Drug Repositioning of Inflammatory Bowel Disease Based on Co-Target Gene Expression Signature of Glucocorticoid Receptor and TET2
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection and Pre-Processing of Public Transcriptomic Datasets
2.2. Acquisition of GR and TET2 Putative Co-Target Genes (GTPCGs)
2.3. Assessment of the Role of GR and TET2 in IBD
2.4. Differential Expression Gene Analysis
2.5. Identification of Specific Gene Signatures in UC and CD and Functional Enrichment Analysis
2.6. Cell-Type-Specific Enrichment Analysis
2.7. Cell Culture and In Vitro Inflammatory Model
2.8. RNA-Seq Library Construction, Sequencing, and Data Analysis
2.9. Gene Set Enrichment Analysis
2.10. Rank-Rank Hypergeometric Overlap (RRHO) Analysis and Acquisition of Distinct Gene Signatures from the In Vitro Inflammation Model
2.11. Connectivity Map (CMap) Analysis
2.12. Cell Viability Assay and In Vitro Treatment with Candidate Compounds
2.13. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.14. Statistical Analysis
3. Results
3.1. Implications of GR and TET2 Regulation in IBD
3.2. Identification of DEGs Associated with UC and CD
3.3. Molecular Mechanisms of IBD through GR and TET2-Related Signatures
3.4. Establishment and Comparative Transcriptomic Analysis of Two In Vitro Inflammatory Cell Models
3.5. Screening and Validation of Candidate Small-Molecule Compounds for IBD Treatment
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Caruso, R.; Lo, B.C.; Nunez, G. Host-microbiota interactions in inflammatory bowel disease. Nat. Rev. Immunol. 2020, 20, 411–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, J.T. Pathophysiology of Inflammatory Bowel Diseases. N. Engl. J. Med. 2020, 383, 2652–2664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ventham, N.T.; Kennedy, N.A.; Nimmo, E.R.; Satsangi, J. Beyond gene discovery in inflammatory bowel disease: The emerging role of epigenetics. Gastroenterology 2013, 145, 293–308. [Google Scholar] [CrossRef] [Scilit]
- Al-Bawardy, B.; Shivashankar, R.; Proctor, D.D. Novel and Emerging Therapies for Inflammatory Bowel Disease. Front. Pharmacol. 2021, 12, 651415. [Google Scholar] [CrossRef] [Scilit]
- Kriger-Sharabi, O.A.; Kopylov, U. Harnessing the Power of Precision Medicine and Novel Biomarkers to Treat Crohn’s Disease. J. Clin. Med. 2023, 12, 2696. [Google Scholar] [CrossRef] [Scilit]
- Subramanian, A.; Narayan, R.; Corsello, S.M.; Peck, D.D.; Natoli, T.E.; Lu, X.; Gould, J.; Davis, J.F.; Tubelli, A.A.; Asiedu, J.K.; et al. A Next Generation Connectivity Map: L1000 Platform and the First 1,000,000 Profiles. Cell 2017, 171, 1437–1452.e1417. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Liu, X.; Peng, C.; Tan, C.; Sun, H.; Liu, H.; Zhang, Y.; Wu, P.; Cui, C.; Liu, C.; et al. The phytochemical hyperforin triggers thermogenesis in adipose tissue via a Dlat-AMPK signaling axis to curb obesity. Cell Metab. 2021, 33, 565–580.e567. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Peng, M.; Chen, P.; Liu, C.; Hu, A.; Zhang, Y.; Peng, J.; Liu, J.; Li, Y.; Li, W.; et al. Imatinib and methazolamide ameliorate COVID-19-induced metabolic complications via elevating ACE2 enzymatic activity and inhibiting viral entry. Cell Metab. 2022, 34, 424–440.e427. [Google Scholar] [CrossRef] [Scilit]
- Quatrini, L.; Ugolini, S. New insights into the cell- and tissue-specificity of glucocorticoid actions. Cell Mol. Immunol. 2021, 18, 269–278. [Google Scholar] [CrossRef] [Scilit]
- Kadmiel, M.; Cidlowski, J.A. Glucocorticoid receptor signaling in health and disease. Trends Pharmacol. Sci. 2013, 34, 518–530. [Google Scholar] [CrossRef] [Scilit]
- Escoter-Torres, L.; Caratti, G.; Mechtidou, A.; Tuckermann, J.; Uhlenhaut, N.H.; Vettorazzi, S. Fighting the Fire: Mechanisms of Inflammatory Gene Regulation by the Glucocorticoid Receptor. Front. Immunol. 2019, 10, 1859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muzzi, C.; Watanabe, N.; Twomey, E.; Meers, G.K.; Reichardt, H.M.; Bohnenberger, H.; Reichardt, S.D. The Glucocorticoid Receptor in Intestinal Epithelial Cells Alleviates Colitis and Associated Colorectal Cancer in Mice. Cell Mol. Gastroenterol. Hepatol. 2021, 11, 1505–1518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cong, B.; Zhang, Q.; Cao, X. The function and regulation of TET2 in innate immunity and inflammation. Protein Cell 2021, 12, 165–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Zhang, Y.; Wang, C.; Wang, X. TET (Ten-eleven translocation) family proteins: Structure, biological functions and applications. Signal Transduct. Target. Ther. 2023, 8, 297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fuster, J.; MacLauchian, S.; Zuriaga, M.; Polackal, M.; Ostriker, A.; Chakraborty, R.; Wu, C.; Sano, S.; Muralidharan, S.; Rius, C. Clonal hematopoiesis associated with TET2 deficiency accelerates a therosclerosis development in mice. Science 2017, 355, 842–847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Zhao, K.; Shen, Q.; Han, Y.; Gu, Y.; Li, X.; Zhao, D.; Liu, Y.; Wang, C.; Zhang, X.; et al. Tet2 is required to resolve inflammation by recruiting Hdac2 to specifically repress IL-6. Nature 2015, 525, 389–393. [Google Scholar] [CrossRef] [Scilit]
- Morante-Palacios, O.; Ciudad, L.; Micheroli, R.; de la Calle-Fabregat, C.; Li, T.; Barbisan, G.; Houtman, M.; Edalat, S.G.; Frank-Bertoncelj, M.; Ospelt, C.; et al. Coordinated glucocorticoid receptor and MAFB action induces tolerogenesis and epigenome remodeling in dendritic cells. Nucleic Acids Res. 2022, 50, 108–126. [Google Scholar] [CrossRef] [Scilit]
- Costello, C.M.; Mah, N.; Hasler, R.; Rosenstiel, P.; Waetzig, G.H.; Hahn, A.; Lu, T.; Gurbuz, Y.; Nikolaus, S.; Albrecht, M.; et al. Dissection of the inflammatory bowel disease transcriptome using genome-wide cDNA microarrays. PLoS Med. 2005, 2, e199. [Google Scholar] [CrossRef] [Scilit]
- Perez, K.; Ngollo, M.; Rabinowitz, K.; Hammoudi, N.; Seksik, P.; Xavier, R.J.; Daly, M.J.; Dotan, I.; Le Bourhis, L.; Allez, M. Meta-Analysis of IBD Gut Samples Gene Expression Identifies Specific Markers of Ileal and Colonic Diseases. Inflamm. Bowel Dis. 2022, 28, 775–782. [Google Scholar] [CrossRef] [Scilit]
- Dovrolis, N.; Filidou, E.; Tarapatzi, G.; Kokkotis, G.; Spathakis, M.; Kandilogiannakis, L.; Drygiannakis, I.; Valatas, V.; Arvanitidis, K.; Karakasiliotis, I.; et al. Co-expression of fibrotic genes in inflammatory bowel disease; A localized event? Front. Immunol. 2022, 13, 1058237. [Google Scholar] [CrossRef] [Scilit]
- Leek, J.T.; Johnson, W.E.; Parker, H.S.; Jaffe, A.E.; Storey, J.D. The sva package for removing batch effects and other unwanted variation in high-throughput experiments. Bioinformatics 2012, 28, 882–883. [Google Scholar] [CrossRef] [Scilit]
- Zheng, R.; Wan, C.; Mei, S.; Qin, Q.; Wu, Q.; Sun, H.; Chen, C.H.; Brown, M.; Zhang, X.; Meyer, C.A.; et al. Cistrome Data Browser: Expanded datasets and new tools for gene regulatory analysis. Nucleic Acids Res. 2019, 47, D729–D735. [Google Scholar] [CrossRef] [Scilit]
- McLean, C.Y.; Bristor, D.; Hiller, M.; Clarke, S.L.; Schaar, B.T.; Lowe, C.B.; Wenger, A.M.; Bejerano, G. GREAT improves functional interpretation of cis-regulatory regions. Nat. Biotechnol. 2010, 28, 495–501. [Google Scholar] [CrossRef] [Scilit]
- Yu, B.; Yin, Y.X.; Tang, Y.P.; Wei, K.L.; Pan, Z.G.; Li, K.Z.; Guo, X.W.; Hu, B.L. Diagnostic and Predictive Value of Immune-Related Genes in Crohn’s Disease. Front. Immunol. 2021, 12, 643036. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Li, X.; Zhang, S.; Qi, C.; Zhang, Z.; Ma, R.; Xiang, L.; Chen, L.; Zhu, Y.; Tang, C.; et al. Oxidative stress gene expression, DNA methylation, and gut microbiota interaction trigger Crohn’s disease: A multi-omics Mendelian randomization study. BMC Med. 2023, 21, 179. [Google Scholar] [CrossRef] [Scilit]
- Pan, Z.; Lin, H.; Fu, Y.; Zeng, F.; Gu, F.; Niu, G.; Fang, J.; Gu, B. Identification of gene signatures associated with ulcerative colitis and the association with immune infiltrates in colon cancer. Front. Immunol. 2023, 14, 1086898. [Google Scholar] [CrossRef] [Scilit]
- Vanhove, W.; Peeters, P.M.; Staelens, D.; Schraenen, A.; Van der Goten, J.; Cleynen, I.; De Schepper, S.; Van Lommel, L.; Reynaert, N.L.; Schuit, F.; et al. Strong Upregulation of AIM2 and IFI16 Inflammasomes in the Mucosa of Patients with Active Inflammatory Bowel Disease. Inflamm. Bowel Dis. 2015, 21, 2673–2682. [Google Scholar] [CrossRef] [Scilit]
- Keir, M.E.; Fuh, F.; Ichikawa, R.; Acres, M.; Hackney, J.A.; Hulme, G.; Carey, C.D.; Palmer, J.; Jones, C.J.; Long, A.K.; et al. Regulation and Role of alphaE Integrin and Gut Homing Integrins in Migration and Retention of Intestinal Lymphocytes during Inflammatory Bowel Disease. J. Immunol. 2021, 207, 2245–2254. [Google Scholar] [CrossRef] [Scilit]
- Lee, M.; Kim, Y.S.; Lim, S.; Shin, S.H.; Kim, I.; Kim, J.; Choi, M.; Kim, J.H.; Koh, S.J.; Park, J.W.; et al. Protein stabilization of ITF2 by NF-kappaB prevents colitis-associated cancer development. Nat. Commun. 2023, 14, 2363. [Google Scholar] [CrossRef] [Scilit]
- Newman, A.M.; Liu, C.L.; Green, M.R.; Gentles, A.J.; Feng, W.; Xu, Y.; Hoang, C.D.; Diehn, M.; Alizadeh, A.A. Robust enumeration of cell subsets from tissue expression profiles. Nat. Methods 2015, 12, 453–457. [Google Scholar] [CrossRef] [Scilit]
- Newman, A.M.; Steen, C.B.; Liu, C.L.; Gentles, A.J.; Chaudhuri, A.A.; Scherer, F.; Khodadoust, M.S.; Esfahani, M.S.; Luca, B.A.; Steiner, D.; et al. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nat. Biotechnol. 2019, 37, 773–782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [Scilit]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef] [Scilit]
- Kuleshov, M.V.; Jones, M.R.; Rouillard, A.D.; Fernandez, N.F.; Duan, Q.; Wang, Z.; Koplev, S.; Jenkins, S.L.; Jagodnik, K.M.; Lachmann, A.; et al. Enrichr: A comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 2016, 44, W90–W97. [Google Scholar] [CrossRef] [Scilit]
- Dai, Y.; Hu, R.; Manuel, A.M.; Liu, A.; Jia, P.; Zhao, Z. CSEA-DB: An omnibus for human complex trait and cell type associations. Nucleic Acids Res. 2021, 49, D862–D870. [Google Scholar] [CrossRef] [Scilit]
- Dai, Y.; Hu, R.; Liu, A.; Cho, K.S.; Manuel, A.M.; Li, X.; Dong, X.; Jia, P.; Zhao, Z. WebCSEA: Web-based cell-type-specific enrichment analysis of genes. Nucleic Acids Res. 2022, 50, W782–W790. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.-j.; Xu, B.; Huang, S.-w.; Luo, X.; Deng, X.-l.; Luo, S.; Liu, C.; Wang, Q.; Chen, J.-y.; Zhou, L. Baicalin prevents LPS-induced activation of TLR4/NF-κB p65 pathway and inflammation in mice via inhibiting the expression of CD14. Acta Pharmacol. Sin. 2020, 42, 88–96. [Google Scholar] [CrossRef] [Scilit]
- Guo, C.; Guo, D.; Fang, L.; Sang, T.; Wu, J.; Guo, C.; Wang, Y.; Wang, Y.; Chen, C.; Chen, J.; et al. Ganoderma lucidum polysaccharide modulates gut microbiota and immune cell function to inhibit inflammation and tumorigenesis in colon. Carbohydr. Polym. 2021, 267, 118231. [Google Scholar] [CrossRef] [Scilit]
- Zhu, G.; Cheng, Z.; Lin, C.; Hoffman, R.M.; Huang, Y.; Singh, S.R.; Zheng, W.; Yang, S.; Ye, J. MyD88 Regulates LPS-induced NF-kB/MAPK Cytokines and Promotes Inflammation and Malignancy in Colorectal Cancer Cells. Cancer Genom. Proteom. 2019, 16, 409–419. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Chen, S.; Wang, J.; Chen, Y.; Guo, Y.; Wang, Q.; Liu, Z.; Zeng, H.; Xu, C. Olfactomedin-4 deletion exacerbates DSS-induced colitis through a matrix metalloproteinase-9-dependent mechanism. Int. J. Biol. Sci. 2023, 19, 2150–2166. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Scilit]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef] [Scilit]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plaisier, S.B.; Taschereau, R.; Wong, J.A.; Graeber, T.G. Rank-rank hypergeometric overlap: Identification of statistically significant overlap between gene-expression signatures. Nucleic Acids Res. 2010, 38, e169. [Google Scholar] [CrossRef] [Scilit]
- Cahill, K.M.; Huo, Z.; Tseng, G.C.; Logan, R.W.; Seney, M.L. Improved identification of concordant and discordant gene expression signatures using an updated rank-rank hypergeometric overlap approach. Sci. Rep. 2018, 8, 9588. [Google Scholar] [CrossRef] [Scilit]
- Hettne, K.M.; Williams, A.J.; van Mulligen, E.M.; Kleinjans, J.; Tkachenko, V.; Kors, J.A. Automatic vs. manual curation of a multi-source chemical dictionary: The impact on text mining. J. Cheminformatics 2010, 2, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clark, P.M.; Dawany, N.; Dampier, W.; Byers, S.W.; Pestell, R.G.; Tozeren, A. Bioinformatics analysis reveals transcriptome and microRNA signatures and drug repositioning targets for IBD and other autoimmune diseases. Inflamm. Bowel Dis. 2012, 18, 2315–2333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sina, C.; Kemper, C.; Derer, S. The intestinal complement system in inflammatory bowel disease: Shaping intestinal barrier function. Semin. Immunol. 2018, 37, 66–73. [Google Scholar] [CrossRef] [Scilit]
- Smillie, C.S.; Biton, M.; Ordovas-Montanes, J.; Sullivan, K.M.; Burgin, G.; Graham, D.B.; Herbst, R.H.; Rogel, N.; Slyper, M.; Waldman, J.; et al. Intra- and Inter-cellular Rewiring of the Human Colon during Ulcerative Colitis. Cell 2019, 178, 714–730. [Google Scholar] [CrossRef] [Scilit]
- Graham, D.B.; Xavier, R.J. Pathway paradigms revealed from the genetics of inflammatory bowel disease. Nature 2020, 578, 527–539. [Google Scholar] [CrossRef] [Scilit]
- Eissa, N.; Hussein, H.; Mesgna, R.; Bonin, S.; Hendy, G.N.; Metz-Boutigue, M.H.; Bernstein, C.N.; Ghia, J.E. Catestatin Regulates Epithelial Cell Dynamics to Improve Intestinal Inflammation. Vaccines 2018, 6, 67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rathinam, V.A.K.; Zhao, Y.; Shao, F. Innate immunity to intracellular LPS. Nat. Immunol. 2019, 20, 527–533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, D.; Bhave, S.; Gregg, E.; Uht, R. Dexamethasone Induces a Putative Repressor Complex and Chromatin Modifications in the CRH Promoter. Mol. Endocrinol. 2013, 27, 1142–1152. [Google Scholar] [CrossRef] [Scilit]
- Campbell, E.L.; Bruyninckx, W.J.; Kelly, C.J.; Glover, L.E.; McNamee, E.N.; Bowers, B.E.; Bayless, A.J.; Scully, M.; Saeedi, B.J.; Golden-Mason, L.; et al. Transmigrating neutrophils shape the mucosal microenvironment through localized oxygen depletion to influence resolution of inflammation. Immunity 2014, 40, 66–77. [Google Scholar] [CrossRef] [Scilit]
- Luo, C.; Zhang, H. The Role of Proinflammatory Pathways in the Pathogenesis of Colitis-Associated Colorectal Cancer. Mediat. Inflamm. 2017, 2017, 5126048. [Google Scholar] [CrossRef] [Scilit]
- Wittman, M.; Carboni, J.; Attar, R.; Balasubramanian, B.; Balimane, P.; Brassil, P.; Beaulieu, F.; Chang, C.; Clarke, W.; Dell, J. Discovery of a (1H-benzoimidazol-2-yl)-1H-pyridin-2-one (BMS-536924) inhibitor of insulin-like growth factor I receptor kinase with in vivo antitumor activity. J. Med. Chem. 2005, 48, 5639–5643. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Q. BMS-536924, an ATP-competitive IGF-1R/IR inhibitor, decreases viability and migration of temozolomide-resistant glioma cells in vitro and suppresses tumor growth in vivo. Onco Targets Ther. 2015, 8, 689–697. [Google Scholar] [CrossRef] [Scilit]
- Crudden, C.; Song, D.; Cismas, S.; Trocme, E.; Pasca, S.; Calin, G.A.; Girnita, A.; Girnita, L. Below the Surface: IGF-1R Therapeutic Targeting and Its Endocytic Journey. Cells 2019, 8, 1223. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Dong, R.; Yu, J.; Yi, S.; Da, J.; Yu, F.; Zha, Y. Inhibitor of IGF1 receptor alleviates the inflammation process in the diabetic kidney mouse model without activating SOCS2. Drug Des. Devel Ther. 2018, 12, 2887–2896. [Google Scholar] [CrossRef] [Scilit]





| Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) | Product Size |
|---|---|---|---|
| GAPDH | ACCTGACCTGCCGTCTAGAA | GGTGTCGCTGTTGAAGTCAGA | 140 |
| TLR4 | GGCATCTTCAATGGCTTGTCC | AGAGGTCCAGGAAGGTCAAGT | 118 |
| TNF-α | CAACCTCCTCTCTGCCATCAAG | GATAGTCGGGCCGATTGATCTC | 152 |
| IL-6 | TGCAATAACCACCCCTGACC | ATTTGCCGAAGAGCCCTCAG | 150 |
| NR3C1 | GTGGAAGGACAGCACAATTACC | CCTGTAGTGGCCTGCTGAAT | 173 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, X.; Hu, C.; Chen, X.; Ren, S.; Gao, F. Drug Repositioning of Inflammatory Bowel Disease Based on Co-Target Gene Expression Signature of Glucocorticoid Receptor and TET2. Biology 2024, 13, 82. https://doi.org/10.3390/biology13020082
Zhao X, Hu C, Chen X, Ren S, Gao F. Drug Repositioning of Inflammatory Bowel Disease Based on Co-Target Gene Expression Signature of Glucocorticoid Receptor and TET2. Biology. 2024; 13(2):82. https://doi.org/10.3390/biology13020082
Chicago/Turabian StyleZhao, Xianglin, Chenghao Hu, Xinyu Chen, Shuqiang Ren, and Fei Gao. 2024. "Drug Repositioning of Inflammatory Bowel Disease Based on Co-Target Gene Expression Signature of Glucocorticoid Receptor and TET2" Biology 13, no. 2: 82. https://doi.org/10.3390/biology13020082
APA StyleZhao, X., Hu, C., Chen, X., Ren, S., & Gao, F. (2024). Drug Repositioning of Inflammatory Bowel Disease Based on Co-Target Gene Expression Signature of Glucocorticoid Receptor and TET2. Biology, 13(2), 82. https://doi.org/10.3390/biology13020082

