Extended-Spectrum-Beta-Lactamase (ESBL)-Producing Escherichia coli in Laying Hens: Slaughterhouse Prevalence and Antibiotic Resistance Patterns
Abstract
1. Introduction
2. Results and Discussion
2.1. Detection and Confirmation of the ESBL E. coli Isolates
2.2. Detection of the ESBL Genes
2.3. Antibiotic Resistance Profile of the Isolates
3. Material and Methods
3.1. Sampling Sites and Sample Collection
3.2. Bacterial Isolation, Identification and Characterization
3.3. Molecular and Genotypical Characterization of Isolates
3.3.1. Molecular Identification of the E. coli
3.3.2. ESBL-Encoding Gene Detection in E. coli
3.3.3. Sequence Analysis
3.4. Phenotypic Antimicrobial Resistance Profile
3.5. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wu, Y.; Wang, C.H.; Li, X.; Li, F.; Jiang, M.L.; Liu, Z.K.; Liu, G.F.; Li, J.Y. Characteristics of the Plasmid-Mediate Colistin-Resistance Gene Mcr-1 in Escherichia coli Isolated from Pig Farm in Jiangxi. Pak. Vet. J. 2024, 44, 1002827. [Google Scholar]
- Xue, M.; Li, Z.; Zhang, P.; Lei, W. Genomic Characteristics of ETT2 Gene Clusters in Avian Pathogenic Escherichia coli Identified by Whole-genome Sequencing. Pak. Vet. J. 2024, 44, 833–839. [Google Scholar]
- Kizil, S.; Aydin, F.E.; Önel, A.U.; Yildirim, M.; Güneri, C.Ö.; Cecen, E.M. Determination of Subtypes, Serogroups, And Serotypes, Virulence, and/or Toxigenic Properties of Escherichia coli Isolated from Cattle, Sheep, and Goat Feces by Multiplex PCR. Kafkas Univ. Vet. Fak. Derg. 2024, 30, 155–160. [Google Scholar]
- Blaak, H.; van Hoek, A.H.A.M.; Hamidjaja, R.A.; van der Plaats, R.Q.J.; Kerkhof-de Heer, L.; de Roda Husman, A.M.; Schets, F.M. Distribution, numbers, and diversity of ESBL producing E. coli in the poultry farm environment. PLoS ONE 2015, 10, e0135402. [Google Scholar]
- Ungureanu, V.; Corcionivoschi, N.; Gundogdu, O.; Stef, L.; Pet, I.; Păcală, N.; Madden, R.H. The emergence of beta-lactamase producing Escherichia coli and the problems in assessing their potential contribution to foodborne illness: A Review. AgroLife Sci. J. 2019, 8, 248–260. [Google Scholar]
- Lemlem, M.; Aklilu, E.; Mohammed, M.; Kamaruzzaman, F.; Zakaria, Z.; Harun, A.; Devan, S.S. Molecular detection and antimicrobial resistance profiles of Extended-Spectrum Beta-Lactamase (ESBL) producing Escherichia coli in broiler chicken farms in Malaysia. PLoS ONE 2023, 18, e0285743. [Google Scholar]
- Shaikh, S.; Fatima, J.; Shakil, S.; Rizvi, S.M.D.; Kamal, M.A. Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment. Saudi J. Biol. Sci. 2015, 22, 90–101. [Google Scholar]
- Falagas, M.E.; Karageorgopoulos, D.E. Extended-spectrum ß-lactamase-producing organisms. J. Hosp. Infect. 2009, 73, 345–354. [Google Scholar] [CrossRef] [Scilit]
- Urban-Chmiel, R.; Marek, A.; Stepien-Pysniak, D.; Wieczorek, K.; Dec, M.; Nowaczek, A.; Osek, J. Antibiotic resistance in bacteria-a review. Antibiotics 2022, 11, 1079. [Google Scholar]
- Hu, Y.; Yang, X.; Li, J.; Lv, N.; Liu, F.; Wu, J.; Lin, I.Y.C.; Wu, N.; Weimer, B.C.; Gao, G.F.; et al. The bacterial mobile resistome transfer network connecting the animal and human microbiomes. Appl. Environ. Microbiol. 2016, 82, 6672–6681. [Google Scholar]
- Xu, C.; Kong, L.; Gao, H.; Cheng, X.; Wang, X. A review of current bacterial resistance to antibiotics in food animals. Front. Microbiol. 2022, 13, 822689. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwang-Won, S.; Young-Ju, L. Detection of plasmid-mediated quinolone resistance genes in β-lactamase-producing Escherichia coli isolates from layer hens. Poult. Sci. 2019, 98, 1480–1487. [Google Scholar]
- Aldea, I.; Gibello, A.; Hernandez, M.; Leekitcharoenphon, P.; Bortolaia, V.; Moreno, M.A. Clonal and plasmid-mediated flow of ESBL/AmpC genes in Escherichia coli in a commercial laying hen farm. Vet. Microbiol. 2022, 270, 109453. [Google Scholar] [CrossRef] [Scilit]
- Rahman, A.; Rahman Chowdhury, M.S.; Hossain, H.; Elsaid, F.G.; Almutairi, L.A.; Begum, R.; Sabrin, M.S.; Akanda, A.R.; Mukter Hossain, M.M.; Rafiqul Islam, M.R.; et al. Identification of Virulence Genes and Multidrug Resistance in Shiga-Toxin Producing Escherichia coli (STEC) from Migratory and Captive Wild Birds. Pak. Vet. J. 2024, 44, 1120–1130. [Google Scholar]
- General Directorate of Meteorology. Official Statistics: Provincial Seasonal Norms. 2023. Available online: https://www.mgm.gov.tr/veridegerlendirme/il-ve-ilceler-istatistik.aspx?m=KONYA (accessed on 1 September 2023).
- Khalid, N.; Bukhari, S.M.; Alshahrani, M.Y.; Rehman, K.U.; Ahmad, S.; Andleeb, S.; Javid, A.; Azam, S.M. Nucleotide analysis and prevalence of Escherichia coli isolated from feces of some captive avian species. J. King Saud Univ. Sci. 2023, 35, 102375. [Google Scholar] [CrossRef] [Scilit]
- Wibisono, F.J.; Sumiatro, B.; Untari, T.; Effendi, M.H.; Permatasari, D.A.; Witaningrum, A.M. Molecular identification of ctx gene of extended spectrum beta-lactamases (ESBL) producing Escherichia coli on layer chicken in Blitar, Indonesia. J. Anim. Plant Sci. 2021, 31, 954–959. [Google Scholar]
- Aliyu, A.B.; Jalila, A.; Saleha, A.A.; Zunita, Z. ESBL Producing E. coli in Chickens and Poultry Farms Environment in Selangor, Malaysia: A Cross-Sectional Study on Their Occurrence and Associated Risk Factors with Environment and Public Health Importance. Zoonoses Public Health 2024, 71, 962–971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gazal, L.E.D.S.; Medeiros, L.P.; Dibo, M.; Nishio, E.K.; Koga, V.L.; Gonçalves, B.C.; Grassotti, T.T.; Leal de Camargo, T.C.; Pinheiro, J.J.; Vespero, E.C.; et al. Detection of ESBL/AmpC-producing and fosfomycin-resistant Escherichia coli from different sources in poultry production in Southern Brazil. Front. Microbiol. 2021, 11, 604544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ewers, C.; De Jong, A.; Prenger-Berninghoff, E.; El Garch, F.; Leidner, U.; Tiwari, S.K.; Semmler, T. Genomic diversity and virulence potential of ESBL-and AmpC-β-lactamase-producing Escherichia coli strains from healthy food animals across Europe. Front. Microbiol. 2021, 12, 626774. [Google Scholar]
- Effendi, M.H.; Wibisono, F.J.; Witaningrum, A.M.; Permatasari, D.A. Identification of blaTEM and blaSHV genes of extended spectrum beta lactamase (ESBL) producing Escherichia coli from broilers chicken in Blitar, Indonesia. Sys. Rev. Pharm. 2021, 12, 976–981. [Google Scholar]
- Faridah, H.D.; Wibisono, F.M.; Wibisono, F.J.; Nisa, N.; Fatimah, F.; Effendi, M.H.; Ugbo, E.N.; Khairullah, A.R.; Kurniawan, S.C.; Silaen, O.S.M. Prevalence of the blaCTX-M and blaTEM genes among extended-spectrum beta lactamase-producing Escherichia coli isolated from broiler chickens in Indonesia. J. Vet. Res. 2023, 67, 179–186. [Google Scholar] [PubMed]
- Kawamura, K.; Nagano, N.; Suzuki, M.; Wachino, J.; Kimura, K.; Arakawa, Y. ESBL-producing Escherichia coli and its rapid rise among healthy people. Food Saf. 2017, 5, 122–150. [Google Scholar]
- Overdevest, I.; Willemsen, I.; Rijnsburger, M.; Eustace, A.; Xu, L.; Hawkey, P.; Heck, M.; Savelkoul, P.; Vandenbroucke-Grauls, C.; van der Zwaluw, K.; et al. Extended-spectrum β-lactamase genes of Escherichia coli in chicken meat and humans, the Netherlands. Emerg. Infect. Dis. 2011, 17, 1216–1222. [Google Scholar] [CrossRef] [Scilit]
- Huijbers, P.M.C.; Graat, E.A.M.; Haenen, A.P.J.; van Santen, M.G.; Van Essen-Zandbergen, A.; Mevius, D.J.; van Duijkeren, E.; van Hoek, A.H.A.M. Extended-spectrum and AmpCβ-lactamase-producing Escherichia coli in broilers and people living and/or working on broiler farms: Prevalence, risk factors and molecular characteristics. J. Antimicrob. Chemother. 2014, 69, 2669–2675. [Google Scholar]
- Harada, S.; Ishii, Y.; Yamaguchi, K. Extended-spectrum β-lactamases: Implications for the clinical laboratory and therapy. Korean J. Lab. Med. 2008, 28, 401–412. [Google Scholar] [PubMed]
- Meng, M.; Li, Y.; Yao, H. Plasmid-mediated transfer of antibiotic resistance genes in soil. Antibiotics 2022, 11, 525. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Huang, S.; Zhang, D.; Ji, H.; Ni, Y.; Zhang, X.; Dong, J.; Li, B. Characteristics of Extended-Spectrum β-Lactamase-Producing Escherichia coli Derived from Food and Humans in Northern Xinjiang, China. Foodborne Pathog. Dis. 2023, 20, 270–278. [Google Scholar] [PubMed]
- Widodo, A.; Khairullah, A.R.; Effendi, M.H.; Moses, I.B.; Agustin, A.L.D. Extended-spectrum β-lactamase-producing Escherichia coli from poultry: A review. Vet. World 2024, 17, 2017. [Google Scholar]
- Becker, E.; Projahn, M.; Burow, E.; Käsbohrer, A. Are there effective intervention measures in broiler production against the ESBL/AmpC producer Escherichia coli? Pathogens 2021, 10, 608. [Google Scholar] [CrossRef] [Scilit]
- Olopade, A.; Bitrus, A.A.; Momoh-Zekeri, A.H.; Bamayi, P.H. Multi-drug resistant phenotypes of extended-spectrum β-lactamase (ESBL)-producing E. coli from layer chickens. Iraqi J. Vet. Sci. 2022, 36, 945–951. [Google Scholar]
- Pais, S.; Costa, M.; Barata, A.R.; Rodrigues, L.; Afonso, I.M.; Almeida, G. Evaluation of antimicrobial resistance of different phylogroups of Escherichia coli isolates from feces of breeding and laying hens. Antibiotics 2023, 12, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wibisono, F.J.; Sumiatro, B.; Untari, T.; Effendi, M.H.; Permatasari, D.A.; Witaningrum, A.M. Pattern of antibiotic resistance on extended-spectrum beta-lactamases genes producing Escherichia coli on laying hens in Blitar, Indonesia. Biodiversitas 2020, 21, 4631–4635. [Google Scholar] [CrossRef] [Scilit]
- Benameur, Q.; Gervasi, T.; Dahloum, L.; Rechidi-Sidhoum, N.; Benklaouz, M.B.; Yakubu, A. Multidrug-resistant Escherichia coli isolated from cleaned and disinfected poultry houses prior to day-old chick placement. J. Environ. Qual. 2023, 52, 296–302. [Google Scholar] [CrossRef] [Scilit]
- ISO 18593:2018; Microbiology of the Food Chain—Horizontal Methods for Surface Sampling. 2nd ed. International Organization for Standardization: Geneva, Switzerland, 2018.
- Hess-Kosa, K. Indoor Air Quality: Sampling Methodologies; CRC Press: Boca Raton, FL, USA, 2010. [Google Scholar]
- ISO 19458:2006; Water Quality—Sampling for Microbiological Analysis. 1st ed. International Organization for Standardization: Geneva, Switzerland, 2006.
- Ongut, G.; Daloglu, A.E.; Baysan, B.O.; Daglar, D.; Ogunc, D.; Sekercioglu, A.O.; Colak, D.; Gunseren, F. Evaluation of a chromogenic medium for detection of extended-spectrum-beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae strains. Clin. Lab. 2014, 60, 1213–1215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Griffiths, M.W. PCR differentiation of Escherichia coli from other Gram-negative bacteria using primers derived from the nucleotide sequences flanking the gene encoding the universal stress protein. Lett. Appl. Microbiol. 1998, 27, 369–371. [Google Scholar] [CrossRef] [Scilit]
- Fang, H.; Ataker, F.; Hedin, G.; Dornbusch, K. Molecular epidemiology of extended-spectrum beta-lactamases among Escherichia coli isolates collected in a Swedish hospital an dits associated health care facilities from 2001 to 2006. J. Clin. Microbiol. 2008, 46, 707–712. [Google Scholar] [CrossRef] [Scilit]
- Dallenne, C.; Da Costa, A.; Decre, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important b-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [Scilit]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [Scilit]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing: Seventeenth Informational Suplement Approved Standard M100-S17. Available online: https://clsi.org/standards/products/microbiology/documents/m100/ (accessed on 1 September 2024).
- EUCAST. The European Committee on Antimicrobial Susceptibility Testing, Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 13.1. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_13.1_Breakpoint_Tables.pdf (accessed on 1 September 2024).



| Sample Points | Samples Taken for Analysis | January | February | March | June | July | August |
|---|---|---|---|---|---|---|---|
| Cloaca | C1 | - | - | - | - | - | - |
| C2 | - | - | - | - | - | - | |
| C3 | - | - | - | - | - | - | |
| C4 | - | - | - | - | - | - | |
| C5 | - | - | - | - | - | - | |
| Personnel | P1 | - | +1 | - | - | - | - |
| P2 | - | - | - | +6 | - | - | |
| P3 | - | - | - | +7 | - | - | |
| P4 | - | - | - | - | - | - | |
| P5 | - | - | - | - | - | +13 | |
| Air | slaughter line | - | - | - | - | - | - |
| packaging–labeling | - | - | - | - | - | - | |
| cold storage warehouse | - | - | - | - | - | - | |
| Wastewater | untreated | - | - | +3 | - | +9 | +14 |
| treated | - | - | - | - | - | - | |
| Carcasses | after bloodletting1 | - | - | - | - | +10 | - |
| after bloodletting2 | - | - | - | - | - | - | |
| after evisceration1 | - | - | - | - | +11 | - | |
| after evisceration2 | - | - | - | - | - | - | |
| after evisceration3 | - | - | +4 | - | - | +15 | |
| after evisceration4 | - | - | - | - | - | +16 | |
| Egg | egg1 | - | +2 | +5 | - | - | +17 |
| egg2 | - | - | - | +8 | - | - | |
| Final product | FP1 | - | - | - | - | +12 | - |
| FP2 | - | - | - | - | - | - |
| Sample | uspA | blaSHV | blaTEM | blaOXA | blaCTX-M | |||
|---|---|---|---|---|---|---|---|---|
| blaCTX-M1 | blaCTX-M2 | blaCTX-M9 | blaCTX-M8/25 | |||||
| Personnel 1 | + | - | + | - | + | - | - | - |
| After evisceration 1 | + | - | - | - | + | - | - | - |
| Raw wastewater 1 | + | - | + | - | + | - | - | - |
| Personnel 2 | + | - | - | - | + | - | - | - |
| Personnel 3 | + | - | + | - | + | - | - | - |
| After evisceration 2 | + | + | - | + | + | - | - | - |
| Raw wastewater 2 | + | - | + | - | + | - | - | - |
| After evisceration 3 | + | - | - | - | + | - | - | - |
| After evisceration 4 | + | - | + | - | + | - | - | - |
| Raw wastewater 3 | + | - | - | - | + | - | - | - |
| Isolate | AMC | AM | ATM | FEP | CPD | CXM | KF | IPM | MEM | MOX |
|---|---|---|---|---|---|---|---|---|---|---|
| P1 | R | R | R | R | R | R | R | S | S | R |
| P2 | R | R | R | R | R | R | R | S | S | I |
| P3 | R | R | R | R | R | R | R | S | S | I |
| P4 | R | R | R | R | R | R | R | S | S | S |
| RW1 | R | R | R | R | R | R | R | S | S | S |
| RW2 | R | R | R | R | R | R | R | S | S | S |
| RW3 | R | R | R | R | R | R | R | S | S | S |
| CAB1 | R | R | R | R | R | R | R | S | S | S |
| CAE1 | R | R | R | R | R | R | R | S | S | S |
| CAE2 | R | R | R | R | R | R | R | S | S | R |
| CAE3 | R | R | R | R | R | R | R | S | S | S |
| CAE4 | R | R | R | R | R | R | R | S | S | I |
| FP1 | R | R | R | R | R | R | R | S | S | S |
| E1 | R | R | R | R | R | R | R | S | S | I |
| E2 | R | R | R | R | R | R | R | S | S | S |
| E3 | R | R | R | R | R | R | R | S | S | I |
| E4 | R | R | R | R | R | R | R | S | S | I |
| %R | 100 | 100 | 100 | 100 | 100 | 100 | 100 | 0 | 0 | 29.4 |
| %I | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 35.3 |
| %S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 100 | 100 | 35.3 |
| Target Gene | Primer Sequence (5′ to 3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|
| blaSHV | CTTTATCGGCCCTCACTCAA AGGTGCTCATCATGGGAAAG | 237 | [40] |
| blaTEM | CGCCGCATACACTATTCTCAGAATGA ACGCTCACCGGCTCCAGATTTAT | 445 | [40] |
| blaOXA | ACACAATACATATCAACTTCGC AGTGTGTTTAGAATGGTGATC | 813 | [40] |
| blaCTX-M | ATGTGCAGYACCAGTAARGTKATGGC TGGGTRAARTARGTSACCAGAAYCAGCGG | 593 | [40] |
| blaCTX-M1 | CGTCACGCTGTTGT TAGGAA TCGGTTCGCTTTCACTTTTC | 227 | [40] |
| blaCTX-M2 | GGAGAAAAGTTCGGGAGGTC GCTTATCGCTCTCGCTCTGT | 155 | [40] |
| blaCTX-M9 | ACGTGGCTCAAAGGCAATAC CGG CTG GGT AAA ATA GGT CA | 174 | [40] |
| blaCTX-M8/25 | AACRCRCAGACGCTCTAC TCGAGCCGGAASGTGTYAT | 326 | [41] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Telli, N.; Telli, A.E.; Biçer, Y.; Turkal, G. Extended-Spectrum-Beta-Lactamase (ESBL)-Producing Escherichia coli in Laying Hens: Slaughterhouse Prevalence and Antibiotic Resistance Patterns. Antibiotics 2025, 14, 351. https://doi.org/10.3390/antibiotics14040351
Telli N, Telli AE, Biçer Y, Turkal G. Extended-Spectrum-Beta-Lactamase (ESBL)-Producing Escherichia coli in Laying Hens: Slaughterhouse Prevalence and Antibiotic Resistance Patterns. Antibiotics. 2025; 14(4):351. https://doi.org/10.3390/antibiotics14040351
Chicago/Turabian StyleTelli, Nihat, Arife Ezgi Telli, Yusuf Biçer, and Gamze Turkal. 2025. "Extended-Spectrum-Beta-Lactamase (ESBL)-Producing Escherichia coli in Laying Hens: Slaughterhouse Prevalence and Antibiotic Resistance Patterns" Antibiotics 14, no. 4: 351. https://doi.org/10.3390/antibiotics14040351
APA StyleTelli, N., Telli, A. E., Biçer, Y., & Turkal, G. (2025). Extended-Spectrum-Beta-Lactamase (ESBL)-Producing Escherichia coli in Laying Hens: Slaughterhouse Prevalence and Antibiotic Resistance Patterns. Antibiotics, 14(4), 351. https://doi.org/10.3390/antibiotics14040351

