Next Article in Journal
In Vitro Antibacterial Efficacy of Recombinant Phage-Derived Endolysin LysTAC1 Against Carbapenem-Resistant Acinetobacter baumannii
Previous Article in Journal
Insight into the Roles of Albumin—Alone and in Combination with Either Voriconazole or Antimicrobial Peptides Derived from Chromogranin A—In the Growth of Different Microbial Species
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

In Vitro Activity of Delafloxacin Against Corynebacterium spp.

by
Montserrat Muñoz-Rosa
1,2,
Cristina Elías-López
2,3,*,
Rosa Pedraza
1,2,
Cristina Riazzo
1,2,
Cristina Arjona-Torres
2,
Isabel Machuca
2,3,4,
Rocio Tejero-García
1,2,
Julian Torre-Cisneros
2,3,4 and
Luis Martínez-Martínez
1,2,3,5
1
Unit of Microbiology, Reina Sofía University Hospital, 14004 Cordoba, Spain
2
Maimonides Biomedical Research Institute of Cordoba, Reina Sofía University Hospital, University of Cordoba (IMIBIC/HURS/UCO), 14004 Cordoba, Spain
3
CIBER de Enfermedades Infecciosas (CIBERINFEC), Instituto de Salud Carlos III, 28029 Madrid, Spain
4
Clinical Unit of Infectious Diseases, Reina Sofía University Hospital, 14004 Cordoba, Spain
5
Department of Agricultural Chemistry, Soil Sciences and Microbiology, University of Cordoba, 14071 Cordoba, Spain
*
Author to whom correspondence should be addressed.
Antibiotics 2025, 14(10), 973; https://doi.org/10.3390/antibiotics14100973
Submission received: 30 July 2025 / Revised: 26 August 2025 / Accepted: 4 September 2025 / Published: 26 September 2025

Abstract

Background/Objectives: The susceptibility of Corynebacterium spp. to antimicrobial agents is species-related, with increasing levels of resistance to fluoroquinolones in several species related to their continued use in clinical practice. The objectives were to determine the in vitro activity of delafloxacin in comparison with other fluoroquinolones against clinical isolates of Corynebacterium spp., to compare MICs of delafloxacin obtained with gradient strips and with reference microdilution, and to investigate the mechanisms related to fluoroquinolone resistance in the tested strains. Methods: Fifty-three clinical isolates, assigned to five species of Corynebacterium spp., were evaluated using reference microdilution for delafloxacin, ciprofloxacin, levofloxacin, and moxifloxacin (with and without reserpine or phenylalanine-arginine β-naphthylamide), and gradient strips for delafloxacin. The QRDR of the gyrA gene was amplified using primers specific to the different species, and mutations were defined after aligning against the corresponding reference sequences. Results: Delafloxacin was the most active compound with MIC50/MIC90 values of 0.5/8 mg/L. Single mutations at the QRDR were observed in isolates, with MICs of delafloxacin ranging from 0.016 to 4 mg/L, while double mutations occurred in isolates, with MICs ranging from 0.125 to 16 mg/L. The delafloxacin gradient strips showed an essential agreement of 88.7%, bias of −5%, and a Kappa index of 0.848. Conclusions: Increased MICs of delafloxacin against Corynebacterium spp. are related to the presence of non-conservative mutations in the QRDR of gyrA. Delafloxacin gradient strips could be a reasonable alternative for use in the clinical routine of the microbiology laboratory. Delafloxacin could represent an alternative for treating infections due to some species of Corynebacterium.

1. Introduction

Corynebacterium species other than C. diphteriae are members of the normal microbiota of skin and mucosa, but have also been described as etiologic agents of a variety of human infections [1,2,3]. Susceptibility of Corynebacterium spp. to antimicrobial agents is species-related, and several species are frequently resistant to multiple antimicrobial agents [4,5,6]. Glycopeptides and linezolid present excellent in vitro activity against most clinically relevant species [1,4,5,6,7]. β-lactams, fluoroquinolones, aminoglycosides, macrolides, and tetracyclines are also of therapeutic interest for Corynebacterium infections [4,5,6].
Previous studies have evaluated the in vitro activity of fluoroquinolones, including ciprofloxacin [6,8,9,10], levofloxacin [6,11], and moxifloxacin [6,10], against Corynebacterium spp. As for other organisms, higher rates of resistance to fluoroquinolones in Corynebacterium spp. have been observed after the continuous use of fluoroquinolones in clinical practice [8,9,10,11,12]. Corynebacterium spp. lack topoisomerase IV [9], and their resistance to fluoroquinolones is primarily linked to point mutations in the quinolone resistance determining region (QRDR) of the gyrA gene, encoding the subunit A of DNA gyrase [9,12,13]. The improved activity of delafloxacin against multiple Gram-positive bacteria compared to older quinolones suggests it may also be more active against Corynebacterium spp.
Delafloxacin is a new non-zwitterionic dual quinolone, with affinity for both DNA gyrase and topoisomerase IV [14,15]. It presents better in vitro activity against Staphylococcus aureus and Streptococcus pneumoniae than older quinolones [16]. There is limited information on the activity of delafloxacin against Corynebacterium spp. In one study on bacteria cultured from patients with cancer [17], minimal inhibitory concentration (MIC) range, MIC50, and MIC90 of delafloxacin against 30 Corynebacterium spp. were ≤0.03–4, 0.06, and 2 mg/L, much lower than those of ciprofloxacin and levofloxacin. In another recent study [18] on clinical isolates from a single centre (n = 116, 69% C. striatum and 16% C. amycolatum), MIC range, MIC50, and MIC90 of delafloxacin were 0.002–>1, 1, and >1 mg/L.
Delafloxacin is not yet included in the antimicrobial panels for automatic susceptibility testing systems commonly used in clinical laboratories, and in vitro testing of this compound is usually performed using discs or gradient strips, although evidence of the reliability of these approaches when considering Corynebacterium spp. is lacking.
The objectives of this study were as follows: (i) to determine the in vitro activity of delafloxacin in comparison with ciprofloxacin, levofloxacin, and moxifloxacin against a collection of clinical isolates of Corynebacterium spp. using standardized broth microdilution (BMD), (ii) to compare MIC values of delafloxacin obtained with gradient strips with those obtained with BMD, and (iii) to investigate the mechanisms related to fluoroquinolone resistance in the tested strains.

2. Results

The MIC range, MIC50, and MIC90 values obtained with BMD and gradient strips are presented in Table 1. Detailed fluoroquinolone MICs and changes in QRDR of gyrA for every isolate are presented in Table 2.
MICs of moxifloxacin were at least two times lower than those of ciprofloxacin for 45/53 (84.9%) isolates, although for C. glucuronolyticum MICs of moxifloxacin were the same (4/10 isolates) or two times higher than MICs of ciprofloxacin (3/10 isolates). Similarly, MICs of moxifloxacin were at least four times lower than those of levofloxacin for 42/53 (79.2%). MICs of ciprofloxacin and levofloxacin were within one 2-log dilution step for C. jeikeium (10/10 isolates), C. striatum (10/10 isolates), and C. urealyticum (9/10 isolates), but were lower for ciprofloxacin in the case of C. glucuronolyticum (8/10 isolates) and C. amycolatum with wild-type gyrA (4/4).
Delafloxacin was at least two times more active than the three other tested fluoroquinolones for 50/53 (94.3%) isolates. The remaining three isolates correspond to one C. jeikeium with a double mutation in QRDR, and two C. glucuronolyticum with wild-type QRDR. For the 53 Corynebacterium spp. evaluated (when using reference BMD), 43.4% and 26.4% were inhibited at ≤0.25 mg/L and ≤0.016 mg/L. At ≤0.25 mg/L, the highest percentage of inhibition was observed for C. amycolatum (84.6%) and the lowest for C. striatum (0%) and C. urealyticum (10.0%) (Table 1).
MICs of delafloxacin were just 4, 8, 16, and ≥32 times lower than those of moxifloxacin for 21, 13, 3, and 4 isolates, and for 3 and 1 additional isolates they were ≥4 and ≥8 times lower (Table 2). From another point of view and for the complete set of tested isolates, the MIC50 of delafloxacin by the reference method was 8, 16, and 32 times lower than the MIC50 of moxifloxacin, ciprofloxacin, and levofloxacin, respectively. Similarly, the MIC90 of delafloxacin was 4, >4, and >4 times lower than the MIC90 of moxifloxacin, ciprofloxacin, and levofloxacin, respectively (Table 1).
All isolates (except one C. amycolatum) for which MICs of delafloxacin were ≤0.016 mg/L had a wild type gyrA QRDR. Most gyrA QRDR mutations occurred in position 87 (Ser in the five evaluated species) alone or combined with a second mutation in position 91 (Asp in the wild type sequences). In several species, a particular mutation pattern was observed in most isolates (i.e., Ser87Ile in C. glucuronolyticum, Ser87Phe plus Asp91Ala in C. striatum, or Ser87Val plus Asp91Tyr in C. urealyticum). As far as we know, some novel mutations in a concrete species have also been observed, as detailed in Table 2, expanding our information on the importance on this region on resistance of Corynebacterium spp. to fluoroquinolones. A point mutation in the QRDR of gyrA was related to a moderate increase in MIC values, while double mutations were observed among isolates with MICs of delafloxacin ranging from 0.125 to 16 mg/L (Table 2). This confirms previous observations in Corynebacterium spp. [9,12,13].
As shown in Table 2, MICs of delafloxacin for isolates of the same species with just the same gyrA QRDR mutation(s) are not the same: i.e., for C. glucuronolyticum isolates with the Ser87Ile change, MICs range from 0.25 to 2 mg/L, and for C. amycolatum with Ser87Arg, MICs range from 0.016 to 0.125 mg/L, suggesting the presence of additional mechanism(s) of resistance. However, for all tested isolates, MIC values in the presence of the efflux pump inhibitors reserpine or phenylalanine-arginine β-naphthylamide (PAβN) were the same or within one two-fold dilution of those obtained in the absence of the corresponding inhibitor.
The delafloxacin gradient strips showed an essential agreement (EA) of 88.7%, slightly below the threshold of the acceptance criteria (≥90%). Bias was −5% compared to the reference method, which is inside the acceptable range of ±30%. However, the categorical agreement (CA) was 92.5% and the Kappa index was 0.848, indicating an almost perfect concordance. MIC50 and MIC90 values of delafloxacin by BMD and gradients strips were the same or within one dilution step, except for the MIC50 for C. jeikeium and the MIC90 for C. urealyticum (Table 1, Figure 1).

3. Discussion

Because of the increasing clinical relevance of multiple species of Corynebacterium spp. other than C. diphtheriae and their frequent resistance to available antimicrobial agents, it is necessary to evaluate the activity of new compounds against these organisms. Delafloxacin is a new fluoroquinolone of great therapeutic interest because of its dual activity against both DNA gyrase and topoisomerase IV [6,7]. This translates into an improved activity against different Gram-positive bacteria (i.e., S. aureus, Streptococcus pneumoniae), for which ciprofloxacin and most other fluoroquinolones preferentially target topoisomerase IV [19]. Although Corynebacterium spp. lacks topoisomerase IV, delafloxacin is still more active against these microorganisms than the three tested fluoroquinolones. This can be related to the previous observation that, beyond its dual action on DNA gyrase and topoisomerase IV, the main target of delafloxacin for S. aureus is, in fact, GyrA, for which delafloxacin is about six times more active than ciprofloxacin [20]. It is likely that targeting DNA gyrase is more efficient than interacting with topoisomerase IV, since the former works ahead of the replication fork to remove DNA supercoils and, consequently, inhibits faster DNA replication. Additionally, delafloxacin differs structurally from other quinolones in presenting a 3-hydroxyazetidine-1-yl substituent at position 7 of the 6-fluoroquinolone core [20], which determines that under acidic conditions the compound is predominantly in a non-ionized form, which improves the activity in acid environments and, in addition, may favor the intrabacterial accumulation of the compound in comparison with other fluoroquinolones.
A large proportion (40/53; 75.5%) of the isolates evaluated in this study were resistant to both ciprofloxacin and moxifloxacin, according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints (breakpoints have not been defined for levofloxacin). Delafloxacin is much more active than the tested comparators, in particular against C. amycolatum, C. glucuronolyticum, and, to a lesser extent, C. jeikeium, although MICs of delafloxacin increase in parallel to those of comparative quinolones, as also indicated in a recent report [18]. The worse results were obtained with C. striatum and C. urealyticum; both species often show high resistance rates to all fluoroquinolones, limiting their use as possible treatment options.
In the absence of clinical breakpoints of delafloxacin for Corynebacterium spp. to interpret susceptibility testing data, it is difficult to evaluate the actual impact of its improved in vitro activity from a therapeutic point of view. Considering EUCAST breakpoints for S. aureus (susceptible: ≤0.25 mg/L for skin and skin structure infections and ≤0.016 mg/L for community-acquired pneumonia, respectively), only 45.3% and 21.4% of the tested isolates were below these reference breakpoints. As a comparison, 75.5% and 71.7% of the isolates were resistant to ciprofloxacin and moxifloxacin, respectively.
Despite the limited number of studies in which mutations in the QRDR of the gyrA gene have been determined in Corynebacterium spp., most mutations detected in this study have already been reported. As an example, the Ser87Phe plus Asp91Ala double change frequently observed in C. striatum in this study was also the most common pattern in other studies [9,12].
Beyond the clear importance of gyrA mutations in compromising the in vitro activity of delafloxacin, the observation that isolates with the same mutations present different MICs of the compound suggests that other mechanisms of resistance modulate delafloxacin resistance in Corynebacterium spp. Resistance to fluoroquinolones caused by efflux pumps has been described in Staphylococcus spp. and other Gram-positive organisms [21,22], which can be easily demonstrated using active efflux inhibitors [23,24]. The relevance of active efflux in the resistance of Corynebacterium spp. to tetracycline and other compounds has also been previously reported [25,26,27]. We hypothesized that efflux pumps could also contribute to fluoroquinolone resistance in our isolates, but we have not observed any relevant difference in the MICs of fluoroquinolones determined in the presence of reserpine or PaβN. This may indicate that active efflux is not really an important mechanism of resistance of the tested isolates against delafloxacin and other fluoroquinolones, or that the inhibitors are not adequate to inhibit such a mechanism, perhaps because their penetration into corynebacteria is limited due to the different surface structure of this microorganism compared to Staphylococcus or other Gram-positive bacteria. New studies are warranted to evaluate the importance of active efflux and other mechanisms as a cause of delafloxacin resistance in Corynebacterium spp.
Although the reference method for determining the MIC of delafloxacin is broth microdilution, this method is difficult to implement in daily work, and, as this antibiotic is not yet included in most commercial panels of semi-automated microdilution systems, we have explored the reliability of using gradient strips. The obtained results suggest that this approach may represent an acceptable option for testing delafloxacin against Corynebacterium spp., although further studies are needed to define categorical errors with the strips when, eventually, specific clinical breakpoints are defined.
The major limitation of this study is that we have focused just on the five species commonly found in our centre, but have not evaluated other species of Corynebacterium or related organisms, and that the number of studied isolates was also limited. Further research on these groups of Gram-positive bacteria is also warranted.

4. Materials and Methods

4.1. Bacterial Strains

Fifty-three clinical isolates (one per patient) of Corynebacterium spp., including C. amycolatum (n = 13), C. glucuronolyticum (n = 10), C. jeikeium (n = 10), C. striatum (n = 10), and C. urealyticum (n = 10), recovered at the clinical microbiology laboratory of the Reina Sofía University Hospital of Cordoba, Spain, and representing the most frequently identified species at our centre during 2018–2022, were evaluated. Species were identified using MALDI-TOF/MS (MALDI Biotyper; Bruker Daltonics, Bremen, Germany).

4.2. Susceptibility Testing

MICs of delafloxacin, ciprofloxacin, levofloxacin, and moxifloxacin (all from MedChemExpress, Monmouth Junction, NJ, USA), with and without reserpine (20 mg/L) (MedChemExpress) and PAβN (25 mg/L) (Sigma-Aldrich, Taufkirchen, Germany), were determined by reference BMD (ISO guidelines) [28] using cation-adjusted Mueller–Hinton broth (Sigma-Aldrich) supplemented with 5% lysed horse blood (ThermoFisher, Waltham, MA, USA) and 20 mg/L β-NAD (Sigma-Aldrich) according to the EUCAST recommendations for fastidious organisms. Streptococcus pneumoniae ATCC 49619 and Staphylococcus aureus ATCC 29213 were used as control strains.
Additionally, susceptibility to delafloxacin was also determined with gradient strips (Etest, BioMèrieux, Rhone, France) using Mueller–Hinton agar with 5% lysed horse blood and 20 mg/L β-NAD (BioMérieux, France). Although EUCAST has not defined clinical breakpoints of delafloxacin for Corynebacterium, for analyzing the impact of gyrA mutations on the MICs of delafloxacin, the EUCAST breakpoints (V_15.0) [29] for Staphylococcus aureus (susceptible: ≤0.25 and ≤0.016 mg/L, for skin and skin structure infections and for community-acquired pneumonia, respectively) were considered.
To evaluate the performance of the gradient strips, EA and bias were calculated according to the recommendations in ISO-20776-2:2021 [30]. Rates of CA were also calculated following the definitions by ISO 20776-2:2007 [31]. The Kappa index was used to evaluate concordance based on Landis and Koch guidelines [32], and was calculated using the Statistical Package for the Social Sciences (IBM SPSS Statistics 19.0, Armonk, NY, USA) software.

4.3. Sequencing and Gene Analysis

To amplify the QRDR of the gyrA gene of C. amycolatum, C. jeikeium, C. striatum, and C. urealyticum, primers CorynA1: GCGGCTACGTAAAGTCC and CorynA2: CCGCCGGAGCCGTTCAT [9] were used. A novel pair of primers for QRDR of C. glucuronolyticum were designed (GluQRDR-F: TACGCATCCTTAATGCCCTG and GluQRDR-R: CCAATCGACCTGAATGAGGA). The amplicons (both strands) were sequenced using Sanger technology (Sistemas Genómicos, Valencia, Spain). Quality control of the sequences was assessed with CLC Genomics Workbench 24.0.3 (Qiagen, Germantown, MD, USA) by manual check and correction of basecalls in the electropherogram and end-trimming. Mutations were defined after BLAST alignment [https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 1 January 2025)] against the following corresponding reference sequences: C. amycolatum quinolone-susceptible clinical isolate [9] (Accession number NCBI: AY559039), C. glucuronolyticum strain FDAARGOS_1053 (Accession number NCBI: NZ_CP066007.1), C. jeikeium ATCC 43734 (Accession number NCBI: NZ_GG700813.1), C. striatum ATCC 6940 (Accession number NCBI: AY559038), and C. urealyticum DSM 7109 [33] (Accession number NCBI: NC_010545.1).

5. Conclusions

In summary, compared to the other fluoroquinolones analyzed, delafloxacin was the most in vitro active compound against Corynebacterium spp. It may represent a therapeutic alternative for infections caused by these organisms, and could help preserve the efficacy of fluoroquinolones through targeted therapy. The clinical implications of these findings warrant further study, including clinical efficacy and risk of emergence of new resistance.
The increase in the MICs of fluoroquinolones against Corynebacterium spp. is related to non-conservative mutations in the QRDR of the gyrA gene of the studied isolates. The level of increase depends on whether there are one or two mutations, their positions, and the considered species. Indirect evidence suggests that additional mechanisms contribute to decreased activity of delafloxacin against Corynebacterium spp.
Gradient strips may represent a reasonable strategy for determining the MIC of delafloxacin against Corynebacterium spp. in routine work.

Author Contributions

Conceptualization, M.M.-R., C.E.-L., and L.M.-M.; methodology, M.M.-R., C.E.-L., R.P., C.R., and C.A.-T.; software, M.M.-R., C.E.-L., and R.P.; validation, R.T.-G., C.R., C.A.-T., and L.M.-M.; formal analysis, M.M.-R. and C.E.-L.; investigation, M.M.-R., C.E.-L., R.P., C.R., R.T.-G., and C.A.-T.; resources, L.M.-M.; data curation, M.M.-R., C.E.-L., and L.M.-M.; writing—original draft preparation, M.M.-R. and C.E.-L.; writing—review and editing, M.M.-R., C.E.-L., R.P., C.R., C.A.-T., R.T.-G., I.M., J.T.-C., and L.M.-M.; visualization, J.T.-C. and L.M.-M.; supervision, L.M.-M.; project administration, L.M.-M.; funding acquisition, L.M.-M. All authors have read and agreed to the published version of the manuscript.

Funding

The authors declare that this study received funding from Laboratorios Menarini S.A. The funder was not involved in the study design, collection, analysis, interpretation of data, the writing of this article or the decision to submit it for publication.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author(s).

Acknowledgments

We acknowledge Jesús Navas (University of Cantabria and Valdecilla Biomedical Research Institute, IDIVAL, Santander, Spain) for his contribution in designing primers and conditions for PCR of the QRDR of gyrA of C. glucuronolyticum.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
BMDBroth microdilution
CACategorical agreement
EAEssential agreement
GSGradient strip
MICMinimal inhibitory concentration
PAβNPhenylalanine-arginine β-naphthylamide
QRDRQuinolone resistance determining region

References

  1. Funke, G.; von Graevenitz, A.; Clarridge, J.E., 3rd; Bernard, K.A. Clinical microbiology of coryneform bacteria. Clin. Microbiol. Rev. 1997, 10, 125–159. [Google Scholar] [CrossRef]
  2. Bernard, K. The genus Corynebacterium and other medically relevant coryneform-like bacteria. J. Clin. Microbiol. 2012, 50, 3152–3158. [Google Scholar] [CrossRef] [PubMed]
  3. Zasada, A.A.; Mosiej, E. Contemporary microbiology and identification of Corynebacteria spp. causing infections in human. Lett. Appl. Microbiol. 2018, 66, 472–483. [Google Scholar] [CrossRef]
  4. Olender, A. Antibiotic resistance and detection of the most common mechanism of resistance (MLSB) of opportunistic Corynebacterium. Chemotherapy 2013, 59, 294–306. [Google Scholar] [CrossRef]
  5. Khodadadi, R.B.; El Zein, S.; Rivera O’Connor, C.G.; Stevens, R.W.; Schuetz, A.N.; Abu Saleh, O.M.; Fida, M. Retrospective analysis of antimicrobial susceptibility profiles of non-diphtheriae Corynebacterium species from a tertiary hospital and reference laboratory, 2012–2023. J. Clin. Microbiol. 2024, 62, e0119924. [Google Scholar] [CrossRef] [PubMed]
  6. Neemuchwala, A.; Soares, D.; Ravirajan, V.; Marchand-Austin, A.; Kus, J.V.; Patel, S.N. In Vitro Antibiotic Susceptibility Pattern of Non-diphtheriae Corynebacterium Isolates in Ontario, Canada, from 2011 to 2016. Antimicrob. Agents Chemother. 2018, 62, e01776-17. [Google Scholar] [CrossRef] [PubMed]
  7. Gómez-Garcés, J.L.; Alos, J.I.; Tamayo, J. In vitro activity of linezolid and 12 other antimicrobials against coryneform bacteria. Int. J. Antimicrob. Agents 2007, 29, 688–692. [Google Scholar] [CrossRef]
  8. Martínez-Martínez, L.; Suárez, A.I.; Ortega, M.C.; Perea, E.J. Comparative in vitro activities of new quinolones against coryneform bacteria. Antimicrob. Agents Chemother. 1994, 38, 1439–1441. [Google Scholar] [CrossRef][Green Version]
  9. Sierra, J.M.; Martinez-Martinez, L.; Vázquez, F.; Giralt, E.; Vila, J. Relationship between mutations in the gyrA gene and quinolone resistance in clinical isolates of Corynebacterium striatum and Corynebacterium amycolatum. Antimicrob. Agents Chemother. 2005, 49, 1714–1719. [Google Scholar] [CrossRef]
  10. Soriano, F.; Huelves, L.; Naves, P.; Rodríguez-Cerrato, V.; del Prado, G.; Ruiz, V.; Ponte, C. In vitro activity of ciprofloxacin, moxifloxacin, vancomycin and erythromycin against planktonic and biofilm forms of Corynebacterium urealyticum. J. Antimicrob. Chemother. 2009, 63, 353–356. [Google Scholar] [CrossRef]
  11. Martínez-Martínez, L.; Pascual, A.; Suárez, A.I.; Perea, E.J. In-vitro activity of levofloxacin, ofloxacin and D-ofloxacin against coryneform bacteria and Listeria monocytogenes. J. Antimicrob. Chemother. 1999, 43 (Suppl. 3), 27–32. [Google Scholar] [CrossRef]
  12. Wang, Y.; Shi, X.; Zhang, J.; Wang, Y.; Lv, Y.; Du, X.; ChaoLuMen, Q.; Wang, J. Wide- spread and diversity of mutation in the gyrA gene of quinolone-resistant Corynebacterium striatum strains isolated from three tertiary hospitals in China. Ann. Clin. Microbiol. Antimicrob. 2021, 20, 71. [Google Scholar] [CrossRef]
  13. Ramos, J.N.; Valadão, T.B.; Baio, P.V.P.; Mattos-Guaraldi, A.L.; Vieira, V.V. Novel mutations in the QRDR region gyrA gene in multidrug-resistance Corynebacterium spp. isolates from intravenous sites. Antonie Van Leeuwenhoek 2020, 113, 589–592. [Google Scholar] [CrossRef] [PubMed]
  14. Kocsis, B.; Gulyás, D.; Szabó, D. Delafloxacin, Finafloxacin, and Zabofloxacin: Novel Fluoroquinolones in the Antibiotic Pipeline. Antibiotics 2021, 10, 1506. [Google Scholar] [CrossRef]
  15. Markham, A. Delafloxacin: First Global Approval. Drugs 2017, 77, 1481–1486. [Google Scholar] [CrossRef]
  16. Turban, A.; Guérin, F.; Dinh, A.; Cattoir, V. Updated Review on Clinically Relevant Properties of Delafloxacin. Antibiotics 2023, 12, 1241. [Google Scholar] [CrossRef]
  17. Gerges, B.; Rosenblatt, J.; Shellburne, S.A.; Chaftari, A.M.; Hachem, R.; Raad, I. In vitro activity of tebipenem and comparator agents against bacterial pathogens isolated from patients with cancer. JAC-Antimicrob. Resist. 2023, 5, dlad132. [Google Scholar] [CrossRef]
  18. Bichali, A.R.; Piau, C.; Reissier, S.; Lecourt, M.; Collet, A.; Penven, M.; Guérin, F.; Cattoir, V. In Vitro Activity of Novel Antibiotics Against Corynebacterium spp. Clinical Isolates Responsible for Difficult-to-Treat Infections. Microb. Drug Resist. 2025, 31, 211–218. [Google Scholar] [CrossRef] [PubMed]
  19. Drlica, K.; Zhao, X. DNA gyrase, topoisomerase IV, and the 4-quinolones. Microbiol. Mol. Biol. Rev. 1997, 61, 377–392. [Google Scholar] [CrossRef] [PubMed]
  20. Nilius, A.M.; Shen, L.L.; Hensey-Rudloff, D.; Almer, L.S.; Beyer, J.M.; Balli, D.J.; Cai, Y.; Flamm, R.K. In vitro antibacterial potency and spectrum of ABT-492, a new fluoroquinolone. Antimicrob. Agents Chemother. 2003, 47, 3260–3269. [Google Scholar] [CrossRef]
  21. de la Rosa, J.M.O.; Fernández, M.A.; Rodríguez-Villodres, Á.; Casimiro-Soriguer, C.S.; Cisneros, J.M.; Lepe, J.A. High-level delafloxacin resistance through the combination of two different mechanisms in Staphylococcus aureus. Int. J. Antimicrob. Agents 2023, 61, 106795. [Google Scholar] [CrossRef]
  22. Hooper, D.C. Emerging mechanisms of fluoroquinolone resistance. Emerg. Infect. Dis. 2001, 7, 337–341. [Google Scholar] [CrossRef]
  23. Beyer, R.; Pestova, E.; Millichap, J.J.; Stosor, V.; Noskin, G.A.; Peterson, L.R. A convenient assay for estimating the possible involvement of efflux of fluoroquinolones by Streptococcus pneumoniae and Staphylococcus aureus: Evidence for diminished moxifloxacin, sparfloxacin, and trovafloxacin efflux. Antimicrob. Agents Chemother. 2000, 44, 798–801. [Google Scholar] [CrossRef] [PubMed]
  24. Kumar, G.; Kiran Tudu, A. Tackling multidrug-resistant Staphylococcus aureus by natural products and their analogues acting as NorA efflux pump inhibitors. Bioorganic Med. Chem. 2023, 80, 117187. [Google Scholar] [CrossRef] [PubMed]
  25. Su, T.; Che, C.; Han, J.; Zhao, Y.; Zhang, Z.; An, G.; Si, M.; Chen, C. The TetR-type regulator AtsR is involved in multidrug response in Corynebacterium glutamicum. Microb. Cell Factories 2022, 21, 123. [Google Scholar] [CrossRef]
  26. Kittl, S.; Brodard, I.; Tresch, M.; Perreten, V. Novel tetracycline resistance gene tet(65) located on a multi-resistance Corynebacterium plasmid. J. Antimicrob. Chemother. 2024, 79, 1023–1029. [Google Scholar] [CrossRef] [PubMed]
  27. Kim, H.J.; Kim, Y.; Lee, M.S.; Lee, H.S. Gene lmrB of Corynebacterium glutamicum confers efflux-mediated resistance to lincomycin. Mol. Cells 2001, 12, 112–116. [Google Scholar] [CrossRef]
  28. ISO 20776-1:2019; Susceptibility testing of infectious agents and evaluation of performance of antimicrobial susceptibility test devices. Part 1: Broth micro-dilution reference method for testing the in vitro activity of antimicrobial agents against rapidly growing aerobic bacteria involved in infectious diseases. ITEH Standards: San Francisco, CA, USA, 2019.
  29. The European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 15.0; European Committee on Antimicrobial Susceptibility Testing: Växjö, Sweden, 2025. [Google Scholar]
  30. ISO 20776-2:2021; Clinical Laboratory Testing and In Vitro Diagnostic Test Systems-Susceptibility Testing of Infectious Agents and Evaluation of Performance of Antimicrobial Susceptibility Test Devices-Part 2: Evaluation of Performance of Antimicrobial Susceptibility Test Devices Against Reference Broth Micro-Dilution. ITEH Standards: San Francisco, CA, USA, 2021.
  31. ISO 20776-2:2007; Clinical Laboratory Testing and In Vitro Diagnostic Test Systems-Susceptibility Testing of Infectious Agents and Evaluation of Performance of Antimicrobial Susceptibility Test Devices-Part 2: Evaluation of Performance of Antimicrobial Susceptibility Test Devices. ITEH Standards: San Francisco, CA, USA, 2007.
  32. Landis, J.R.; Koch, G. The measurement of observer agreement for categorical data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef]
  33. Tauch, A.; Trost, E.; Tilker, A.; Ludewig, U.; Schneiker, S.; Goesmann, A.; Arnold, W.; Bekel, T.; Brinkrolf, K.; Brune, I.; et al. The lifestyle of Corynebacterium urealyticum derived from its complete genome sequence established by pyrosequencing. J. Biotechnol. 2008, 136, 11–21. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Correlation between delafloxacin MICs as determined by reference broth microdilution (BMD) and Etest. Strains with MICs corresponding to BMD and 1-log2 dilution are indicated in the dark and light grey squares, respectively.
Figure 1. Correlation between delafloxacin MICs as determined by reference broth microdilution (BMD) and Etest. Strains with MICs corresponding to BMD and 1-log2 dilution are indicated in the dark and light grey squares, respectively.
Antibiotics 14 00973 g001
Table 1. In vitro activity of delafloxacin determined by reference broth microdilution (BMD) or gradient strips (GS), and of three other fluoroquinolones by BMD against clinical isolates of Corynebacterium spp.
Table 1. In vitro activity of delafloxacin determined by reference broth microdilution (BMD) or gradient strips (GS), and of three other fluoroquinolones by BMD against clinical isolates of Corynebacterium spp.
DELAFLOXACINCIPROFLOXACINLEVOFLOXACINMOXIFLOXACIN
SpeciesN MIC a
≤0.25
MIC
≤0.016
MIC
Range
MIC50MIC90MIC
Range
MIC50MIC90R b
(N, %)
MIC
Range
MIC50MIC90MIC RangeMIC50MIC90R b
(N, %)
C.
amycolatum
13BMD11
(84.6%)
5
(38.5%)
≤0.002–20.030.50.016–>324>329
(69.2%)
0.06–>324320.016–16188
(61.5%)
GS12
(92.3%)
4
(30.8%)
≤0.002–20.0230.25-----------
C.
glucuronolyticum
10BMD4
(40%)
3
(30%)
≤0.002–20.520.016–4447
(70%)
0.06–>3216320.004–8487
(70%)
GS4
(40%)
3
(30%)
≤0.002–10.381-----------
C. jeikeium10BMD7
(70%)
5
(50%)
0.004–160.00880.06–>320.125>325
(50%)
0.125–>320.25>320.03–160.06164
(40%)
GS6
(60%)
4
(40%)
0.006–>320.198-----------
C. striatum10BMD0(0%)0
(0%)
0.5–4144–>3232>3210
(100%)
4–>32>32>322–88810
(100%)
GS1
(10%)
0
(0%)
0.25–31.53-----------
C. urealyticum10BMD1
(10%)
1
(10%)
0.008–8480.06–>32>32>329
(90%)
0.25–>32>32>320.06–3232329
(90%)
GS1
(10%)
1
(10%)
0.006–>326>32-----------
Corynebacterium
spp.
53BMD23
(43.4%)
14
(26.4%)
≤0.002–160.580.016–>328>3240
(75.5%)
0.06–>3216>320.004–3243238
(71.7%)
GS24
(45.3%)
12
(21.4%)
≤0.002–>320.56-----------
a MIC values expressed in mg/L. b R: Resistant, according to EUCAST breakpoints (ciprofloxacin > 1 mg/L, moxifloxacin > 0.5 mg/L).
Table 2. Relationship between MICs (mg/L) of delafloxacin (DEL), moxifloxacin (MOX), ciprofloxacin (CIP), and levofloxacin (LEV), and mutations in the QRDR of gyrA of five Corynebacterium species.
Table 2. Relationship between MICs (mg/L) of delafloxacin (DEL), moxifloxacin (MOX), ciprofloxacin (CIP), and levofloxacin (LEV), and mutations in the QRDR of gyrA of five Corynebacterium species.
ID_IsolatesDELMOXCIPLEVAmino Acid Change(s) a
C. amycolatumNA bNANANASer-Ala-Asp (87–88–91)
CHURS-201026≤0.0020.0160.0160.06WT
CHURS-201094≤0.0020.0080.0160.06WT
CHURS-202160≤0.0020.0080.0160.06 WT
CHURS-201550≤0.0020.0080.0160.03 WT
CHURS-2007840.016124 Ser87Arg
CHURS-2009210.03144 Ser87Arg
CHURS-2012160.03144 Ser87Arg
CHURS-2022760.03144 Ser87Arg
CHURS-2014450.1250.584 Ser87Arg
CHURS-2022750.125188 Ser87Ile
CHURS-2010330.12523216Ser87Ile
Ala88Val *
CHURS-2016370.58>3232 Ser87Arg
Ala88Pro
CHURS-202078216>32>32 Ser87Ile
Asp91Gly
C. glucuronolyticumNANANANASer (87)
CHURS-201459≤0.0020.0040.0160.06 WT
CHURS-2001110.0080.060.1250.125 WT
CHURS-2014580.0080.060.1250.25 WT
CHURS-2021610.254416 Ser87Ile
CHURS-2014340.54432 Ser87Ile
CHURS-2001130.54416 Ser87Ile
CHURS-20032618432 Ser87Ile
CHURS-200692188>32 Ser87Ile
CHURS-20011228432 Ser87Ile
CHURS-20138828432 Ser87Ile
C. jeikeiumNANANANA Ser-Asp (87–91)
CHURS-1823370.0040.030.060.125 WT
CHURS-2225050.0040.030.060.125 WT
CHURS-2004210.0080.030.060.125 WT
CHURS-2016360.0080.030.060.25 WT
CHURS-1815880.0080.060.1250.25 WT
CHURS-2205380.125144 Ser87Arg
CHURS-2057440.252168 Ser87Arg
CHURS-18171712816 Ser87Ile
CHURS-183397816>32>32 Ser87Ile
Asp91Tyr
CHURS-1923121616>32>32 Ser87Ile
Asp91Tyr
C. striatumNANANANA Ser-Asp (87–91)
CHURS-2019820.5244 Ser87Val
CHURS-200172141632 Ser87Phe
Asp91Ala
CHURS-200532141632 Ser87Phe
Asp91Ala
CHURS-2006091432>32 Ser87Phe
Asp91Ala
CHURS-20523218>32>32 Ser87Phe
Asp91Ala
CHURS-2019002832>32 Ser87Phe
Asp91Ala
CHURS-2019172832>32 Ser87Phe
Asp91Ala
CHURS-20240028>32>32 Ser87Phe
Asp91Ala
CHURS-2020434832>32 Ser87Phe
Asp91Ala
CHURS-20225348>32>32 Ser87Phe
Asp91Ala
C. urealyticumNANANANA Ser-Asp (87–91)
CHURS-2005850.0080.060.060.25 WT
CHURS-201308143216 Ser87Val
CHURS-200529416>32>32 Ser87Val
Asp91Tyr
CHURS-201820432>3232 Ser87Val
Asp91Tyr
CHURS-200825432>32>32 Ser87Val
Asp91Tyr
CHURS-200751832>32>32 Ser87Val
Asp91Tyr
CHURS-201390832>32>32 Ser87Val
Asp91Tyr
CHURS-201559832>32>32 Ser87Val
Asp91Tyr
CHURS-201661832>32>32 Ser87Val
Asp91Tyr
CHURS-201808832>32>32Ser87Tyr
Asp91Phe *
a Amino acids in the positions of the wild-type (WT) sequence of the reference strains are also shown. b NA: not available. * Novel mutation.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Muñoz-Rosa, M.; Elías-López, C.; Pedraza, R.; Riazzo, C.; Arjona-Torres, C.; Machuca, I.; Tejero-García, R.; Torre-Cisneros, J.; Martínez-Martínez, L. In Vitro Activity of Delafloxacin Against Corynebacterium spp. Antibiotics 2025, 14, 973. https://doi.org/10.3390/antibiotics14100973

AMA Style

Muñoz-Rosa M, Elías-López C, Pedraza R, Riazzo C, Arjona-Torres C, Machuca I, Tejero-García R, Torre-Cisneros J, Martínez-Martínez L. In Vitro Activity of Delafloxacin Against Corynebacterium spp. Antibiotics. 2025; 14(10):973. https://doi.org/10.3390/antibiotics14100973

Chicago/Turabian Style

Muñoz-Rosa, Montserrat, Cristina Elías-López, Rosa Pedraza, Cristina Riazzo, Cristina Arjona-Torres, Isabel Machuca, Rocio Tejero-García, Julian Torre-Cisneros, and Luis Martínez-Martínez. 2025. "In Vitro Activity of Delafloxacin Against Corynebacterium spp." Antibiotics 14, no. 10: 973. https://doi.org/10.3390/antibiotics14100973

APA Style

Muñoz-Rosa, M., Elías-López, C., Pedraza, R., Riazzo, C., Arjona-Torres, C., Machuca, I., Tejero-García, R., Torre-Cisneros, J., & Martínez-Martínez, L. (2025). In Vitro Activity of Delafloxacin Against Corynebacterium spp. Antibiotics, 14(10), 973. https://doi.org/10.3390/antibiotics14100973

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop