Next Article in Journal
Tetrapeptides Modelled to the Androgen Binding Site of ZIP9 Stimulate Expression of Tight Junction Proteins and Tight Junction Formation in Sertoli Cells
Next Article in Special Issue
Comprehensive Identification and Expression Profiling of the VQ Motif-Containing Gene Family in Brassica juncea
Previous Article in Journal
Companion Animal Model in Translational Oncology; Feline Oral Squamous Cell Carcinoma and Canine Oral Melanoma
Previous Article in Special Issue
Targeting Penicillium expansum GMC Oxidoreductase with High Affinity Small Molecules for Reducing Patulin Production
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 11
Issue 1
10.3390/biology11010053
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization and Functional Localization of a Novel SUMOylation Gene in Oryza sativa

by
Eid I. Ibrahim
1,*,
Kotb A. Attia
2,3,*,
Abdelhalim I. Ghazy
1,
Kimiko Itoh
4,
Fahad N. Almajhdi
5 and
Abdullah A. Al-Doss
1
1
Biotechnology Lab., Plant Production Department, College of Food and Agriculture Sciences, King Saud University, P.O. Box 2460, Riyadh 11451, Saudi Arabia
2
Center of Excellence in Biotechnology Research, King Saud University, P.O. Box 2455-11451, Riyadh 11451, Saudi Arabia
3
Rice Biotechnology Lab., Rice Research Department, Field Crops Research Institute, ARC, Sakha, Kafr, EL-Sheikh 33717, Egypt
4
Institute of Science and Technology, Niigata University, Niigata 950-2181, Japan
5
Department of Botany and Microbiology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Saudi Arabia
*
Authors to whom correspondence should be addressed.
Biology 2022, 11(1), 53; https://doi.org/10.3390/biology11010053
Submission received: 18 November 2021 / Revised: 19 December 2021 / Accepted: 28 December 2021 / Published: 31 December 2021
(This article belongs to the Special Issue Plant Functional Genomics in the Era of Omics Approaches)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

The small ubiquitin-related modifier genes regulate the function of the cellular proteins, which are associated with cell stress-tolerance. Identification and understanding the functional localization of these genes are very important to mitigate the stresses. In this study, we identified a novel small ubiquitin-related modifier gene and studied its functional localization in the cell. This new finding will be very valuable in increasing our understanding of the mechanism of stress-tolerance.

Abstract

Small ubiquitin-related modifier (SUMO) regulates the cellular function of diverse proteins through post-translational modifications. The current study defined a new homolog of SUMO genes in the rice genome and named it OsSUMO7. Putative protein analysis of OsSUMO7 detected SUMOylation features, including di-glycine (GG) and consensus motifs (ΨKXE/D) for the SUMOylation site. Phylogenetic analysis demonstrated the high homology of OsSUMO7 with identified rice SUMO genes, which indicates that the OsSUMO7 gene is an evolutionarily conserved SUMO member. RT-PCR analysis revealed that OsSUMO7 was constitutively expressed in all plant organs. Bioinformatic analysis defined the physicochemical properties and structural model prediction of OsSUMO7 proteins. A red fluorescent protein (DsRed), fused with the OsSUMO7 protein, was expressed and localized mainly in the nucleus and formed nuclear subdomain structures. The fusion proteins of SUMO-conjugating enzymes with the OsSUMO7 protein were co-expressed and co-localized in the nucleus and formed nuclear subdomains. This indicated that the OsSUMO7 precursor is processed, activated, and transported to the nucleus through the SUMOylation system of the plant cell.

1. Introduction

Post-translational modifications (PTMs) of proteins play an essential role in a majority of various cellular processes [1,2,3]. PTMs of proteins occur through various mechanisms such as acetylation, phosphorylation, glycosylation, ubiquitination (Ub), and SUMOylation [4,5]. The small ubiquitin-related modifier (SUMO) is an essential regulator of different biological processes [3,6]. SUMO, a low-molecular-weight protein about 100 amino acids in length, is a form of a ubiquitin-like protein (Ubl) in structure but is different in function [7]. The inconsistency of this functional mechanism is because ubiquitination is involved in proteasomal degradation while SUMOylation suppresses this degradation to change the target protein’s localization [8,9,10]. The SUMO protein is present in all eukaryotic cells and has emerged as an influential mechanism for target protein management [1,11]. SUMO has a consolidated center sequence as well as N- and C-variable terminal sequences. It is only approximately 20 percent similar to Ub, but comparable to Ub in that it has a three-dimensional (3D) structure [12]. The SUMO system contains several protein isoforms which participate in SUMOylation reactions [4]. SUMOylation is a mechanism that occurs in the nucleus and cytoplasm via a cascade of parallel enzymatic reactions, including activation enzymes (E1-SUMO), conjugation enzymes (E2-SUMO), and ligation enzymes (E3-SUMO) [13,14]. It often occurs in lysine (K) inside the SUMO consensus sequence ΨKXE/D (ψ, a hydrophobic residue; K, lysine; X, any amino acid; and E/D, glutamic, or aspartic) [11,15,16]. SUMOylation plays a main role in several important intracellular processes, such as the activity and stability of enzymes, DNA repair, and cell cycle regulation [3,17,18]. The SUMO system affects plant production through the accumulation of SUMO conjugates under abiotic stress [3,19,20,21]. In Arabidopsis, the abundance of SUMO conjugates and increases in response to salinity, heat, and brassinosteroid signaling [22,23,24,25]. The E3 ligase SIZ1 (SAP and miz1) regulates plant development and high-temperature stress in Arabidopsis as well as improved water deficit stress tolerance in tobacco [26,27]. Esd4 (early in short days 4) is a form of a SUMO-specific protease that controls flowering time and promotes the SUMO precursor in Arabidopsis [28]. It has also been found that the SUMO protease OTS1 (overly tolerant to salt 1) is a positive regulator for rice seed germination and root system growth under salt stress [29]. The SUMOylation of OsSIZ1 regulated the response to phosphate and nitrogen, as well as the Pi-dependent response in rice [30]. OsMMS21 is the SUMO-ligase-regulated auxin response and development in rice [31]. Overexpression of the ZmSCE1e (Zea mays SUMO conjugation enzyme 1) maize gene increased the level of SUMO conjugation and amplified the tolerance to drought and salinity of transgenic tobacco [32]. Eight SUMO genes were reported in the Arabidopsis thaliana genome [33], and its SUMO proteins were classified into two groups [34,35]. The first group was mono-SUMOylation (mono-SUMO), which contained amino acid sequences without SUMO acceptor sites, whereas the second group was poly-SUMOylation (poly-SUMO), which had amino acid sequences with one or more SUMO acceptor sites [36]. In the rice genome, six SUMO genes have been reported so far, named OsSUMO1–6 [16,18,37]. In the current investigation, we defined and molecularly characterized a new rice SUMO family member. Additionally, we analyzed the expression patterns and cellular localization of its SUMO protein in plant cells.

2. Materials and Methods

2.1. Plant Material and Candidate Gene Amplification

Seedlings of Oryza sativa L., cv Super-300 (Egyptian Japonica variety) were germinated and grown in a greenhouse under conditions of 14.5 L/9.5 D day length as well as 30 °C day/25 °C night thermo-conditions at an experimental farm of the Rice Research & Training Center (RRTC), Field Crops Research Institute, Sakha, Egypt. Molecular work was achieved at the Biotechnology Lab of the Plant Production Department, Food, and Agriculture College, King Saud University, Riyadh, Saudi Arabia. The extraction of total RNA from young rice leaves was performed using a plant total RNA extract kit (Magen) and then used for first-strand cDNA synthesis with SuperScript II (Invitrogen, currently Life-Technologies Co., San Francisco, CA, USA). The coding region of OsSUMO7 was amplified using specific primers, 5′ TGCCTTCCATCGTTGTGTTG ′3 (forward) and 5′ CCATATCAACTTCAGCAGATTCC ′3 (reverse), which were designed from genomic DNA of the SUMO region of a Japonica rice genome database. The PCR amplification reaction was completed using 12.5 μL of 1 × of GoTaq® Green Master Mix (Promega Corporation, Madison, WI, USA), 2-μL mix primers, 8.5 μL of double-distilled water, and 2 μL of DNA. The thermo-cycling conditions were 95 °C for 5 min for initial denaturation, followed by 35 cycles at 95 °C for 30 s; 57 °C for 45 s; 72 °C for 1 min; and 72 °C for 10 min for extra elongation. Ten micro-liters from the PCR product was used for 2% agarose gel electrophoresis to check the target band of the candidate gene.

2.2. RNA Extraction and Reverse-Transcription PCR

To investigate the transcription levels of OsSUMO7, different organs of the Japonica-type rice were collected and grinded with liquid nitrogen for RNA extraction using a plant total RNA extract kit (Magen). RT-PCR was performed using KOD Dash DNA polymerase (Toyobo) and an ABI 2720 thermal cycler (Life Technologies, Carlsbad, CA, USA). The transcript of the new SUMO gene was amplified using a pair of gene-specific primers: 5′ GGGTTGATTGATGGTGGTGG ′3 (forward) and 5′ GTGAAACGGAGGAAGTAGCTC ′3 (reverse). Rice Actin1 was used as an internal control.

2.3. Sequencing and Bioinformatic Analysis of OsSUMO7

Sequencing of the candidate region: The expected PCR band was purified using a Gel Extraction Kit (Qiagen Inc., Chatsworth, California, CA, USA) and sequenced using an automated DNA sequencer (Applied Biosystems Inc., Foster City, California, CA, USA). Six rice SUMO genes have been reported [18,38]; we obtained their sequences from the Rice Annotation Project (http://rapdb.dna.affrc.go.jp/, accessed on 6 October 2021). Known protein/DNA sequences were used as search queries to BLAST against rice sequence databases to determine if the rice genome encodes additional SUMO proteins. Arabidopsis AtSUMO sequences were obtained from TAIR (http://www.arabidopsis.org, accessed on 6 October 2021), while human and yeast SUMO sequences were obtained from the NCBI database. Sequences were aligned using ClustalW and then searched for conserved domains using the Pfam database [39,40]. Protein sequences alignment was performed using ClustalX software (http://www.clustal.org/, accessed on 6 October 2021). Phylogenetic tree analysis was carried out using the neighbor-joining method, PHYLIP version 3.69 (http://evolution.genetics.washington.edu/phylip.html, accessed on 6 October 2021), with bootstrap values from 1000 neighbor-joining bootstrap replicates. The candidate gene-coding region was investigated to define the SUMO features.

2.4. In Silico Characterization of the OsSUMO7 Protein

SUMOplotTM prediction: the SUMO binding sites in SUMO genes were identified using computer SUMOplot™ software. Prediction of the structure of OsSUMO7: the prediction of homology, secondary structure, and three-dimensional (3D) structure were carried out using the SWISS-MODEL, I-TASSER server (https://zhanglab.ccmb.med.umich.edu/I-TASSER/, accessed on 6 October 2021) [41]. Physicochemical properties of the SUMO proteins were determined using the ExPASy ProtParam server tool [42]. Primary structure, such as molecular weight (MW), the composition of amino acids, atomic composition, and the theoretical isoelectric point (T-pi), were calculated. In addition, the instability index (Ii) was calculated by Guruprasad [43], showing that there are certain dipeptides, the occurrence of which is significantly different in the unstable proteins compared with those in the stable ones. A protein with an instability index value of less than 40 is stable, while those with more than 40 are unstable. The aliphatic index (Ai) of a protein is obtained by using the formula described by Ikai [44]. The grand average of hydropathy (GRAVY) is calculated by the methodology reported by Kyte [45].

2.5. Construction of Expression Vectors Harboring Rice SUMO Components

The original expression vector pUC119 [46] has been used to construct the expression vectors harboring OsSUMO components according to the methodology described by Ikarashi [37]. The constructed vectors expressed red or green fluorescent protein makers (DsRed or GFP), driven by the cauliflower mosaic virus 35S (CaMV35S) promoter (Figure S1). All the corresponding primers that were used in the study are listed in Table S1. The target genes were inserted into pDsRed using an In-Fusion HD Cloning Kit (Takara Bio, Kusatsu, Japan), and the reconstructed vectors were designated as follows. The vector pDsRed:SUMO7 was constructed to investigate the expression and localization of the new OsSUMO7 protein. A series deletion mutant vector, pDsRed:SUMO7ΔGG, was constructed to study the role of the GG motif on the cellular localization of OsSUMO7 proteins. The SUMO conjugation enzyme (SCE1a) was cloned into a pGFP:SCE1a vector to study its co-expression and co-localization with OsSUMO7 proteins. Cell organellar markers were fused with GFP and constructed vectors, such as pPTS2:GFP (peroxisomal marker), pmt:GFP (mitochondrial marker), pWxTP:GFP (plastidial marker), and pGFP:SYP31 (cis-Golgi marker) (Figure S1). These vectors were co-transfected with DsRed:SUMO7ΔGG in onion cells to study whether the OsSUMO7 protein is localized in any other organelles in the cell.

2.6. Expression Analysis of SUMO Proteins

Constructed vectors harboring SUMO genes were transformed into onion epidermal cells using particle bombardment (Biolistic® PDS-1000/He, BioRad). Bombarded cells were kept in the dark for 24 h at room temperature. The expressed proteins were observed using the confocal laser scanning microscopy (FV300-BX61, Olympus), according to the methods reported by Ikarashi and Kitajima, respectively [37,47].

3. Results

The novel SUMO gene of rice was identified using the known SUMO system pathway components from Arabidopsis. The Arabidopsis SUMO protein/gene sequences were downloaded from the website genome database (https://www.arabidopsis.org/, accessed on 6 October 2021). The basic local alignment search tool for amino acids (BLASTP) and the basic local alignment search tool for nucleotides (TBLASTN) analyses were performed with the rice genome database (https://rapdb.dna.affrc.go.jp/, accessed on 6 October 2021) using the identified Arabidopsis SUMO genes. From the outcomes, the top identity sequences were chosen. Reciprocal BLASTP/TBLASTN analysis were performed using National Center for Biotechnology Information (NCBI) to ensure that the subject is most closely matched to the SUMO pathway query. All previously identified SUMO genes in rice were excluded. PCR primers were designed for the highest similarity sequence with the rice genome crops.

3.1. Molecular Characterization of the OsSUMO7 Gene

Using PCR, we amplified the coding region of a new SUMO family’s genes from the rice genome using specific primers (Table S1), which were designed based on genomic DNA of the SUMO region from a Japonica rice genome database (Figure 1A). The sequencing analysis determined that the 303 bps region coded the complete protein of 100 amino acids length (Figure 1B). Transcriptional levels of OsSUMO7 were investigated using RT-PCR in different rice organs, such as leaves, roots, stem, and spikelets. The data revealed that the gene was expressed in the tested rice organs (Figure 1C), indicating the constitutive expression of the gene. A BLAST analysis based on the protein sequence was performed in the rice database and showed that the OsSUMO7 gene predicted a protein containing 100 amino acid residues. These amino acid sequences have a C-terminal diglycine (GG) motif as the processing site by ULP; the consensus motifs (ΨKXE/D) of the SUMOylation site showed a high similarity to other SUMO members (Figure 2A). These data indicated that the OsSUMO7 gene has the features of SUMO members. A phylogenetic tree was generated based on the predicted SUMO protein sequences from different species, including Oryza sativa (Os), Arabidopsis thaliana (At), Homo sapiens (Hs), Brachypodium distachyon (Bd), Setaria italic (Si), Sorghum bicolor (Sb), and Saccharomyces cerevisiae (Sc). The OsSUMO7 protein shared a higher homology with monocotyledons, such as Brachypodium distachyon (Bd), Oryza sativa (Os), and Sorghum bicolor (Sc) (Figure 3). The similarity of protein sequences and conserved domains among OsSUMOs of different species demonstrated that OsSUMO7 is an evolutionarily conserved SUMO family member (Figure 2B).

3.2. Characterization of the OsSUMO7 Protein:

A bioinformatic analysis was performed to characterize the OsSUMO7 protein, comparing it to other OsSUMO and AtSUMO members. The results indicated that the OsSUMO7 gene located on chromosome seven was similar to OsSUMO3,5,6 genes and coded full-length active proteins with 100 amino acids, similar to OsSUMO1 (Table 1). Moreover, the OsSUMO7 protein contains two motifs for SUMOylation sites, one with a high probability at the K58 position and another with a low probability at the K23 position, similar to OsSUMO6; however, OsSUMO6 has two low-probability motifs at the K20 and K28 positions (Table 1).

3.2.1. Physicochemical Properties Analyses

Physicochemical properties analyses of SUMO proteins, performed using ProtParam, are listed in Table 2. The results recorded that the MW of the OsSUMO7 protein is 10.99 KDa, similar to the OsSUMO1, AtSUMO1, and AtSUMO7 proteins. The OsSUMO7 protein recorded a T-Pi value of 4.92, which is almost equal to OsSUMO1 and AtSUMO1. In addition, the OsSUMO7 protein revealed a TNNCR (Asp + Glu) value (17) similar to OsSUMO2 and OsSUMO4, while it showed the lowest TNPCR (Arg + Lys) value (11) among all the SUMO proteins (Table 2). The instability index (Ii) value was less than 40 (30.35) for OsSUMO7, indicating the stability of its protein, which was similar to the proteins of OsSUMO4, OsSUMO5, AtSUMO2, and AtSUMO7; the other SUMO proteins were unstable. At the same time, the OsSUMO7 protein recorded the highest value of Ai (119) and GRAVY (0.031) among all the tested SUMO proteins (Table 2). The amino acid composition analysis demonstrated that the OsSUMO7 protein sequence included all 20 amino acids, except tyrosine (Y) (Figure 4A, Table S2). In addition, it showed the lowest percentage of Ala (A, 2%), Arg (R, 2%), and Gln (Q, 1%) amino acids among the tested SUMO proteins, whereas the OsSUMO7 protein recorded the highest percentage of Leu (L, 17%) and Val (V, 11%) amino acids among the other SUMO proteins that were tested. Concurrently, the OsSUMO7 protein revealed high percentages of Gly (G, 12%), Lys (K, 9%), Glu (E, 9%), and Asp (D, 8%) (Figure 4A, Table S3). The atomic composition (AC) of the amino acid included carbon (C), hydrogen (H), nitrogen (N), oxygen (O), and sulfur (S). The results showed that the OsSUMO6 recorded the highest value (2034) of TNA, while the OsSUMO7 protein recorded a value of 1565 of TNA (Table S2). Radar graph analysis for atomic composition demonstrated that there was no significant difference in atomic composition percentage among the tested SUMO proteins (Figure 4B).

3.2.2. Structure–Model Prediction of the OsSUMO7 Protein

The analysis of the secondary structure was determined based on sequence-based prediction using PSSpred. The data showed that the sequence’s structure identity (helix, strand, or coil) is determined by the sum of the confidence scores. The structure revealed four strands intervened by eight coils and four helixes (Figure 5A). The confidence scores showed relatively high values, which are indicative of high-confidence predictions. Likewise, the predicted normalized B-factor performed using the ResQ method revealed the similarity with the secondary structure of the OsSUMO7 sequence model, which showed four strands intervened by eight coils and four helixes (Figure 5B). The negative values indicated the stability of the OsSUMO7 structure. The SPIKER program was used to select for a 3D model produced by I-TASSER simulations based on the pairwise structure similarity. The final predicted 3D model for OsSUMO7 observed an estimated TM-score value of 0.80 ± 0.09, a C-score of 0.63, and a calculated RMSD of 2.8 ± 2.0 A° (Figure 5C).

3.3. Expression and Subcellular Localization of the OsSUMO7 Protein

The DsRed:SUMO7 fusion proteins were mainly localized in the nucleus and form nuclear subdomains (Figure 6A). Moreover, DsRed:SUMO7ΔGG fusion proteins were detected in both the cytoplasm and nucleus. However, subnuclear structures disappeared (Figure 6B). To study whether the SUMO proteins are localized in any other organelles in the cell, various constructed vectors expressing some organellar markers, including pPTS2:GFP (peroxisomal marker), pmt:GFP (mitochondrial marker), pWxTP:GFP (plastidial marker), and pGFP:SYP31 (cis-Golgi marker), were constructed, and transfection was performed with pDsRed:OsSUMO7 in onion epidermal cells. The results showed that the OsSUMO7 proteins did not localize at any of these organelles (Figure 7).

3.4. Expression and Co-Localization of OsSUMO7 with GFP:SCE1a

The fusion proteins of GFP:SCE1a (SUMO conjugation enzyme) and DsRed:SUMO7, which were co-expressed and co-localized in the nucleus and formed nuclear subdomains, seem to be speckled (Figure 8A). The high-magnification images (Figure 8B) indicated that DsRed:SUMO7 is processed and conjugated within SCE1a:GFP and that both are localized in nuclear foci.

4. Discussion

The current investigation defined a new member of SUMO genes in the rice genome and was named OsSUMO7. The putative protein sequences of this gene showed to have SUMOylation features, such as di-glycine (GG) motifs at the C-terminal and a consensus motif (ΨKXE/D) at the SUMOylation site (Figure 2A). Many of the SUMO genes were reported in different plant species. Six SUMO genes were identified in the rice genome, named OsSUMO1~6 [16,18,37]. On the other hand, eight SUMO genes were identified in the Arabidopsis genome, named AtSUMO1~8 [48]. Most of those SUMO proteins contain consensus motifs at the SUMOylation sites [48,49], except for OsSUMO1/2 genes [18,50]. Among the identified OsSUMO genes, the new OsSUMO7 gene showed high similarity to the OsSUMO5 gene (Figure 2B). Coincidentally, the OsSUMO7 putative protein shared a higher homology with monocotyledons, such as Brachypodium distachyon (Bd), Oryza sativa (Os), and Sorghum bicolor (Sc) (Figure 3). It was classified in the same cluster as OsSUMO3/5/6 genes, which might have some important functions. This finding demonstrated that OsSUMO7 is an evolutionarily conserved SUMO member with other homologs of SUMO families in different species. This was consistent with a previous study that reported that the OsSUMO3/5/6 genes were classified into one group of monocotyledon species [18].
Our data showed that the OsSUMO7 gene was located on chromosome seven, i.e., the same as the OsSUMO 3,5,6 genes, while the OsSUMO1/2/4 genes were located on chromosome one (Table 1). Moreover, a phylogenetic tree classified the OsSUMO proteins into pairs: OsSUMO1/2, OsSUMO7/5, and OsSUMO3/4, while the OsSUMO4 gene was associated with OsSUMO1/2, but not in pairing (Figure 2B). This result suggested that the OsSUMO1/2/3/5/6/7 genes might be arranged as tandem pairs in the rice genome. Similarly, in the Arabidopsis genome, the AtSUMO2/3/4/6 genes were found to be located on chromosome five in tandem pairs [50,51]. These results indicated that the diversification of rice SUMO genes is similar to those in Arabidopsis in tandem duplications.
The transcripts of OsSUMO7 were detected in different rice organs, such as leaves, roots, stem, and spikelets (Figure 1C), which demonstrated the constitutive expression of this gene in all plant organs with no specific tissue. A previous study reported that the transcripts of OsSUMO1 and OsSUMO2 functioned in the whole plant body, while the transcripts of OsSUMO3 were detected only in root and panicle tissues. However, OsSUMO4 transcripts were not detected in any of the rice organs, which suggested that the OsSUMO4 gene may not be expressed [50]. Conversely, another study reported that all rice SUMO genes were expressed in all plant organs, except for the OsSUMO4/6 genes which were found to be tissue-specific, functionally expressed in some specific rice organs as opposed to others [18]. This indicated that individual SUMO genes might have diverged functions.
SUMOylation is well known to play a main role in diverse cellular processes, such as stress response, hormone signaling, and development [2,17,29]. Defining the expression levels and cellular localizations of SUMO transcripts is the most important step for increasing our understanding about the mechanisms and functions of SUMOylation. Our current study investigated the functional expression and cellular localization of the new OsSUMO7 proteins in the plants. The DsRed:SUMO7 fusion proteins were localized mainly in nucleus, and formed nuclear subdomain structures (Figure 6A). These nuclear subdomains were observed in a previous study [15]. Our results demonstrated that DsRed-fused OsSUMO7 was processed, activated, and bound to certain substrate proteins by the SUMO-activating system inside cells. Deletion of the GG motif suppressed the accumulation of the DsRed:SUMO7ΔGG proteins in the nucleus and caused the subnuclear structures to disappear (Figure 6B). These results indicated that the GG motif is necessary for the processing, activation, and accumulation of SUMO proteins in the nucleus. Similar results have been reported previously [23,37]. Additionally, our results confirmed that the OsSUMO7 proteins did not localize at any other organellar cell, except the nucleus (Figure 8). Previous studies found that the fusion proteins GFP:OsSUMO1/2/3 were mainly localized in the nucleus of rice root cells compared with the negative control GFP protein, which was detected in all cell areas, while the fusion protein GFP:OsSUMO4 was found to be localized in specific compartments of the nucleus compared with the GFP protein alone, which was distributed evenly in areas of the cell [50]. This result revealed the essential role of SUMO proteins in the regulation of protein SUMOylation, interaction, and cellular localization of the proteins.
SUMO-conjugating enzyme GFP:SCE1a and DsRed:SUMO7 co-expressing analyses showed that both signals are co-localized in the nucleus and formed nuclear subdomains (Figure 8). This suggested that the OsSUMO7 precursor is processed, activated, and transported to the nucleus through the onion cell SUMOylation system, and that OsSUMO7 possibly binds to the substrate proteins of onion cells. In the rice genome, three conjugation enzyme-encoding genes OsSCE1, OsSCE2, and OsSCE3 were identified [52]. The cellular localization of OsSCE1:GFP fusion proteins was detected in specific compartments in the nucleus, while the fusion proteins of OsSCE2:GFP and OsSCE3:GFP were distributed evenly in the nucleus [52]. The same study suggested that OsSCE1 is involved in carbohydrate metabolism, OsSCE3 is associated with drought stress response, while OsSCE2 still has an unknown function. Three genes of OsSCE1, namely OsSCE1a, OsSCE1b, and OsSCE1c, were assessed from rice [22]. SCE1 has a potential role in mediating the conjugation of SUMO to target proteins during the SUMOylation pathway [53]. The accumulations of SUMO conjugates are involved in abiotic stress responses in plants [52,53,54,55]. The modifications of SUMO isoforms are able to regulate the proteins’ activities, interactions among proteins, and the intracellular localization of the proteins [6,50]. Humans and plants have multi-SUMO isoforms, in contrast with yeast which has a single form of a SUMO-encoding gene [6,56]. In humans, the difference in function among SUMO isoforms might be related to differences in their expression levels [5]. The rice genome includes diversification of SUMO genes. However, the SUMO isoforms’ function is still unclear in rice.

5. Conclusions

In conclusion, the new OsSUMO7 gene was defined in the rice genome and its putative protein was characterized. OsSUMO7 was expressed in the whole plant body. The cellular localization of its expression proteins was mainly localized in the nucleus of the plant cell. The fused proteins of GFP:SCE1a and DsRed:SUMO7 were co-expressed and co-localized in the nucleus, and formed nuclear subdomains. This finding demonstrated that the new OsSUMO7 precursor is able to be processed, activated, and transported to the nucleus through the plant cell SUMOylation system.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biology11010053/s1. Table S1. Primer list used in the study. Table S2. OsSUMO and AtSUMO amino acid and atomic composition. Table S3. OsSUMO and AtSUMO composition of amino acid by percentage. Figure S1: (A) Construction of expression plasmid harboring OsSUMO7 gene. (B) Construction of expression plasmid harboring OsSUMO7 gene with GG deletion. (C) Construction of expression plasmid harboring SCE1a gene. (D) Construction of expression plasmid PTS2:GFP. (E) Construction of expression plasmid mt:GFP. (F) Construction of expression plasmid WxTP:GFP. (G) Construction of expression plasmid SYP31:GFP.

Author Contributions

Conceptualization, E.I.I. and K.A.A.; methodology, E.I.I. and K.A.A.; software, E.I.I.; validation, E.I.I., K.A.A., A.A.A.-D. and A.I.G.; formal analysis, E.I.I. and K.I.; investigation, K.A.A., E.I.I., A.I.G. and A.A.A.-D.; data curation, A.A.A.-D., E.I.I., K.I. and K.A.A.; writing—original draft preparation, E.I.I. and K.A.A.; writing—review and editing, K.I., A.I.G., A.A.A.-D., F.N.A. and E.I.I.; supervision, A.A.A.-D., A.I.G. and K.A.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Deanship of Scientific Research at King Saud University through research group No. (RG-1439-059).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data, tables, and figures are original.

Acknowledgments

The authors extend their appreciation to the Deanship of Scientific Research at King Saud University for funding this work through research group No. (RG-1439-059).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Le Roux, M.L.; Kunert, K.J.; Van der Vyver, C.; Cullis, C.A.; Botha, A.-M. Expression of a small ubiquitin-like modifier protease increases drought tolerance in wheat (Triticum aestivum L.). Front. Plant Sci. 2019, 10, 266. [Google Scholar] [CrossRef] [Green Version]
  2. Augustine, R.C.; Vierstra, R.D. SUMOylation: Re-wiring the plant nucleus during stress and development. Curr. Opin. Plant Biol. 2018, 45, 143–154. [Google Scholar] [CrossRef]
  3. Liu, Y.; Zhu, J.; Sun, S.; Cui, F.; Han, Y.; Peng, Z.; Zhang, X.; Wan, S.; Li, G. Defining the function of SUMO system in pod development and abiotic stresses in Peanut. BMC Plant Biol. 2019, 19, 593. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Kerscher, O.; Felberbaum, R.; Hochstrasser, M. Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell Dev. Biol. 2006, 22, 159–180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Wang, Y.-C.; Peterson, S.E.; Loring, J.F. Protein post-translational modifications and regulation of pluripotency in human stem cells. Cell Res. 2014, 24, 143–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Gareau, J.R.; Lima, C.D. The SUMO pathway: Emerging mechanisms that shape specificity, conjugation and recognition. Nat. Rev. Mol. Cell Biol. 2010, 11, 861–871. [Google Scholar] [CrossRef] [Green Version]
  7. Kim, K.I.; Baek, S.H.; Chung, C.H. Versatile protein tag, SUMO: Its enzymology and biological function. J. Cell. Physiol. 2002, 191, 257–268. [Google Scholar] [CrossRef]
  8. Saeki, Y. Ubiquitin recognition by the proteasome. J. Biochem. 2017, 161, 113–124. [Google Scholar] [CrossRef]
  9. Mahajan, R.; Delphin, C.; Guan, T.; Gerace, L.; Melchior, F. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 1997, 88, 97–107. [Google Scholar] [CrossRef] [Green Version]
  10. Gill, G. Post-translational modification by the small ubiquitin-related modifier SUMO has big effects on transcription factor activity. Curr. Opin. Genet. Dev. 2003, 13, 108–113. [Google Scholar] [CrossRef]
  11. Morrell, R.; Sadanandom, A. Dealing with stress: A review of plant SUMO proteases. Front. Plant Sci. 2019, 10, 1122. [Google Scholar] [CrossRef] [PubMed]
  12. Bayer, P.; Arndt, A.; Metzger, S.; Mahajan, R.; Melchior, F.; Jaenicke, R.; Becker, J. Structure determination of the small ubiquitin-related modifier SUMO-1. J. Mol. Biol. 1998, 280, 275–286. [Google Scholar] [CrossRef] [PubMed]
  13. Miura, K.; Jin, J.B.; Hasegawa, P.M. Sumoylation, a post-translational regulatory process in plants. Curr. Opin. Plant Biol. 2007, 10, 495–502. [Google Scholar] [CrossRef] [PubMed]
  14. Salman, A.; Kotb, A.; Ghazy, A.I.; Ibrahim, E.I.; Al-Ateeq, T.K. Structural and functional characterization of Tomato SUMO1 gene. Saudi J. Biol. Sci. 2020, 27, 352–357. [Google Scholar] [CrossRef]
  15. Lois, L.M.; Lima, C.D.; Chua, N.-H. Small ubiquitin-like modifier modulates abscisic acid signaling in Arabidopsis. Plant Cell 2003, 15, 1347–1359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Rosa, M.T.; Almeida, D.M.; Pires, I.S.; da Rosa Farias, D.; Martins, A.G.; da Maia, L.C.; de Oliveira, A.C.; Saibo, N.J.; Oliveira, M.M.; Abreu, I.A. Insights into the transcriptional and post-transcriptional regulation of the rice SUMOylation machinery and into the role of two rice SUMO proteases. BMC Plant Biol. 2018, 18, 349. [Google Scholar] [CrossRef] [PubMed]
  17. Park, H.J.; Kim, W.-Y.; Park, H.C.; Lee, S.Y.; Bohnert, H.J.; Yun, D.-J. SUMO and SUMOylation in plants. Mol. Cells 2011, 32, 305. [Google Scholar] [CrossRef] [Green Version]
  18. Teramura, H.; Yamada, K.; Ito, K.; Kasahara, K.; Kikuchi, T.; Kioka, N.; Fukuda, M.; Kusano, H.; Tanaka, K.; Shimada, H. Characterization of novel SUMO family genes in the rice genome. Genes Genet. Syst. 2021, 96, 1–8. [Google Scholar] [CrossRef]
  19. Conti, L.; Price, G.; O’Donnell, E.; Schwessinger, B.; Dominy, P.; Sadanandom, A. Small ubiquitin-like modifier proteases OVERLY TOLERANT TO SALT1 and-2 regulate salt stress responses in Arabidopsis. Plant Cell 2008, 20, 2894–2908. [Google Scholar] [CrossRef] [Green Version]
  20. Li, Y.; Wang, G.; Xu, Z.; Li, J.; Sun, M.; Guo, J.; Ji, W. Organization and regulation of soybean SUMOylation system under abiotic stress conditions. Front. Plant Sci. 2017, 8, 1458. [Google Scholar] [CrossRef] [Green Version]
  21. Li, S.; Lin, M.; Wang, J.; Zhang, L.; Lin, M.; Hu, Z.; Qi, Z.; Jiang, H.; Fu, Y.; Xin, D. Regulation of soybean SUMOylation system in response to Phytophthora sojae infection and heat shock. Plant Growth Regul. 2019, 87, 69–82. [Google Scholar] [CrossRef]
  22. Chaikam, V.; Karlson, D.T. Response and transcriptional regulation of rice SUMOylation system during development and stress conditions. BMB Rep. 2010, 43, 103–109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Murtas, G.; Reeves, P.H.; Fu, Y.-F.; Bancroft, I.; Dean, C.; Coupland, G. A nuclear protease required for flowering-time regulation in Arabidopsis reduces the abundance of SMALL UBIQUITIN-RELATED MODIFIER conjugates. Plant Cell 2003, 15, 2308–2319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Yoo, C.Y.; Miura, K.; Jin, J.B.; Lee, J.; Park, H.C.; Salt, D.E.; Yun, D.-J.; Bressan, R.A.; Hasegawa, P.M. SIZ1 small ubiquitin-like modifier E3 ligase facilitates basal thermotolerance in Arabidopsis independent of salicylic acid. Plant Physiol. 2006, 142, 1548–1558. [Google Scholar] [CrossRef] [Green Version]
  25. Zhang, L.e.; Han, Q.; Xiong, J.; Zheng, T.; Han, J.; Zhou, H.; Lin, H.; Yin, Y.; Zhang, D. Sumoylation of BRI1-EMS-SUPPRESSOR 1 (BES1) by the SUMO E3 ligase SIZ1 negatively regulates brassinosteroids signaling in Arabidopsis thaliana. Plant Cell Physiol. 2019, 60, 2282–2292. [Google Scholar] [CrossRef] [PubMed]
  26. Hammoudi, V.; Fokkens, L.; Beerens, B.; Vlachakis, G.; Chatterjee, S.; Arroyo-Mateos, M.; Wackers, P.F.; Jonker, M.J.; van den Burg, H.A. The Arabidopsis SUMO E3 ligase SIZ1 mediates the temperature dependent trade-off between plant immunity and growth. PLoS Genet. 2018, 14, e1007157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Zhang, S.; Zhuang, K.; Wang, S.; Lv, J.; Ma, N.N.; Meng, Q. A novel tomato SUMO E3 ligase, SlSIZ1, confers drought tolerance in transgenic tobacco. J. Integr. Plant Biol. 2017, 59, 102–117. [Google Scholar] [CrossRef] [Green Version]
  28. Golebiowski, F.; Matic, I.; Tatham, M.H.; Cole, C.; Yin, Y.; Nakamura, A.; Cox, J.; Barton, G.J.; Mann, M.; Hay, R.T. System-wide changes to SUMO modifications in response to heat shock. Sci. Signal. 2009, 2, ra24. [Google Scholar] [CrossRef] [Green Version]
  29. Srivastava, A.K.; Zhang, C.; Sadanandom, A. Rice OVERLY TOLERANT TO SALT 1 (OTS1) SUMO protease is a positive regulator of seed germination and root development. Plant Signal. Behav. 2016, 11, e1173301. [Google Scholar] [CrossRef] [Green Version]
  30. Wang, H.; Sun, R.; Cao, Y.; Pei, W.; Sun, Y.; Zhou, H.; Wu, X.; Zhang, F.; Luo, L.; Shen, Q. OsSIZ1, a SUMO E3 ligase gene, is involved in the regulation of the responses to phosphate and nitrogen in rice. Plant Cell Physiol. 2015, 56, 2381–2395. [Google Scholar] [CrossRef] [Green Version]
  31. Jiang, J.; Xie, Y.; Du, J.; Yang, C.; Lai, J. A SUMO ligase OsMMS21 regulates rice development and auxin response. J. Plant Physiol. 2021, 263, 153447. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, H.; Wang, M.; Xia, Z. Overexpression of a maize SUMO conjugating enzyme gene (ZmSCE1e) increases Sumoylation levels and enhances salt and drought tolerance in transgenic tobacco. Plant Sci. 2019, 281, 113–121. [Google Scholar] [CrossRef] [PubMed]
  33. Hay, R.T. SUMO: A history of modification. Mol. Cell 2005, 18, 1–12. [Google Scholar] [CrossRef]
  34. Lima, C.D.; Reverter, D. Structure of the human SENP7 catalytic domain and poly-SUMO deconjugation activities for SENP6 and SENP7. J. Biol. Chem. 2008, 283, 32045–32055. [Google Scholar] [CrossRef] [Green Version]
  35. Dou, H.; Huang, C.; Van Nguyen, T.; Lu, L.-S.; Yeh, E.T. SUMOylation and de-SUMOylation in response to DNA damage. FEBS Lett. 2011, 585, 2891–2896. [Google Scholar] [CrossRef] [Green Version]
  36. Tozluoğlu, M.; Karaca, E.; Nussinov, R.; Haliloğlu, T. A mechanistic view of the role of E3 in sumoylation. PLoS Comput. Biol. 2010, 6, e1000913. [Google Scholar] [CrossRef]
  37. Ikarashi, Y.; Noguchi, N.; Attia, K.; Kitajima-Koga, A.; Mitsui, T.; Itoh, K. Cloning, expression, and intracellular localization of rice SUMO genes. Bull. Fac. Agric. Niigata Univ. 2012, 65, 77–83. [Google Scholar]
  38. Chaikam, V.; Karlson, D.T. Functional characterization of two cold shock domainproteins from Oryza sativa. Plant Cell Environ. 2008, 31, 995–1006. [Google Scholar] [CrossRef]
  39. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Green Version]
  40. Finn, R.D.; Tate, J.; Mistry, J.; Coggill, P.C.; Sammut, S.J.; Hotz, H.-R.; Ceric, G.; Forslund, K.; Eddy, S.R.; Sonnhammer, E.L. The Pfam protein families database. Nucleic Acids Res. 2007, 36, D281–D288. [Google Scholar] [CrossRef] [Green Version]
  41. Roy, A.; Kucukural, A.; Zhang, Y. I-TASSER: A unified platform for automated protein structure and function prediction. Nat. Protoc. 2010, 5, 725–738. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Guruprasad, K.; Reddy, B.B.; Pandit, M.W. Correlation between stability of a protein and its dipeptide composition: A novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Eng. Des. Sel. 1990, 4, 155–161. [Google Scholar] [CrossRef]
  44. Ikai, A. Thermostability and aliphatic index of globular proteins. J. Biochem. 1980, 88, 1895–1898. [Google Scholar] [PubMed]
  45. Kyte, J.; Doolittle, R.F. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 1982, 157, 105–132. [Google Scholar] [CrossRef] [Green Version]
  46. Vieira, J.; Messing, J. Production of single-stranded plasmid DNA. Recomb. DNA Methodol. 1989, 153, 3–11. [Google Scholar]
  47. Kitajima, A.; Asatsuma, S.; Okada, H.; Hamada, Y.; Kaneko, K.; Nanjo, Y.; Kawagoe, Y.; Toyooka, K.; Matsuoka, K.; Takeuchi, M. The rice α-amylase glycoprotein is targeted from the Golgi apparatus through the secretory pathway to the plastids. Plant Cell 2009, 21, 2844–2858. [Google Scholar] [CrossRef] [Green Version]
  48. Kurepa, J.; Walker, J.M.; Smalle, J.; Gosink, M.M.; Davis, S.J.; Durham, T.L.; Sung, D.-Y.; Vierstra, R.D. The small ubiquitin-like modifier (SUMO) protein modification system in Arabidopsis: Accumulation of SUMO1 and-2 conjugates is increased by stress. J. Biol. Chem. 2003, 278, 6862–6872. [Google Scholar] [CrossRef] [Green Version]
  49. Rodriguez, M.S.; Dargemont, C.; Hay, R.T. SUMO-1 conjugation in vivo requires both a consensus modification motif and nuclear targeting. J. Biol. Chem. 2001, 276, 12654–12659. [Google Scholar] [CrossRef] [Green Version]
  50. Joo, J.; Choi, D.H.; Kim, S.H.; Song, S.I. Cellular Localization of rice SUMO/SUMO conjugates and in vitro sumoylation using rice components. Rice Sci. 2020, 27, 1–4. [Google Scholar] [CrossRef]
  51. Hammoudi, V.; Vlachakis, G.; Schranz, M.E.; van den Burg, H.A. Whole-genome duplications followed by tandem duplications drive diversification of the protein modifier SUMO in Angiosperms. New Phytol. 2016, 211, 172–185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Joo, J.; Choi, D.H.; Lee, Y.H.; Seo, H.S.; Song, S.I. The rice SUMO conjugating enzymes OsSCE1 and OsSCE3 have opposing effects on drought stress. J. Plant Physiol. 2019, 240, 152993. [Google Scholar] [CrossRef] [PubMed]
  53. Nurdiani, D.; Widyajayantie, D.; Nugroho, S. OsSCE1 encoding SUMO E2-conjugating enzyme involves in drought stress response of Oryza sativa. Rice Sci. 2018, 25, 73–81. [Google Scholar] [CrossRef]
  54. Castro, P.H.; Tavares, R.M.; Bejarano, E.R.; Azevedo, H. SUMO, a heavyweight player in plant abiotic stress responses. Cell. Mol. Life Sci. 2012, 69, 3269–3283. [Google Scholar] [CrossRef] [PubMed]
  55. Castro, P.H.; Couto, D.; Freitas, S.; Verde, N.; Macho, A.P.; Huguet, S.; Botella, M.A.; Ruiz-Albert, J.; Tavares, R.M.; Bejarano, E.R. SUMO proteases ULP1c and ULP1d are required for development and osmotic stress responses in Arabidopsis thaliana. Plant Mol. Biol. 2016, 92, 143–159. [Google Scholar] [CrossRef] [PubMed]
  56. Novatchkova, M.; Tomanov, K.; Hofmann, K.; Stuible, H.P.; Bachmair, A. Update on sumoylation: Defining core components of the plant SUMO conjugation system by phylogenetic comparison. New Phytol. 2012, 195, 23–31. [Google Scholar] [CrossRef] [Green Version]
Biology 11 00053 g001 550
Figure 1. (A) Rice chromosomes and the genomic sequence of the OsSUMO7 gene. (B) OsSUMO7 protein sequence. (C) Transcripts level of OsSUMO7 using RT-PCR.
Figure 1. (A) Rice chromosomes and the genomic sequence of the OsSUMO7 gene. (B) OsSUMO7 protein sequence. (C) Transcripts level of OsSUMO7 using RT-PCR.
Biology 11 00053 g001
Biology 11 00053 g002 550
Figure 2. (A) Alignment of SUMO genes in rice. Di-glycine motifs at the end of the mature SUMO proteins are indicated by the yellow box. Potential SUMOylation sites (ΨKXE/D) are boxed in red for a high probability and with blue for a low probability. A green box refers to the conserved ubiquitin-like domain. (B) Phylogenetic tree analysis of the OsSUMO family.
Figure 2. (A) Alignment of SUMO genes in rice. Di-glycine motifs at the end of the mature SUMO proteins are indicated by the yellow box. Potential SUMOylation sites (ΨKXE/D) are boxed in red for a high probability and with blue for a low probability. A green box refers to the conserved ubiquitin-like domain. (B) Phylogenetic tree analysis of the OsSUMO family.
Biology 11 00053 g002
Biology 11 00053 g003 550
Figure 3. Phylogenetic tree analysis of SUMO genes. Multiple sequence alignment result of SUMOs from ClustalW. Os refers to Oryza sativa, At refers to Arabidopsis thaliana, Hs refers to Homo sapiens, Bd refers to Brachypodium distachyon, Si refers to Setaria italic, Sb refers to Sorghum bicolor, and Sc refers to Saccharomyces cerevisiae.
Figure 3. Phylogenetic tree analysis of SUMO genes. Multiple sequence alignment result of SUMOs from ClustalW. Os refers to Oryza sativa, At refers to Arabidopsis thaliana, Hs refers to Homo sapiens, Bd refers to Brachypodium distachyon, Si refers to Setaria italic, Sb refers to Sorghum bicolor, and Sc refers to Saccharomyces cerevisiae.
Biology 11 00053 g003
Biology 11 00053 g004 550
Figure 4. (A) Heatmap presentation of OsSUMOs’ and AtSUMOs’ composition of amino acid by percentage. The common amino acid present in all SUMOs is shown. (B) Radar graph for atomic composition percentage (number of each atom by number of total atoms) of OsSUMOs and AtSUMOs.
Figure 4. (A) Heatmap presentation of OsSUMOs’ and AtSUMOs’ composition of amino acid by percentage. The common amino acid present in all SUMOs is shown. (B) Radar graph for atomic composition percentage (number of each atom by number of total atoms) of OsSUMOs and AtSUMOs.
Biology 11 00053 g004
Biology 11 00053 g005 550
Figure 5. (A) Putative OsSUMO7 protein prediction of secondary structure by PSSpred. (B) The predicted normalized B-factor of OsSUMO7 by ResQ. (C) The predicted 3D model, as well as the estimated global and local accuracy of the OsSUMO7, calculated by the I-TASSER server.
Figure 5. (A) Putative OsSUMO7 protein prediction of secondary structure by PSSpred. (B) The predicted normalized B-factor of OsSUMO7 by ResQ. (C) The predicted 3D model, as well as the estimated global and local accuracy of the OsSUMO7, calculated by the I-TASSER server.
Biology 11 00053 g005
Biology 11 00053 g006 550
Figure 6. (A) Localization of DsRed:OsSUMO7 in onion cells. (B) Localization of DsRed:OsSUMO7 with GG deletion in onion cells. (C) 35S:DsRed (control).
Figure 6. (A) Localization of DsRed:OsSUMO7 in onion cells. (B) Localization of DsRed:OsSUMO7 with GG deletion in onion cells. (C) 35S:DsRed (control).
Biology 11 00053 g006
Biology 11 00053 g007 550
Figure 7. (A) Co-expression of DsRed:OsSUMO7ΔGGs and PTS2:GFP in onion cells. PTS2 peroxisomal marker. (B) Co-expression of DsRed:OsSUMO7ΔGGs and mt:GFP in onion cells. mt; mitochondrial marker. (C) Co-expression of DsRed:OsSUMO7ΔGGs and WxTP:GFP in onion cells. WxTP, plastidial marker. (D) Co-expression of DsRed:OsSUMO7ΔGGs and SYP31:GFP in onion cells. SYP31, cis-Golgi marker.
Figure 7. (A) Co-expression of DsRed:OsSUMO7ΔGGs and PTS2:GFP in onion cells. PTS2 peroxisomal marker. (B) Co-expression of DsRed:OsSUMO7ΔGGs and mt:GFP in onion cells. mt; mitochondrial marker. (C) Co-expression of DsRed:OsSUMO7ΔGGs and WxTP:GFP in onion cells. WxTP, plastidial marker. (D) Co-expression of DsRed:OsSUMO7ΔGGs and SYP31:GFP in onion cells. SYP31, cis-Golgi marker.
Biology 11 00053 g007
Biology 11 00053 g008 550
Figure 8. (A) Co-expression and co-localization of DsRed:OsSUMO7 with GFP:SCE1a in the nucleus of onion cells. (B) Co-expression and co-localization of DsRed:OsSUMO7 with GFP:SCE1a in the nucleus with high magnification.
Figure 8. (A) Co-expression and co-localization of DsRed:OsSUMO7 with GFP:SCE1a in the nucleus of onion cells. (B) Co-expression and co-localization of DsRed:OsSUMO7 with GFP:SCE1a in the nucleus with high magnification.
Biology 11 00053 g008
Table
Table 1. Putative protein characterization of identified rice SUMO genes.
Table 1. Putative protein characterization of identified rice SUMO genes.
OsSUMOGenBankNo. of AAChr. No.SUMOplotTM Prediction of SUMOylation Sites
Motifs with High ProbabilityMotifs with Low Probability
MotifPos.ScoreMotifPos.Score
OsSUMO1P558571001 DKKPK90.39
OsSUMO2Q8RZU91011 EKKPK100.39
OsSUMO3Q6ZL081107VKVEK120.93GKTPK200.57
OsSUMO4BAB84389.11141VKVEK220.93
OsSUMO5XP_015646034.11107LKGD and AKAPK72 and K53 0.91 and 0.69
OsSUMO6XP_025882647.11307VKVEK120.93WKTP and WKAPK20 and K28 0.54 and 0.54
OsSUMO7Query1007LKGDK580.91HKVDK230.52
Table
Table 2. Physiochemical Properties of OsSUMOs and AtSUMOs by ProtParam.
Table 2. Physiochemical Properties of OsSUMOs and AtSUMOs by ProtParam.
FormulaMW (kDa)T. PiTNNCRTNPCRIiStabilityAiGRAVY
OsSUMO1C464H744N138O153S710.934.95181351.75Unstable64.5−0.681
OsSUMO2C471H756N138O156S511.015.1171354.05Unstable66.73−0.721
OsSUMO3C542H834N156O173S412.434.77211542.58Unstable59.45−0.718
OsSUMO4C532H859N145O176S512.264.73171237.37Stable80.44−0.264
OsSUMO5C545H858N142O164S1012.345.01161237.87Stable71.73−0.174
OsSUMO6C657H995N183O195S414.715.23191641.52Unstable62.31−0.605
OsSUMO7C492H795N127O146S510.994.92171130.35Stable111.90.031
AtSUMO1C462H740N140O158S610.984.91181347.48Unstable59.60−0.84
AtSUMO2C578H903N159O177S613.105.13191531.96Stable72.33−0.47
AtSUMO3C550H866N154O170S712.585.09191547.57Unstable76.49−0.58
AtSUMO4C586H939N173O185S513.536.85212149.47Unstable65.73−0.85
AtSUMO5C524H844N148O164S812.108.91121551.41Unstable64.07−0.61
AtSUMO6C588H934N170O175S713.419.13182143.92Unstable62.28−0.76
AtSUMO7C478H756N136O145S610.926.03151330.69Stable76.00−0.55
AtSUMO8C498H782N138O150S511.266.05161453.29Unstable76.29−0.56
MW, molecular weight; T. Pi, theoretical pI; TNNCR, total number of negatively charged residues (Asp + Glu); TNPCR, total number of positively charged residues (Arg + Lys); Ii, instability index; Ai, aliphatic index; and GRAVY, grand average of hydropathicity.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ibrahim, E.I.; Attia, K.A.; Ghazy, A.I.; Itoh, K.; Almajhdi, F.N.; Al-Doss, A.A. Molecular Characterization and Functional Localization of a Novel SUMOylation Gene in Oryza sativa. Biology 2022, 11, 53. https://doi.org/10.3390/biology11010053

AMA Style

Ibrahim EI, Attia KA, Ghazy AI, Itoh K, Almajhdi FN, Al-Doss AA. Molecular Characterization and Functional Localization of a Novel SUMOylation Gene in Oryza sativa. Biology. 2022; 11(1):53. https://doi.org/10.3390/biology11010053

Chicago/Turabian Style

Ibrahim, Eid I., Kotb A. Attia, Abdelhalim I. Ghazy, Kimiko Itoh, Fahad N. Almajhdi, and Abdullah A. Al-Doss. 2022. "Molecular Characterization and Functional Localization of a Novel SUMOylation Gene in Oryza sativa" Biology 11, no. 1: 53. https://doi.org/10.3390/biology11010053

APA Style

Ibrahim, E. I., Attia, K. A., Ghazy, A. I., Itoh, K., Almajhdi, F. N., & Al-Doss, A. A. (2022). Molecular Characterization and Functional Localization of a Novel SUMOylation Gene in Oryza sativa. Biology, 11(1), 53. https://doi.org/10.3390/biology11010053

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop