D-Carvone Attenuates CCl4-Induced Liver Fibrosis in Rats by Inhibiting Oxidative Stress and TGF-ß 1/SMAD3 Signaling Pathway
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. Effect of D-Carvone on Liver Function Indices in CCl4-Induced Liver Fibrosis
2.2. Effect of D-Carvone on Liver Oxidant/Antioxidant Biomarkers in CCl4-Induced Liver Fibrosis
2.3. Effect of D-Carvone on Liver Histopathological Changes in CCl4-Induced Liver Fibrosis
2.4. Effect of D-Carvone on Collagen Deposition in Liver of CCl4-Induced Liver Fibrosis
2.5. Effect of D-Carvone on TGF-β and MMP9 Genes Expression
2.6. Effect of D-Carvone on Hepatic α-SMA, TGF-β1, and SMAD3 Protein Expression
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Animals
4.3. Experimental Design
4.4. Serum and Tissue Biomarkers
4.5. Histopathological Assessment
4.6. Quantitative Real-Time PCR Analysis (qRT-PCR)
4.7. Immunohistochemical Assessment
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Poynard, T.; Lebray, P.; Ingiliz, P.; Varaut, A.; Varsat, B.; Ngo, Y.; Norha, P.; Munteanu, M.; Drane, F.; Messous, D.; et al. Prevalence of liver fibrosis and risk factors in a general population using non-invasive biomarkers (FibroTest). BMC Gastroenterol. 2010, 10, 40. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parola, M.; Pinzani, M. Liver fibrosis: Pathophysiology, pathogenetic targets and clinical issues. Mol. Aspects Med. 2019, 65, 37–55. [Google Scholar] [CrossRef] [PubMed]
- Gandhi, C.R. Oxidative stress and hepatic stellate cells: A paradoxical relationship. Trends Cell Mol. Biol. 2012, 7, 1. [Google Scholar] [PubMed]
- Schuppan, D. Liver fibrosis: Common mechanisms and antifibrotic therapies. Clin. Res. Hepatol. Gastroenterol. 2015, 39, S51–S59. [Google Scholar] [CrossRef]
- Prakash, J.; Pinzani, M. Fibroblasts and extracellular matrix: Targeting and therapeutic tools in fibrosis and cancer. Adv. Drug Deliv. Rev. 2017, 121, 1–2. [Google Scholar] [CrossRef]
- Xing, L.; Chang, X.; Shen, L.; Zhang, C.; Fan, Y.; Cho, C.; Zhang, Z.; Jiang, H. Progress in drug delivery system for fibrosis therapy. Asian J. Pharm. Sci. 2021, 16, 47–61. [Google Scholar] [CrossRef]
- Kumar, R.; Rani, R.; Narang, S.K.; Rai, S.; Hajam, Y.A. Hepatotoxicity: Its physiological pathways and control measures using phyto-polyphenols. In Phytomedicine; Elsevier: Amsterdam, The Netherlands, 2021; pp. 621–653. [Google Scholar]
- Abdel-Rahman, R.F.; Fayed, H.M.; Ogaly, H.A.; Hussein, R.A.; Raslan, M. Phytoconstituents of Sansevieria suffruticosa NE Br. Leaves and its Hepatoprotective Effect via Activation of the NRF2/ARE Signaling Pathway in an Experimentally Induced Liver Fibrosis Rat Model. Chem. Biodivers. 2022, 19, e202100960. [Google Scholar] [CrossRef]
- Gopalakrishnan, T.; Ganapathy, S.; Veeran, V.; Namasivayam, N. Preventive effect of D-carvone during DMBA induced mouse skin tumorigenesis by modulating xenobiotic metabolism and induction of apoptotic events. Biomed. Pharmacother. 2019, 111, 178–187. [Google Scholar] [CrossRef]
- Younis, Y.M.H.; Beshir, S.M. Carvone-Rich Essential Oils from Mentha longifolia (L.) Huds. ssp. schimperi Briq. and Mentha spicata L. Grown in Sudan. J. Essent. Oil Res. 2004, 16, 539–541. [Google Scholar] [CrossRef]
- Pina, L.T.S.; Serafini, M.R.; Oliveira, M.A.; Sampaio, L.A.; Guimarães, J.O.; Guimarães, A.G. Carvone and its pharmacological activities: A systematic review. Phytochemistry 2022, 196, 113080. [Google Scholar] [CrossRef]
- Jäger, W.; Mayer, M.; Platzer, P.; Reznicek, G.; Dietrich, H.; Buchbauer, G. Stereoselective metabolism of the monoterpene carvone by rat and human liver microsomes. J. Pharm. Pharmacol. 2000, 52, 191–197. [Google Scholar] [CrossRef]
- Vinothkumar, R.; Sudha, M.; Viswanathan, P.; Kabalimoorthy, J.; Balasubramanian, T.; Nalini, N. Modulating effect of d-carvone on 1,2-dimethylhydrazine-induced pre-neoplastic lesions, oxidative stress and biotransforming enzymes, in an experimental model of rat colon carcinogenesis. Cell Prolif. 2013, 46, 705–720. [Google Scholar] [CrossRef]
- Moro, I.J.; Gondo, G.D.G.A.; Pierri, E.G.; Pietro, R.C.L.R.; Soares, C.P.; de Sousa, D.P.; Santos, A.G.d. Evaluation of antimicrobial, cytotoxic and chemopreventive activities of carvone and its derivatives. Braz. J. Pharm. Sci. 2017, 53. [Google Scholar] [CrossRef] [Green Version]
- Lv, L.; Yang, N.; Cao, Y.; Dang, J.; Cheng, L.; El-Sheikh, M.A.; Zhang, Y. d-Carvone inhibits the JAK/STAT3 signaling pathway and induced the apoptotic cell death in the human gastric cancer AGS cells. J. Biochem. Mol. Toxicol. 2021, 35, e22746. [Google Scholar] [CrossRef]
- Alsanea, S.; Liu, D. BITC and S-Carvone Restrain High-Fat Diet-Induced Obesity and Ameliorate Hepatic Steatosis and Insulin Resistance. Pharm. Res. 2017, 34, 2241–2249. [Google Scholar] [CrossRef]
- Rajeshwari, T.; Raja, B. Antioxidant and free radical scavenging effect of D-carvone in hypertensive rats. In vivo and in vitro study. Int. Lett. Nat. Sci. 2015, 8, 6–12. [Google Scholar]
- Asle-Rousta, M.; Amini, R.; Aghazadeh, S. Carvone suppresses oxidative stress and inflammation in the liver of immobilised rats. Arch. Physiol. Biochem. 2020, 1–6. [Google Scholar] [CrossRef]
- Rajeshwari, T.; Raja, B. D-carvone, a monoterpene reverses alterations in heart rate, nitric oxide, aortic lipids and enzymatic antioxidant status in nitric oxide deficient hypertensive rats. Int. Lett. Nat. Sci. 2015, 5, 19–31. [Google Scholar] [CrossRef] [Green Version]
- Zheng, G.Q.; Kenney, P.M.; Lam, L.K.T. Effects of carvone compounds on glutathione S-transferase activity in A/J mice. J. Agric. Food Chem. 1992, 40, 751–755. [Google Scholar] [CrossRef]
- Murcia, H.W.; Diaz, G.J. Protective effect of glutathione S-transferase enzyme activity against aflatoxin B1 in poultry species: Relationship between glutathione S-transferase enzyme kinetic parameters, and resistance to aflatoxin B1. Poult. Sci. 2021, 100, 101235. [Google Scholar] [CrossRef]
- Galicia-Moreno, M.; Lucano-Landeros, S.; Monroy-Ramirez, H.C.; Silva-Gomez, J.; Gutierrez-Cuevas, J.; Santos, A.; Armendariz-Borunda, J. Roles of Nrf2 in Liver Diseases: Molecular, Pharmacological, and Epigenetic Aspects. Antioxidants 2020, 9, 980. [Google Scholar] [CrossRef]
- Tang, L.-Y.; Heller, M.; Meng, Z.; Yu, L.-R.; Tang, Y.; Zhou, M.; Zhang, Y.E. Transforming growth factor-β (TGF-β) directly activates the JAK1-STAT3 axis to induce hepatic fibrosis in coordination with the SMAD pathway. J. Biol. Chem. 2017, 292, 4302–4312. [Google Scholar] [CrossRef] [Green Version]
- Dai, M.; Wu, L.; Yu, K.; Xu, R.; Wei, Y.; Chinnathambi, A.; Alahmadi, T.A.; Zhou, M. D-Carvone inhibit cerebral ischemia/reperfusion induced inflammatory response TLR4/NLRP3 signaling pathway. Biomed. Pharmacother. 2020, 132, 110870. [Google Scholar] [CrossRef]
- Zhao, M.; Du, J. Anti-inflammatory and protective effects of D-carvone on lipopolysaccharide (LPS)-induced acute lung injury in mice. J. King Saud Univ. 2020, 32, 1592–1596. [Google Scholar] [CrossRef]
- Schuppan, D.; Kim, Y.O. Evolving therapies for liver fibrosis. J. Clin. Investig. 2013, 123, 1887–1901. [Google Scholar] [CrossRef] [Green Version]
- Chen, D.-Q.; Feng, Y.-L.; Cao, G.; Zhao, Y.-Y. Natural products as a source for antifibrosis therapy. Trends Pharmacol. Sci. 2018, 39, 937–952. [Google Scholar] [CrossRef]
- Dong, X.; Alahmadi, T.A.; Alharbi, S.A.; Yang, Y. Antiresproative potency of D-carvone on ovariectomy-induced osteoporosis in rats. Phcog. Mag. 2021, 17, 529–538. [Google Scholar] [CrossRef]
- Khamis, G.; Hassan, M.; Morsy, M.; Ibrahim, M.A.; Abd-Elsalam, R.M.; el Badawy, S.A.; Azouz, A.A.; Galal, M. Innovative application of helium-neon laser: Enhancing the germination of Adansonia digitata and evaluating the hepatoprotective activities in mice. Environ. Sci. Pollut. Res. 2020, 27, 26520–26531. [Google Scholar] [CrossRef]
- Weber, L.W.D.; Boll, M.; Stampfl, A. Hepatotoxicity and mechanism of action of haloalkanes: Carbon tetrachloride as a toxicological model. Crit. Rev. Toxicol. 2003, 33, 105–136. [Google Scholar] [CrossRef]
- Dong, S.; Chen, Q.-L.; Song, Y.-N.; Sun, Y.; Wei, B.; Li, X.-Y.; Hu, Y.-Y.; Liu, P.; Su, S.-B. Mechanisms of CCl4-induced liver fibrosis with combined transcriptomic and proteomic analysis. J. Toxicol. Sci. 2016, 41, 561–572. [Google Scholar] [CrossRef] [Green Version]
- Williams, A.T.; Burk, R.F. Carbon tetrachloride hepatotoxicity: An example of free radical-mediated injury. Semin. Liver Dis. 1990, 10, 279–284. [Google Scholar] [CrossRef]
- Cichoż-Lach, H.; Michalak, A. Oxidative stress as a crucial factor in liver diseases. World J. Gastroenterol. WJG 2014, 20, 8082. [Google Scholar] [CrossRef]
- Dutta, S.; Chakraborty, A.K.; Dey, P.; Kar, P.; Guha, P.; Sen, S.; Kumar, A.; Sen, A.; Chaudhuri, T.K. Amelioration of CCl4 induced liver injury in swiss albino mice by antioxidant rich leaf extract of Croton bonplandianus Baill. PLoS ONE 2018, 13, e0196411. [Google Scholar] [CrossRef] [Green Version]
- Chen, G.; Song, Y.; Ma, F.; Ma, Y. Anti-arthritic activity of D-carvone against complete Freund’s adjuvant-induced arthritis in rats through modulation of inflammatory cytokines. Korean J. Physiol. Pharmacol. 2020, 24, 453–462. [Google Scholar] [CrossRef]
- Muruganathan, U.; Srinivasan, S. Beneficial effect of carvone, a dietary monoterpene ameliorates hyperglycemia by regulating the key enzymes activities of carbohydrate metabolism in streptozotocin-induced diabetic rats. Biomed. Pharmacother. 2016, 84, 1558–1567. [Google Scholar] [CrossRef]
- Zhang, S.; Bi, L.; Wang, Q.; Wang, D.; Tian, Y.; Zheng, Z.; Han, Y. Immunomodulatory effect of d-carvone in swiss albino mice with benzo (a) pyrene-induced lung cancer. Pharmacogn. Mag. 2021, 17, 51. [Google Scholar]
- Al-Sayed, E.; Abdel-Daim, M.M.; Khattab, M.A. Hepatoprotective activity of praecoxin A isolated from Melaleuca ericifolia against carbon tetrachloride-induced hepatotoxicity in mice. Impact on oxidative stress, inflammation, and apoptosis. Phyther. Res. 2019, 33, 461–470. [Google Scholar] [CrossRef]
- Luangmonkong, T.; Suriguga, S.; Mutsaers, H.A.M.; Groothuis, G.M.M.; Olinga, P.; Boersema, M. Targeting oxidative stress for the treatment of liver fibrosis. Rev. Physiol. Biochem. Pharmacol. 2018, 175, 71–102. [Google Scholar]
- Abdel-Daim, M.M.; Abdeen, A.; Jalouli, M.; Abdelkader, A.; Megahed, A.; Alkahtane, A.; Almeer, R.; Alhoshani, N.M.; Al-Johani, N.S.; Alkahtani, S. Fucoidan supplementation modulates hepato-renal oxidative stress and DNA damage induced by aflatoxin B1 intoxication in rats. Sci. Total Environ. 2021, 768, 144781. [Google Scholar] [CrossRef]
- Chang, S.N.; Kim, S.H.; Dey, D.K.; Park, S.M.; Nasif, O.; Bajpai, V.K.; Kang, S.C.; Lee, J.T.; Park, J.G. 5-O-Demethylnobiletin Alleviates CCl4-Induced Acute Liver Injury by Equilibrating ROS-Mediated Apoptosis and Autophagy Induction. Int. J. Mol. Sci. 2021, 22, 1083. [Google Scholar] [CrossRef]
- Ogaly, H.A.; Eltablawy, N.A.; Abd-Elsalam, R.M. Antifibrogenic influence of Mentha piperita L. essential oil against CCl4-induced liver fibrosis in rats. Oxid. Med. Cell. Longev. 2018, 2018, 4039753. [Google Scholar] [CrossRef] [Green Version]
- Zhou, J.; Zheng, Q.; Chen, Z. The Nrf2 Pathway in Liver Diseases. Front. Cell Dev. Biol. 2022, 10, 1–14. [Google Scholar] [CrossRef]
- Foroutan, T.; Ahmadi, F.; Moayer, F.; Khalvati, S. Effects of intraperitoneal injection of magnetic graphene oxide on the improvement of acute liver injury induced by CCl 4. Biomater. Res. 2020, 24, 14. [Google Scholar] [CrossRef]
- Ogaly, H.A.; Eltablawy, N.A.; El-Behairy, A.M.; El-Hindi, H.; Abd-Elsalam, R.M. Hepatocyte growth factor mediates the antifibrogenic action of Ocimum bacilicum essential oil against CCl4-induced liver fibrosis in rats. Molecules 2015, 20, 13518–13535. [Google Scholar] [CrossRef] [Green Version]
- Zhu, X.; Wang, G.; Wu, S.; Li, C. Protective Effect of D-Carvone against Dextran Sulfate Sodium Induced Ulcerative Colitis in Balb/c Mice and LPS Induced RAW Cells via the Inhibition of COX-2 and TNF-α. J. Environ. Pathol. Toxicol. Oncol. 2020, 39, 235–245. [Google Scholar] [CrossRef]
- Kang, W.; Choi, D.; Park, S.; Park, T. Carvone Decreases Melanin Content by Inhibiting Melanoma Cell Proliferation via the Cyclic Adenosine Monophosphate (cAMP) Pathway. Molecules 2020, 25, 5191. [Google Scholar] [CrossRef]
- Elnagdy, M.; Barve, S.; McClain, C.; Gobejishvili, L. cAMP Signaling in Pathobiology of Alcohol Associated Liver Disease. Biomolecules 2020, 10, 1433. [Google Scholar] [CrossRef] [PubMed]
- El Awdan, S.A.; Rahman, R.F.A.; Ibrahim, H.M.; Hegazy, R.R.; el Marasy, S.A.; Badawi, M.; Arbid, M.S. Regression of fibrosis by cilostazol in a rat model of thioacetamide-induced liver fibrosis: Up regulation of hepatic cAMP, and modulation of inflammatory, oxidative stress and apoptotic biomarkers. PLoS ONE 2019, 14, e0216301. [Google Scholar] [CrossRef] [PubMed]
- Inagaki, Y.; Okazaki, I. Emerging insights into transforming growth factor β Smad signal in hepatic fibrogenesis. Gut 2007, 56, 284–292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, J.; Liu, W.; Zeng, Z.; Lin, J.; Zhang, X.; Chen, L. Tgfb3 and Mmp13 regulated the initiation of liver fibrosis progression as dynamic network biomarkers. J. Cell. Mol. Med. 2021, 25, 867–879. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Liu, C.; Zhou, D.; Zhang, L. TGF-β/SMAD Pathway and Its Regulation in Hepatic Fibrosis. J. Histochem. Cytochem. Off. J. Histochem. Soc. 2016, 64, 157–167. [Google Scholar] [CrossRef]
- Malik, S.; Suchal, K.; Khan, S.I.; Bhatia, J.; Kishore, K.; Dinda, A.K.; Arya, D.S. Apigenin ameliorates streptozotocin-induced diabetic nephropathy in rats via MAPK-NF-κB-TNF-α and TGF-β1-MAPK-fibronectin pathways. Am. J. Physiol. Physiol. 2017, 313, F414–F422. [Google Scholar] [CrossRef] [Green Version]
- Pang, Q.; Jin, H.; Wang, Y.; Dai, M.; Liu, S.; Tan, Y.; Liu, H.; Lu, Z. Depletion of serotonin relieves concanavalin A-induced liver fibrosis in mice by inhibiting inflammation, oxidative stress, and TGF-β1/Smads signaling pathway. Toxicol. Lett. 2021, 340, 123–132. [Google Scholar] [CrossRef]
- Mu, M.; Zuo, S.; Wu, R.-M.; Deng, K.-S.; Lu, S.; Zhu, J.-J.; Zou, G.-L.; Yang, J.; Cheng, M.-L.; Zhao, X.-K. Ferulic acid attenuates liver fibrosis and hepatic stellate cell activation via inhibition of TGF-β/Smad signaling pathway. Drug Des. Devel. Ther. 2018, 12, 4107. [Google Scholar] [CrossRef] [Green Version]
- Hu, H.-H.; Chen, D.-Q.; Wang, Y.-N.; Feng, Y.-L.; Cao, G.; Vaziri, N.D.; Zhao, Y.-Y. New insights into TGF-β/Smad signaling in tissue fibrosis. Chem. Biol. Interact. 2018, 292, 76–83. [Google Scholar] [CrossRef] [Green Version]
- Chen, T.-T.; Xiao, F.; Li, N.; Shan, S.; Qi, M.; Wang, Z.-Y.; Zhang, S.-N.; Wei, W.; Sun, W.-Y. Inflammasome as an Effective Platform for Fibrosis Therapy. J. Inflamm. Res. 2021, 14, 1575. [Google Scholar] [CrossRef]
- Pinar, A.A.; Scott, T.E.; Huuskes, B.M.; Cáceres, F.E.T.; Kemp-Harper, B.K.; Samuel, C.S. Targeting the NLRP3 inflammasome to treat cardiovascular fibrosis. Pharmacol. Ther. 2020, 209, 107511. [Google Scholar] [CrossRef]
- Prestigiacomo, V.; Suter-Dick, L. Nrf2 protects stellate cells from Smad-dependent cell activation. PLoS ONE 2018, 13, e0201044. [Google Scholar] [CrossRef] [Green Version]
- Morgan, A.; Galal, M.K.; Ogaly, H.A.; Ibrahim, M.A.; Abd-Elsalam, R.M.; Noshy, P. Tiron ameliorates oxidative stress and inflammation in titanium dioxide nanoparticles induced nephrotoxicity of male rats. Biomed. Pharmacother. 2017, 93, 779–787. [Google Scholar] [CrossRef]
- Duarte, S.; Baber, J.; Fujii, T.; Coito, A.J. Matrix metalloproteinases in liver injury, repair and fibrosis. Matrix Biol. 2015, 44, 147–156. [Google Scholar] [CrossRef]
- Feng, M.; Ding, J.; Wang, M.; Zhang, J.; Zhu, X.; Guan, W. Kupffer-derived matrix metalloproteinase-9 contributes to liver fibrosis resolution. Int. J. Biol. Sci. 2018, 14, 1033. [Google Scholar] [CrossRef]
- Sun, J.; Wu, Y.; Long, C.; He, P.; Gu, J.; Yang, L.; Liang, Y.; Wang, Y. Anthocyanins isolated from blueberry ameliorates CCl(4) induced liver fibrosis by modulation of oxidative stress, inflammation and stellate cell activation in mice. Food Chem. Toxicol. An Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2018, 120, 491–499. [Google Scholar] [CrossRef]
- Li, X.; Peng, J.; Sun, Z.; Tian, H.; Duan, X.; Liu, L.; Ma, X.; Feng, Q.; Liu, P.; Hu, Y. Chinese medicine CGA formula ameliorates DMN-induced liver fibrosis in rats via inhibiting MMP2/9, TIMP1/2 and the TGF-β/Smad signaling pathways. Acta Pharmacol. Sin. 2016, 37, 783–793. [Google Scholar] [CrossRef] [Green Version]
- Shek, F.W.-T.; Benyon, R.C.; Walker, F.M.; McCrudden, P.R.; Pender, S.L.F.; Williams, E.J.; Johnson, P.A.; Johnson, C.D.; Bateman, A.C.; Fine, D.R.; et al. Expression of transforming growth factor-beta 1 by pancreatic stellate cells and its implications for matrix secretion and turnover in chronic pancreatitis. Am. J. Pathol. 2002, 160, 1787–1798. [Google Scholar] [CrossRef]
- El-Baz, F.K.; Salama, A.; Salama, R.A.A. Therapeutic effect of Dunaliella salina microalgae on thioacetamide-(TAA-) induced hepatic liver fibrosis in rats: Role of TGF-β and MMP9. Biomed Res. Int. 2019, 2019, 7028314. [Google Scholar] [CrossRef]
- Zhang, B.; Lai, L.; Tan, Y.; Liang, Q.; Bai, F.; Mai, W.; Huang, Q.; Ye, Y. Hepatoprotective effect of total flavonoids of Mallotus apelta (Lour.) Muell.Arg. leaf against carbon tetrachloride-induced liver fibrosis in rats via modulation of TGF-β1/Smad and NF-κB signaling pathways. J. Ethnopharmacol. 2020, 254, 112714. [Google Scholar] [CrossRef]
- Mirzaei, E.; Sabetian, G.; Masjedi, M.; Heidari, R.; Mirjalili, M.; Dehghanian, A.; Vazin, A. The effect of silymarin on liver enzymes and antioxidant status in trauma patients in the intensive care unit: A randomized double blinded placebo-controlled clinical trial. Clin. Exp. Hepatol. 2021, 7, 149. [Google Scholar] [CrossRef]
- Izadi, F.; Farrokhzad, A.; Tamizifar, B.; Tarrahi, M.J.; Entezari, M.H. Effect of sour tea supplementation on liver enzymes, lipid profile, blood pressure, and antioxidant status in patients with non-alcoholic fatty liver disease: A double-blind randomized controlled clinical trial. Phyther. Res. 2021, 35, 477–485. [Google Scholar] [CrossRef]
- Ntamo, Y.; Ziqubu, K.; Chellan, N.; Nkambule, B.B.; Nyambuya, T.M.; Mazibuko-Mbeje, S.E.; Gabuza, K.B.; Orlando, P.; Tiano, L.; Dludla, P.V. Clinical use of N-acetyl cysteine during liver transplantation: Implications of oxidative stress and inflammation as therapeutic targets. Biomed. Pharmacother. 2022, 147, 112638. [Google Scholar] [CrossRef]
- Salomone, F.; Godos, J.; Zelber-Sagi, S. Natural antioxidants for non-alcoholic fatty liver disease: Molecular targets and clinical perspectives. Liver Int. 2016, 36, 5–20. [Google Scholar] [CrossRef] [PubMed]
- Delgado-Montemayor, C.; Cordero-Pérez, P.; Salazar-Aranda, R.; Waksman-Minsky, N. Models of hepatoprotective activity assessment. Med. Univ. 2015, 17, 222–228. [Google Scholar] [CrossRef] [Green Version]
- Bancroft, J.D.; Gamble, M. Theory and Practice of Histological Techniques, 5th ed.; Churchill Livingstone: London, UK, 2002. [Google Scholar]
- Ishak, K.; Baptista, A.; Bianchi, L.; Callea, F.; de Groote, J.; Gudat, F.; Denk, H.; Desmet, V.; Korb, G.; MacSween, R.N. Histological grading and staging of chronic hepatitis. J. Hepatol. 1995, 22, 696–699. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ogaly, H.A.; Alsherbiny, M.A.; el Badawy, S.A.; Abd-Elsalam, R.M.; Li, C.G.; Azouz, A.A. Gastroprotective effects and metabolomic profiling of Chasteberry fruits against indomethacin-induced gastric injury in rats. J. Funct. Foods 2021, 86, 104732. [Google Scholar] [CrossRef]
- Abdel-Rahman, R.F.; Fayed, H.M.; Asaad, G.F.; Ogaly, H.A.; Hessin, A.F.; Salama, A.A.A.; El-Rahman, S.S.A.; Arbid, M.S.; Mohamed, M.A.E. The involvement of TGF-β1/FAK/α-SMA pathway in the antifibrotic impact of rice bran oil on thioacetamide-induced liver fibrosis in rats. PLoS ONE 2021, 16, e0260130. [Google Scholar] [CrossRef]
- Abdel-Rahman, R.F.; Alqasoumi, S.I.; Ogaly, H.A.; Abd-Elsalam, R.M.; El-Banna, H.A.; Soliman, G.A. Propolis ameliorates cerebral injury in focal cerebral ischemia/reperfusion (I/R) rat model via upregulation of TGF-β1. Saudi Pharm. J. 2020, 28, 116–126. [Google Scholar] [CrossRef]
- Alsharif, I.A.; Fayed, H.M.; Abdel-Rahman, R.F.; Abd-Elsalam, R.M.; Ogaly, H.A. Miconazole Mitigates Acetic Acid-Induced Experimental Colitis in Rats: Insight into Inflammation, Oxidative Stress and Keap1/Nrf-2 Signaling Crosstalk. Biology 2022, 11, 303. [Google Scholar] [CrossRef]
- Ogaly, H.A.; Abdel-Rahman, R.F.; Mohamed, M.; Farid, O.A.; Khattab, M.S.; Abd-Elsalam, R.M. Thymol Ameliorated Neurotoxicity and Cognitive Deterioration in Thioacetamide-Induced Hepatic Encephalopathy Rat Model via Enhanced BDNF/CREB Signaling Pathway. Food Funct. 2022. [Google Scholar] [CrossRef]
- Abu-Elala, N.M.; Abd-Elsalam, R.M.; Marzouk, M.S. Molecular and immunohistochemical diagnosis of Photobacterium damselae subspecies piscicida during naturally occurring disease in Egypt. J. World Aquac. Soc. 2015, 46, 583–595. [Google Scholar] [CrossRef]
- Abd-Elsalam, R.M.; el Badawy, S.A.; Ogaly, H.A.; Ibrahim, F.M.; Farag, O.M.; Ahmed, K.A. Eruca sativa seed extract modulates oxidative stress and apoptosis and up-regulates the expression of Bcl-2 and Bax genes in acrylamide-induced testicular dysfunction in rats. Environ. Sci. Pollut. Res. 2021, 28, 53249–53266. [Google Scholar] [CrossRef]
- El-Marasy, S.A.; Abdel-Rahman, R.F.; Abd-Elsalam, R.M. Neuroprotective effect of vildagliptin against cerebral ischemia in rats. Naunyn. Schmiedebergs. Arch. Pharmacol. 2018, 391, 1133–1145. [Google Scholar] [CrossRef]
Gene | Forward (5′-3′) | Reverse (5′-3′) | Accession # | Ref. |
---|---|---|---|---|
TGFß1 | GGACTCTCCACCTGCAAGAC | CTCTGCAGGCGCAGCTCTG | NM_021578.2 | [77] |
MMP9 | CACTGTAACTGGGGGCAACT | CACTTCTTGTCAGCGTCGAA | NM_031055.2 | [78] |
ß-actin | ATGGTGGGTATGGGTCAG | CAATGCCGTGTTCAATGG | XM_034489257.1 | [79] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ogaly, H.A.; Aldulmani, S.A.A.; Al-Zahrani, F.A.M.; Abd-Elsalam, R.M. D-Carvone Attenuates CCl4-Induced Liver Fibrosis in Rats by Inhibiting Oxidative Stress and TGF-ß 1/SMAD3 Signaling Pathway. Biology 2022, 11, 739. https://doi.org/10.3390/biology11050739
Ogaly HA, Aldulmani SAA, Al-Zahrani FAM, Abd-Elsalam RM. D-Carvone Attenuates CCl4-Induced Liver Fibrosis in Rats by Inhibiting Oxidative Stress and TGF-ß 1/SMAD3 Signaling Pathway. Biology. 2022; 11(5):739. https://doi.org/10.3390/biology11050739
Chicago/Turabian StyleOgaly, Hanan A., Sharah A. A. Aldulmani, Fatimah A. M. Al-Zahrani, and Reham M. Abd-Elsalam. 2022. "D-Carvone Attenuates CCl4-Induced Liver Fibrosis in Rats by Inhibiting Oxidative Stress and TGF-ß 1/SMAD3 Signaling Pathway" Biology 11, no. 5: 739. https://doi.org/10.3390/biology11050739
APA StyleOgaly, H. A., Aldulmani, S. A. A., Al-Zahrani, F. A. M., & Abd-Elsalam, R. M. (2022). D-Carvone Attenuates CCl4-Induced Liver Fibrosis in Rats by Inhibiting Oxidative Stress and TGF-ß 1/SMAD3 Signaling Pathway. Biology, 11(5), 739. https://doi.org/10.3390/biology11050739