Antimicrobials as Single and Combination Therapy for Colistin-Resistant Pseudomonas aeruginosa at a University Hospital in Thailand
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Bacterial Isolates
4.2. Antimicrobial-Susceptibility Testing and Synergistic Activity
4.3. Determination of Clonal Relationships
4.4. Detection of Metallo-β-Lactamase Genes and mcr-1
4.5. Phenotypic AmpC Confirmation by Cefoxitin-Cloxacillin Testing
4.6. Detection of Biofilm Formation by Microtiter-Plate Assay
4.7. Ethical Approval
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Ramphal, R. Infectious Due to Psudomonas, Burkholderia, and Stenotrophomonas Species. In Harison‘s Prinsiples of Internal Medicine, 20th ed.; Jameson, J.L., Kasper, D.L., Longo, D.L., Fauci, A.S., Hauser, S.L., Loscalzo, J., Eds.; McGraw-Hill Education: New York, NY, USA, 2018; Volume 1, pp. 1167–1173. [Google Scholar]
- World Health Organization. WHO Publishes List of Bacteria for Which New Antibiotics Are Urgently Needed. WHO Department of Communications. Available online: https://www.who.int/news-room/detail/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed (accessed on 18 April 2020).
- National Antimicrobial Resistance Surveillance Center. Thailand. Available online: http://narst.dmsc.moph.go.th/ (accessed on 18 April 2020).
- Lin, K.Y.; Lauderdale, T.L.; Wang, J.T.; Chang, S.C. Carbapenem-resistant Pseudomonas aeruginosa in Taiwan: Prevalence, risk factors, and impact on outcome of infections. J. Microbiol. Immunol. Infect. 2016, 49, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Tang, S.Y.; Zhang, S.W.; Wu, J.D.; Wu, F.; Zhang, J.; Dong, J.T.; Guo, P.; Zhang, D.L.; Yang, J.T.; Zhang, W.J. Comparison of mono- and combination antibiotic therapy for the treatment of Pseudomonas aeruginosa bacteraemia: A cumulative meta-analysis of cohort studies. Exp. Ther. Med. 2018, 15, 2418–2428. [Google Scholar] [PubMed]
- Tsuji, B.T.; Pogue, J.M.; Zavascki, A.P.; Paul, M.; Daikos, G.L.; Forrest, A.; Giacobbe, D.R.; Viscoli, C.; Giamarellou, H.; Karaiskos, I.; et al. International Consensus Guidelines for the Optimal Use of the Polymyxins: Endorsed by the American College of Clinical Pharmacy (ACCP), European Society of Clinical Microbiology and Infectious Diseases (ESCMID), Infectious Diseases Society of America (IDSA), International Society for Anti-infective Pharmacology (ISAP), Society of Critical Care Medicine (SCCM), and Society of Infectious Diseases Pharmacists (SIDP). Pharmacotherapy 2019, 39, 10–39. [Google Scholar] [PubMed]
- Tunyapanit, W.; Pruekprasert, P.; Laoprasopwattana, K.; Chelae, S. In vitro activity of colistin against multidrug-resistant Pseudomonas aeruginosa isolates from patients in Songklanagarind Hospital, Thailand. Southeast Asian J. Trop. Med. Public Health 2013, 44, 273–280. [Google Scholar]
- Santimaleeworagun, W.; Thunyaharn, S.; Juntanawiwat, P.; Thongnoy, N.; Harindhanavudhi, S.; Nakeesathit, S.; Teschumroon, S. The prevalence of colistin-resistant Gram-negative bacteria isolated from hospitalized patients with bacteremia. J. Appl. Pharm. Sci. 2020, 10, 056–059. [Google Scholar]
- Wi, Y.M.; Choi, J.Y.; Lee, J.Y.; Kang, C.I.; Chung, D.R.; Peck, K.R.; Song, J.H.; Ko, K.S. Emergence of colistin resistance in Pseudomonas aeruginosa ST235 clone in South Korea. Int. J. Antimicrob. Agents 2017, 49, 767–769. [Google Scholar] [CrossRef]
- Yousefi, S.; Nahaei, M.R.; Farajnia, S.; Aghazadeh, M.; Iversen, A.; Edquist, P.; Maãtallah, M.; Giske, C.G. A multiresistant clone of Pseudomonas aeruginosa sequence type 773 spreading in a burn unit in Orumieh, Iran. Apmis 2013, 121, 146–152. [Google Scholar] [CrossRef]
- Abd El-Baky, R.M.; Masoud, S.M.; Mohamed, D.S.; Waly, N.G.; Shafik, E.A.; Mohareb, D.A.; Elkady, A.; Elbadr, M.M.; Hetta, H.F. Prevalence and Some Possible Mechanisms of Colistin Resistance Among Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa. Infect. Drug Resist. 2020, 13, 323–332. [Google Scholar] [CrossRef]
- Falagas, M.E.; Kasiakou, S.K. Colistin: The revival of polymyxins for the management of multidrug-resistant gram-negative bacterial infections. Clin. Infect. Dis. 2005, 40, 1333–1341. [Google Scholar] [CrossRef]
- Samonis, G.; Matthaiou, D.K.; Kofteridis, D.; Maraki, S.; Falagas, M.E. In vitro susceptibility to various antibiotics of colistin-resistant gram-negative bacterial isolates in a general tertiary hospital in Crete, Greece. Clin. Infect. Dis. 2010, 50, 1689–1691. [Google Scholar] [CrossRef] [PubMed]
- Goli, H.R.; Nahaei, M.R.; Ahangarzadeh Rezaee, M.; Hasani, A.; Samadi Kafil, H.; Aghazadeh, M. Emergence of colistin resistant Pseudomonas aeruginosa at Tabriz hospitals, Iran. Iran. J. Microbiol. 2016, 8, 62–69. [Google Scholar] [PubMed]
- Mataseje, L.F.; Peirano, G.; Church, D.L.; Conly, J.; Mulvey, M.; Pitout, J.D. Colistin-Nonsusceptible Pseudomonas aeruginosa Sequence Type 654 with blaNDM–1 Arrives in North America. Antimicrob. Agents Chemother. 2016, 60, 1794–1800. [Google Scholar] [CrossRef]
- Azimi, L.; Lari, A.R. Colistin-resistant Pseudomonas aeruginosa clinical strains with defective biofilm formation. GMS Hyg. Infect. Control 2019, 14. [Google Scholar] [CrossRef]
- Sykes, R.B.; Bonner, D.P.; Bush, K.; Georgopapadakou, N.H. Azthreonam (SQ 26,776), a synthetic monobactam specifically active against aerobic gram-negative bacteria. Antimicrob. Agents Chemother. 1982, 21, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Barry, A.L.; Thornsberry, C.; Jones, R.N.; Gavan, T.L. Aztreonam: Antibacterial activity, beta-lactamase stability, and interpretive standards and quality control guidelines for disk-diffusion susceptibility tests. Rev. Infect. Dis. 1985, 7, S594–S604. [Google Scholar] [CrossRef] [PubMed]
- Sykes, R.B.; Bonner, D.P. Discovery and development of the monobactams. Rev. Infect. Dis. 1985, 7, S579–S593. [Google Scholar] [CrossRef]
- Zhanel, G.G.; Chung, P.; Adam, H.; Zelenitsky, S.; Denisuik, A.; Schweizer, F.; Lagacé-Wiens, P.R.; Rubinstein, E.; Gin, A.S.; Walkty, A.; et al. Ceftolozane/tazobactam: A novel cephalosporin/β-lactamase inhibitor combination with activity against multidrug-resistant gram-negative bacilli. Drugs 2014, 74, 31–51. [Google Scholar] [CrossRef]
- Buesing, M.A.; Jorgensen, J.H. In vitro activity of aztreonam in combination with newer beta-lactams and amikacin against multiply resistant gram-negative bacilli. Antimicrob. Agents Chemother. 1984, 25, 283–285. [Google Scholar] [CrossRef]
- Brogden, R.N.; Heel, R.C. Aztreonam. A review of its antibacterial activity, pharmacokinetic properties and therapeutic use. Drugs 1986, 31, 96–130. [Google Scholar] [CrossRef]
- Burgess, D.S.; Hastings, R.W. Activity of piperacillin/tazobactam in combination with amikacin, ciprofloxacin, and trovafloxacin against Pseudomonas aeruginosa by time-kill. Diagn. Microbiol. Infect. Dis. 2000, 38, 37–41. [Google Scholar] [CrossRef]
- Chen, Y.H.; Peng, C.F.; Lu, P.L.; Tsai, J.J.; Chen, T.P. In vitro activities of antibiotic combinations against clincal isolates of Pseudomonas aeruginosa. Kaohsiung J. Med. Sci. 2004, 20, 261–267. [Google Scholar] [CrossRef]
- Fujimura, S.; Takane, H.; Nakano, Y.; Watanabe, A. In vitro synergy studies based on tazobactam/piperacillin against clinical isolates of metallo-beta-lactamase-producing Pseudomonas aeruginosa. J. Antimicrob. Chemother. 2009, 64, 1115–1116. [Google Scholar] [CrossRef] [PubMed][Green Version]
- El-Sayed Ahmed, M.A.E.; Zhong, L.L.; Shen, C.; Yang, Y.; Doi, Y.; Tian, G.B. Colistin and its role in the Era of antibiotic resistance: An extended review (2000–2019). Emerg. Microbes Infect. 2020, 9, 868–885. [Google Scholar] [CrossRef] [PubMed]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
- Khosravi, A.D.; Hoveizavi, H.; Mohammadian, A.; Farahani, A.; Jenabi, A. Genotyping of multidrug-resistant strains of Pseudomonas aeruginosa isolated from burn and wound infections by ERIC–PCR. Acta Cir. Bras. 2016, 31, 206–211. [Google Scholar] [CrossRef] [PubMed]
- Zarei, O.; Shokoohizadeh, L.; Hossainpour, H.; Alikhani, M.Y. Molecular analysis of Pseudomonas aeruginosa isolated from clinical, environmental and cockroach sources by ERIC–PCR. BMC Res. Notes 2018, 11, 668. [Google Scholar] [CrossRef] [PubMed]
- Preechachuawong, P.; Santimaleeworagun, W.; Jitwasinkul, T.; Samret, W. Detection of new Delhi metallo-beta-lactamase-1-producing Klebsiella pneumoniae at a general hospital in Thailand. Southeast Asian J. Trop. Med. Public Health 2015, 46, 1031–1036. [Google Scholar]
- Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
- Lertsrisatit, Y.; Santimaleeworagun, W.; Thunyaharn, S.; Traipattanakul, J. In vitro activity of colistin mono- and combination therapy against colistin-resistant Acinetobacter baumannii, mechanism of resistance, and clinical outcomes of patients infected with colistin-resistant A. baumannii at a Thai university hospital. Infect. Drug Resist. 2017, 10, 437–443. [Google Scholar] [CrossRef]
- Peter-Getzlaff, S.; Polsfuss, S.; Poledica, M.; Hombach, M.; Giger, J.; Böttger, E.C.; Zbinden, R.; Bloemberg, G.V. Detection of AmpC beta-lactamase in Escherichia coli: Comparison of three phenotypic confirmation assays and genetic analysis. J. Clin. Microbiol. 2011, 49, 2924–2932. [Google Scholar] [CrossRef]
- Kırmusaoğlu, S. The Methods for Detection of Biofilm and Screening Antibiofilm Activity of Agents. In Antimicrobials, Antibiotic Resistance, Antibiofilm Strategies and Activity Methods; IntechOpen: London, UK, 2019. [Google Scholar]
- Redelman, C.; Marrs, K.; Anderson, G. Discovering Biofilms: Inquiry-Based Activities for the Classroom. Am. Biol. Teach. 2012, 74, 305–309. [Google Scholar] [CrossRef]
- Zaborina, O.; Kohler, J.E.; Wang, Y.; Bethel, C.; Shevchenko, O.; Wu, L.; Turner, J.R.; Alverdy, J.C. Identification of multi-drug resistant Pseudomonas aeruginosa clinical isolates that are highly disruptive to the intestinal epithelial barrier. Ann. Clin. Microbiol. Antimicrob. 2006, 5, 14. [Google Scholar] [CrossRef] [PubMed]
Antimicrobial Agents | MIC Range (µg/mL) | MIC50 (µg/mL) | MIC90 (µg/mL) | Susceptibility (%) |
---|---|---|---|---|
Piperacillin/tazobactam | 1.5–32 | 6 | 16 | 88.89 |
Ceftazidime | 0.25–24 | 1.5 | 4 | 94.44 |
Imipenem | 1–6 | 3 | 6 | 5.56 |
Meropenem | 0.094–1.5 | 0.25 | 1 | 100.00 |
Amikacin | 0.75–16 | 1.5 | 4 | 100.00 |
Gentamicin | 0.25–32 | 2 | 2 | 94.44 |
Ciprofloxacin | 0.0625–8 | 0.125 | 4 | 83.33 |
Levofloxacin | 0.38–2 | 0.75 | 1 | 88.89 |
Ceftolozane/tazobactam | 0.25–3 | 0.75 | 1.5 | 100.00 |
Aztreonam | 1–12 | 3 | 4 | 94.44 |
Colistin | >16 | >16 | >16 | 0 |
Isolates | ERIC-PCR | AMK + PIP/TAZ | AMK + CAZ | AMK + IMP | AMK + MEM | AMK + C/T | AMK + ATM | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
No. | Group | Activity | ΣFICI | Activity | ΣFICI | Activity | ΣFICI | Activity | ΣFICI | Activity | ΣFICI | Activity | ΣFICI |
1 | A | ADD | 1 | IND | 1.33 | IND | 2 | IND | 1.41 | IND | 1.16 | ADD | 0.83 |
2 | A | ADD | 0.88 | IND | 1.41 | IND | 2 | IND | 1.15 | ADD | 0.71 | ADD | 1 |
3 | A | IND | 1.41 | IND | 1.41 | IND | 2 | ADD | 1 | IND | 2 | ADD | 0.62 |
4 | A | ADD | 0.62 | ADD | 0.66 | IND | 1.04 | ADD | 0.67 | ADD | 0.66 | ADD | 0.7 |
5 | A | IND | 1.16 | ADD | 1 | ADD | 1 | ADD | 0.58 | ADD | 1 | ADD | 0.7 |
6 | B | ADD | 0.88 | IND | 1.08 | IND | 2 | IND | 1.08 | IND | 1.5 | ADD | 0.84 |
7 | B | SYN | 0.42 | SYN | 0.44 | ADD | 0.58 | ADD | 0.58 | ADD | 0.54 | ADD | 0.83 |
8 | B | ADD | 0.63 | IND | 1.35 | IND | 2 | IND | 1.41 | ADD | 0.75 | IND | 1.5 |
9 | C | ADD | 0.87 | ADD | 0.7 | IND | 1.25 | ADD | 0.62 | IND | 1.25 | ADD | 0.7 |
10 | C | SYN | 0.35 | ADD | 0.75 | ADD | 0.75 | ADD | 0.59 | ADD | 0.87 | SYN | 0.5 |
11 | C | ADD | 0.62 | ADD | 0.88 | IND | 1.25 | ADD | 0.71 | ADD | 0.62 | ADD | 1 |
12 | D | IND | 1.25 | ADD | 1 | IND | 2 | IND | 1.16 | IND | 2 | ADD | 1 |
13 | D | ADD | 0.75 | ADD | 0.75 | IND | 1.66 | IND | 1.25 | IND | 1.25 | IND | 1.25 |
14 | D | ADD | 0.83 | ADD | 0.66 | IND | 1.66 | IND | 1.16 | IND | 1.32 | IND | 1.33 |
15 | E | ADD | 0.63 | ADD | 0.71 | IND | 2 | IND | 1.5 | IND | 2 | IND | 1.25 |
16 | E | IND | 2 | IND | 1.66 | ADD | 0.69 | SYN | 0.5 | IND | 2 | IND | 1.25 |
17 | F | ADD | 0.7 | ADD | 0.7 | IND | 1.08 | IND | 1.75 | ADD | 0.56 | SYN | 0.41 |
18 | F | IND | 1.33 | ADD | 0.83 | ADD | 0.7 | SYN | 0.33 | ADD | 0.88 | SYN | 0.42 |
Antimicrobial Combinations | Synergistic n (%) | Additive n (%) | Indifferent n (%) |
---|---|---|---|
Amikacin + piperacillin/tazobactam | 2 (11.11) | 11 (61.11) | 5 (27.78) |
Amikacin + ceftazidime | 1 (5.55) | 11 (61.11) | 6 (33.33) |
Amikacin + imipenem | 0 | 5 (27.78) | 13 (72.22) |
Amikacin + meropenem | 2 (11.11) | 7 (38.89) | 9 (50.00) |
Amikacin + ceftolozane/tazobactam | 0 | 9 (50.00) | 9 (50.00) |
Amikacin + aztreonam | 3 (16.67) | 10 (55.56) | 5 (27.78) |
Resistance Genes | |||||||
---|---|---|---|---|---|---|---|
Metallo-β-Lactamase | |||||||
Isolate No. | ERIC-PCR Group | IMP | VIM | NDM | mcr-1 | AmpC Confirmation by Cefoxitin-Cloxacillin Testing | Biofilm Formation |
1 | A | X | X | X | X | X | No |
2 | A | X | X | X | X | X | No |
3 | A | X | X | X | X | X | No |
4 | A | X | X | X | X | X | No |
5 | A | X | X | X | X | X | No |
6 | B | X | X | X | X | X | Moderate |
7 | B | X | X | X | X | X | Moderate |
8 | B | X | X | X | X | X | Moderate |
9 | C | X | X | X | X | X | No |
10 | C | X | X | X | X | X | No |
11 | C | X | X | X | X | X | No |
12 | D | X | X | X | X | X | No |
13 | D | X | X | X | X | X | Moderate |
14 | D | X | X | X | X | X | Moderate |
15 | E | X | √ | X | X | X | Weak |
16 | E | X | X | X | X | X | Weak |
17 | F | X | X | X | X | X | No |
18 | F | X | X | X | X | X | No |
Target Gene | Primer Sequence (5′-3′) | Amplicon Size (bp) | |
---|---|---|---|
IMP | Forward | GGAATAGAGTGGCTTAAYTCTC | 232 |
Reverse | GGTTTAAYAAAACAACCAC | ||
VIM | Forward | GATGGTGTTTGGTCGCATA | 390 |
Reverse | CGAATGCGCAGCACCAG | ||
NDM | Forward | GGTTTGGCGATCTGGTTTTC | 621 |
Reverse | CGGAATGGCTCATCACGATC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pungcharoenkijkul, S.; Traipattanakul, J.; Thunyaharn, S.; Santimaleeworagun, W. Antimicrobials as Single and Combination Therapy for Colistin-Resistant Pseudomonas aeruginosa at a University Hospital in Thailand. Antibiotics 2020, 9, 475. https://doi.org/10.3390/antibiotics9080475
Pungcharoenkijkul S, Traipattanakul J, Thunyaharn S, Santimaleeworagun W. Antimicrobials as Single and Combination Therapy for Colistin-Resistant Pseudomonas aeruginosa at a University Hospital in Thailand. Antibiotics. 2020; 9(8):475. https://doi.org/10.3390/antibiotics9080475
Chicago/Turabian StylePungcharoenkijkul, Supanun, Jantima Traipattanakul, Sudaluck Thunyaharn, and Wichai Santimaleeworagun. 2020. "Antimicrobials as Single and Combination Therapy for Colistin-Resistant Pseudomonas aeruginosa at a University Hospital in Thailand" Antibiotics 9, no. 8: 475. https://doi.org/10.3390/antibiotics9080475
APA StylePungcharoenkijkul, S., Traipattanakul, J., Thunyaharn, S., & Santimaleeworagun, W. (2020). Antimicrobials as Single and Combination Therapy for Colistin-Resistant Pseudomonas aeruginosa at a University Hospital in Thailand. Antibiotics, 9(8), 475. https://doi.org/10.3390/antibiotics9080475