Cross-Sectional Study for Detection and Risk Factor Analysis of ESBL-Producing Avian Pathogenic Escherichia coli Associated with Backyard Chickens in Pakistan
Abstract
1. Introduction
2. Results
2.1. Isolation, Identification and Phenotypic Confirmation of ESBL Producing E. coli
2.2. Antimicrobial Susceptibility and Multiple Antibiotic Resistance Index (MARI) Profiling of E. coli
2.3. Detection of ESBL Genes Using PCR and Sequence Analysis of blaCTX-M
2.4. Risk Factors for the Presence of ESBL-Producing E. coli in Backyard Chicken, Jhang, Pakistan
3. Discussion
4. Materials and Methods
4.1. Collection and Transport of Cloacal Swab Samples from the Study Area
4.2. Isolation and Identification of ESBL Producing E. coli
4.3. Antimicrobial Susceptibility and Multiple Antibiotic Resistance Index (MARI) Profiling of E. coli
4.4. Genomic DNA Extraction and Purification
4.5. Detection of Associated ESBL Genes Using Multiplex PCR
4.6. DNA Sequencing of blaCTX-M Gene Amplicon
4.7. Statistical Analysis of Associated Risk Factors
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rahman, S.; Kesselheim, A.S.; Hollis, A. Persistence of resistance: A panel data analysis of the effect of antibiotic usage on the prevalence of resistance. J. Antibiot. 2023, 76, 270–278. [Google Scholar] [CrossRef] [Scilit]
- Murray, C.J.L.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Aguilar, G.R.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarowska, J.; Futoma-Koloch, B.; Jama-Kmiecik, A.; Frej-Madrzak, M.; Ksiazczyk, M.; Bugla-Ploskonska, G.; Choroszy-Krol, I. Virulence factors, prevalence and potential transmission of extraintestinal pathogenic Escherichia coli isolated from different sources: Recent reports. Gut Pathog. 2019, 11, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, Y.B.; Yoon, M.Y.; Ha, J.S.; Seo, K.W.; Noh, E.B.; Son, S.H.; Lee, Y.J. Molecular characterization of avian pathogenic Escherichia coli from broiler chickens with colibacillosis. Poult. Sci. 2020, 99, 1088–1095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, N.; Costa, L.; Gonçalves, A.; Sousa, M.; Radhouani, H.; Brito, F.; Igrejas, G.; Poeta, P. Genetic characterisation of extended-spectrum β-lactamases in Escherichia coli isolated from retail chicken products including CTX-M-9 containing isolates: A food safety risk factor. Br. Poult. Sci. 2012, 53, 747–755. [Google Scholar] [CrossRef] [Scilit]
- Castanheira, M.; Simner, P.J.; Bradford, P.A. Extended-spectrum β-lactamases: An update on their characteristics, epidemiology and detection. JAC Antimicrob. Resist. 2021, 3, dlab092. [Google Scholar] [CrossRef] [Scilit]
- Tooke, C.L.; Hinchliffe, P.; Bragginton, E.C.; Colenso, C.K.; Hirvonen, V.H.A.; Takebayashi, Y.; Spencer, J. beta-Lactamases and beta-Lactamase Inhibitors in the 21st Century. J. Mol. Biol. 2019, 431, 3472–3500. [Google Scholar] [CrossRef] [Scilit]
- Founou, L.L.; Founou, R.C.; Essack, S.Y. Antibiotic resistance in the food chain: A developing country-perspective. Front. Microbiol. 2016, 7, 1881. [Google Scholar] [CrossRef] [Scilit]
- Olsen, R.H.; Bisgaard, M.; Lohren, U.; Robineau, B.; Christensen, H. Extended-spectrum beta-lactamase-producing Escherichia coli isolated from poultry: A review of current problems, illustrated with some laboratory findings. Avian Pathol. 2014, 43, 199–208. [Google Scholar] [CrossRef] [Scilit]
- Castanon, J.I.R. History of the use of antibiotic as growth promoters in European poultry feeds. Poult. Sci. 2007, 86, 2466–2471. [Google Scholar] [CrossRef] [Scilit]
- Umair, M.; Tahir, M.F.; Ullah, R.W.; Ali, J.; Siddique, N.; Rasheed, A.; Akram, M.; Zaheer, M.U.; Mohsin, M. Quantification and trends of antimicrobial use in commercial broiler chicken production in Pakistan. Antibiotics 2021, 10, 598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibrahim, R.A.; Cryer, T.L.; Lafi, S.Q.; Abu Basha, E.; Good, L.; Tarazi, Y.H. Identification of Escherichia coli from broiler chickens in Jordan, their antimicrobial resistance, gene characterization and the associated risk factors. BMC Vet. Res. 2019, 15, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CDC. Keeping Backyard Chickens and Other Poultry. Available online: https://www.cdc.gov/healthypets/pets/farm-animals/backyard-poultry.html (accessed on 3 May 2023).
- Pohjola, L.; Nykasenoja, S.; Kivisto, R.; Soveri, T.; Huovilainen, A.; Hanninen, M.L.; Fredriksson-Ahomaa, M. Zoonotic Public Health Hazards in Backyard Chickens. Zoonoses Public Health 2016, 63, 420–430. [Google Scholar] [CrossRef] [Scilit]
- Shah, D.H.; Board, M.M.; Crespo, R.; Guard, J.; Paul, N.C.; Faux, C. The occurrence of Salmonella, extended-spectrum beta-lactamase producing Escherichia coli and carbapenem resistant non-fermenting Gram-negative bacteria in a backyard poultry flock environment. Zoonoses Public Health 2020, 67, 742–753. [Google Scholar] [CrossRef] [Scilit]
- Sharma, B. Poultry production, management and bio-security measures. J. Agri. Environ. 2010, 11, 120–125. [Google Scholar] [CrossRef] [Scilit]
- GOP. Agriculture. In Pakistan Economic Survey 2021–22 Chapter 2; Economic Adviser’s Wing, Ed.; Minister for Finance and Revenue: Islamabad, Pakistan, 2022; pp. 17–40. [Google Scholar]
- Liaqat, Z.; Khan, I.; Azam, S.; Anwar, Y.; Althubaiti, E.H.; Maroof, L. Isolation and molecular characterization of extended spectrum beta lactamase producing Escherichia coli from chicken meat in Pakistan. PLoS ONE 2022, 17, e0269194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dawadi, P.; Bista, S.; Bista, S. Prevalence of colistin-resistant Escherichia coli from poultry in south asian developing countries. Vet. Med. Int. 2021, 2021, 6398838. [Google Scholar] [CrossRef] [Scilit]
- Dandachi, I.; Sokhn, E.S.; Dahdouh, E.A.; Azar, E.; El-Bazzal, B.; Rolain, J.M.; Daoud, Z. Prevalence and characterization of multi-drug-resistant gram-negative bacilli isolated from lebanese poultry: A nationwide study. Front. Microbiol. 2018, 9, 550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwoji, I.D.; Musa, J.A.; Daniel, N.; Mohzo, D.L.; Bitrus, A.A.; Ojo, A.A.; Ezema, K.U. Extended-spectrum beta-lactamase-producing Escherichia coli in chickens from small-scale (backyard) poultry farms in Maiduguri, Nigeria. Int. J. One Health 2019, 5, 26–30. [Google Scholar] [CrossRef] [Scilit]
- Nakayama, T.; Jinnai, M.; Kawahara, R.; Diep, K.T.; Thang, N.N.; Hoa, T.T.; Hanh, L.K.; Khai, P.N.; Sumimura, Y.; Yamamoto, Y. Frequent use of colistin-based drug treatment to eliminate extended-spectrum beta-lactamase-producing Escherichia coli in backyard chicken farms in Thai Binh Province, Vietnam. Trop. Anim. Health Prod. 2017, 49, 31–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aworh, M.K.; Kwaga, J.; Okolocha, E.; Harden, L.; Hull, D.; Hendriksen, R.S.; Thakur, S. Extended-spectrum β-lactamase-producing Escherichia coli among humans, chickens and poultry environments in Abuja, Nigeria. One Health Outlook. 2020, 2, 8. [Google Scholar] [CrossRef] [Scilit]
- Rahman, S. Incidence of ESBL-producing-Escherichia coli in poultry farm environment and retail poultry meat. Pak. Vet J. 2019, 39, 116–120. [Google Scholar] [CrossRef] [Scilit]
- Kamboh, A.A.; Shoaib, M.; Abro, S.H.; Khan, M.A.; Malhi, K.K.; Yu, S.Q. Antimicrobial resistance in Enterobacteriaceae isolated from liver of commercial broilers and backyard chickens. J. Appl. Poult. Res. 2018, 27, 627–634. [Google Scholar] [CrossRef] [Scilit]
- Umair, M.; Orubu, S.; Zaman, M.H.; Wirtz, V.J.; Mohsin, M. Veterinary consumption of highest priority critically important antimicrobials and various growth promoters based on import data in Pakistan. PLoS ONE 2022, 17, e0273821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmed, T.; Ameer, H.A.; Javed, S. Pakistan’s backyard poultry farming initiative: Impact analysis from a public health perspective. Trop. Anim. Health Prod. 2021, 53, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Diarra, M.S.; Malouin, F. Antibiotics in Canadian poultry productions and anticipated alternatives. Front. Microbiol. 2014, 5, 282. [Google Scholar] [CrossRef] [Scilit]
- Wales, A.D.; Davies, R.H. Co-selection of resistance to antibiotics, biocides and heavy metals, and Its relevance to foodborne pathogens. Antibiotics 2015, 4, 567–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pym, R. Poultry Housing and Management in Developing Countries, Management and Housing of Semi-Scavenging Flocks; FAO: Rome, Italy, 2010. [Google Scholar]
- Paterson, D.L.; Bonomo, R.A. Extended-spectrum beta-lactamases: A clinical update. Clin. Microbiol. Rev. 2005, 18, 657–686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bevan, E.R.; Jones, A.M.; Hawkey, P.M. Global epidemiology of CTX-M β-lactamases: Temporal and geographical shifts in genotype. J. Antimicrob. Chemother. 2017, 72, 2145–2155. [Google Scholar] [CrossRef] [Scilit]
- Ramos, S.; Silva, V.; Dapkevicius, M.L.E.; Canica, M.; Tejedor-Junco, M.T.; Igrejas, G.; Poeta, P. Escherichia coli as commensal and pathogenic bacteria among food-producing animals: Health implications of Extended Spectrum beta-lactamase (ESBL) production. Animals 2020, 10, 2239. [Google Scholar] [CrossRef] [Scilit]
- Wyres, K.L.; Hawkey, J.; Hetland, M.A.K.; Fostervold, A.; Wick, R.R.; Judd, L.M.; Hamidian, M.; Howden, B.P.; Löhr, I.H.; Holt, K.E. Emergence and rapid global dissemination of CTX-M-15-associated Klebsiella pneumoniae strain ST307. J. Antimicrob. Chemother. 2019, 74, 577–581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valentin, L.; Sharp, H.; Hille, K.; Seibt, U.; Fischer, J.; Pfeifer, Y.; Michael, G.B.; Nickel, S.; Schmiedel, J.; Falgenhauer, L.; et al. Subgrouping of ESBL-producing Escherichia coli from animal and human sources: An approach to quantify the distribution of ESBL types between different reservoirs. Int. J. Med. Microbiol. 2014, 304, 805–816. [Google Scholar] [CrossRef] [Scilit]
- Chowdhury, M.; Bardhan, R.; Pal, S.; Banerjee, A.; Batabyal, K.; Joardar, S.N.; Mandal, G.P.; Bandyopadhyay, S.; Dutta, T.K.; Sar, T.K. Comparative occurrence of ESBL/AmpC beta-lactamase-producing Escherichia coli and Salmonella in contract farm and backyard broilers. Lett. Appl. Microbiol. 2022, 74, 53–62. [Google Scholar] [CrossRef] [Scilit]
- Mohsin, M.; Van Boeckel, T.P.; Saleemi, M.K.; Umair, M.; Naseem, M.N.; He, C.; Khan, A.; Laxminarayan, R. Excessive use of medically important antimicrobials in food animals in Pakistan: A five-year surveillance survey. Glob. Health Action 2019, 12, 1697541. [Google Scholar] [CrossRef] [Scilit]
- Masoud, S.M.; Abd El-Baky, R.M.; Aly, S.A.; Ibrahem, R.A. Co-existence of certain ESBLs, MBLs and plasmid mediated quinolone resistance genes among MDR E. coli isolated from different clinical specimens in Egypt. Antibiotics 2021, 10, 835. [Google Scholar] [CrossRef] [Scilit]
- Korzeniewska, E.; Korzeniewska, A.; Harnisz, M. Antibiotic resistant Escherichia coli in hospital and municipal sewage and their emission to the environment. Ecotox. Environ. Saf. 2013, 91, 96–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahota, A.W.; Bhatti, B.M. Productive performance of Desi field chickens as affected under deep litter system. Pak. J. Vet Res. 2003, 1, 35–38. [Google Scholar]
- Nguyen, V.T.; Carrique-Mas, J.J.; Ngo, T.H.; Ho, H.M.; Ha, T.T.; Campbell, J.I.; Nguyen, T.N.; Hoang, N.N.; Pham, V.M.; Wagenaar, J.A.; et al. Prevalence and risk factors for carriage of antimicrobial-resistant Escherichia coli on household and small-scale chicken farms in the Mekong Delta of Vietnam. J. Antimicrob. Chemother. 2015, 70, 2144–2152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reuland, E.A.; Al Naiemi, N.; Kaiser, A.M.; Heck, M.; Kluytmans, J.A.; Savelkoul, P.H.; Elders, P.J.; Vandenbroucke-Grauls, C.M. Prevalence and risk factors for carriage of ESBL-producing Enterobacteriaceae in Amsterdam. J. Antimicrob. Chemother. 2016, 71, 1076–1082. [Google Scholar] [CrossRef] [Scilit]
- Daniel, W.W. Biostatistics: A Foundation for Analysis in the Health Sciences, 7th ed.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 1999. [Google Scholar]
- Shoaib, M.; Kamboh, A.A.; Sajid, A.; Mughal, G.A.; Leghari, R.A.; Malhi, K.K.; Bughio, S.; Ali, A.; Alam, S.; Khan, S.; et al. Prevalence of extended spectrum beta-lactamase producing enterobacteriaceae in commercial broilers and backyard chickens. Adv. Anim. Vet. Sci. 2016, 4, 209–214. [Google Scholar] [CrossRef] [Scilit]
- Umair, M.; Mohsin, M.; Ali, Q.; Qamar, M.U.; Raza, S.; Ali, A.; Guenther, S.; Schierack, P. Prevalence and genetic relatedness of extended spectrum-β-lactamase-producing Escherichia coli among humans, cattle, and poultry in Pakistan. Microb. Drug Resist. 2019, 25, 1374–1381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eshrati, B.; Baradaran, H.R.; Motevalian, S.A.; Majidpour, A.; Boustanshenas, M.; Soleymanzadeh Moghadam, S.; Moradi, Y. Investigating the relationship between extended spectrum β-lactamase producing Escherichia coli in the environment and food chains with the presence of this infection in people suspected of septicemia: Using the fuzzy set qualitative comparative analysis. J. Environ. Health Sci. Eng. 2020, 18, 1509–1520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing. In CLSI Supplement M100s, 30th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
- Davis, R.; Brown, P.D. Multiple antibiotic resistance index, fitness and virulence potential in respiratory Pseudomonas aeruginosa from Jamaica. J. Med. Microbiol. 2016, 65, 261–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- MNHS. Antimicrobial Resistance National Action Plan Pakistan; Ministry of National Health Services Regulations & Coordination Government of Pakistan: Islamabad, Pakistan, 2017; pp. 1–64. [Google Scholar]
- Monstein, H.J.; Ostholm-Balkhed, A.; Nilsson, M.V.; Nilsson, M.; Dornbusch, K.; Nilsson, L.E. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. Apmis 2007, 115, 1400–1408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wollenberg, K.R.; Atchley, W.R. Separation of phylogenetic and functional associations in biological sequences by using the parametric bootstrap. Proc. Natl. Acad. Sci. USA 2000, 97, 3288–3291. [Google Scholar] [CrossRef]


| Drug Class | Antibiotic Agent | No. of Isolates | ||
|---|---|---|---|---|
| Resistant n (%) | Intermediate n (%) | Susceptible n (%) | ||
| Penicillin | Amoxicillin/Clavulanate | 58 (35.4%) | 7 (4.3%) | 99 (60.4%) |
| Cephalosporin | Cefotaxime (3rd Generation) | 126 (76.8%) | 4 (2.4%) | 34 (20.7%) |
| Phenicol | Chloramphenicol | 99 (60.4%) | 9 (5.5%) | 56 (34.1%) |
| Polymyxin | Colistin | 115 (70.1%) | 11 (6.7%) | 38 (23.2%) |
| Quinolone/Fluoroquinolone | Enrofloxacin | 117 (71.3%) | 13 (7.9%) | 34 (20.7%) |
| Ciprofloxacin | 19 (11.6%) | 8 (4.9%) | 137 (84%) | |
| Norfloxacin | 71 (43.3%) | 6 (3.7%) | 87 (53.1%) | |
| Aminoglycosides | Gentamicin | 94 (57.3%) | 8 (4.9%) | 62 (37.8%) |
| Neomycin | 20 (12.2%) | 7 (4.3%) | 137 (83.5%) | |
| Carbapenem | Imipenem | 16 (9.8%) | 10 (6.1%) | 138 (84.1%) |
| Tetracycline | Doxycycline | 129 (78.6%) | 17 (10.4%) | 18 (10.9%) |
| Sulfonamide | Trimethoprim/sulfamethoxazole | 113 (68.9%) | 21 (12.8%) | 30 (18.3%) |
| Macrolide | Tylosin | 156 (95.1%) | 3 (1.8%) | 5 (3.0%) |
| ESBL E. coli (n = 74) | MAR Index * | Non-ESBL E. coli (n = 90) | MAR Index |
|---|---|---|---|
| 3 (4.05%) | 0.84 | 9 (10%) | 0.46 |
| 1 (1.35%) | 0.61 | 11 (12.2%) | 0.38 |
| 6 (8.11%) | 0.46 | 21 (23.3%) | 0.23 |
| 16 (21.62%) | 0.38 | 18 (20%) | 0.15 |
| 26 (35.13%) | 0.23 | 31 (34.4%) | 0 |
| 9 (12.16%) | 0.07 | - | - |
| 13 (17.57%) | 0 | - | - |
| Geometric mean | 0.25 | Geometric mean | 0.17 |
| Predictor Variables as Risk Factors | Total E. coli | Categorical Response Variable | Chi-Square (X2) Statistics | p-Value | ||
|---|---|---|---|---|---|---|
| ESBL E. coli (Code: 1) | Non-ESBL E. coli (Code: 0) | |||||
| (n = 164) | (n = 74) | (n = 90) | ||||
| Location | Ahmad Pur Sial | 46 (28%) | 16 (22.2%) | 30 (33.3%) | 2.77 | 0.428 |
| Shorkot | 36 (21.9%) | 18 (24.3%) | 18 (20%) | |||
| Athara Hazari | 37 (22.5%) | 18 (24.3%) | 19 (21.1%) | |||
| Jhang | 45 (27.4%) | 22 (29.7%) | 23 (25.5%) | |||
| Chicken Breed | Aseel chicken | 50 (30.5%) | 26 (35.1%) | 24 (26.6%) | 1.597 | 0.66 |
| Golden chicken | 43 (26.2%) | 17 (23%) | 26 (28.9%) | |||
| Misri chicken | 33 (20.1%) | 14 (18.9%) | 19 (21.1%) | |||
| Naked neck chicken | 38 (23.2%) | 17 (23%) | 21 (23.3%) | |||
| Sex | Male | 84 (51.2%) | 35 (47.3%) | 49 (54.4%) | 0.830 | 0.362 |
| Female | 80 (48.8%) | 39 (52.7%) | 41 (45.5%) | |||
| Age | <6 months | 40 (24.4%) | 14 (18.9%) | 26 (28.9%) | 5.21 | 0.074 |
| ≥6 months–12 months | 49 (29.9%) | 19 (25.7%) | 30 (33.3%) | |||
| > 12 months | 75 (45.7%) | 41 (55.4%) | 34 (37.8%) | |||
| Size of farm/unit birds | Small (<50 birds) | 61 (37.2%) | 30 (40.5%) | 31 (34.4%) | 0.646 | 0.422 |
| Large (≥50 birds) | 103 (62.8%) | 44 (59.5%) | 59 (65.5%) | |||
| Housing system | Strict Cage system | 78 (47.5%) | 26 (35.1%) | 52 (57.8%) | 8.348 | 0.004 |
| Free-range husbandry management system | 86 (52.4%) | 48 (64.9%) | 38 (42.2%) | |||
| Feeding resource | Commercial feed | 52 (31.7%) | 22 (29.7%) | 30 (33.3%) | 0.244 | 0.622 |
| Exogenous (Free picking) | 112 (68.3%) | 52 (70.3%) | 60 (66.7%) | |||
| Disinfection of drinking water | Yes | 132 (80.5%) | 55 (74.3%) | 77 (85.5%) | 3.262 | 0.07 |
| No | 32 (19.5%) | 19 (25.7%) | 13 (14.4%) | |||
| Vaccination in last 6 months | Yes | 88 (53.6%) | 40 (54.1%) | 48 (53.3%) | 0.008 | 0.927 |
| No | 76 (46.3%) | 34 (46%) | 42 (46.7%) | |||
| Contact with animals/birds | No | 85 (51.8%) | 32 (32.2%) | 53 (58.9%) | 3.98 | 0.04 |
| Yes | 79 (48.2%) | 42 (56.8%) | 37 (41.1%) | |||
| Antimicrobial Resistance Level | Non-MDR | 72 (43.9%) | 25 (33.8%) | 47 (52.2%) | 5.60 | 0.02 |
| MDR | 92 (56.1%) | 49 (66.2%) | 43 (47.8%) | |||
| Antibacterial usage in last 6 months | Low (≤5 mg/kg/week) | 49 (29.9%) | 15 (20.3%) | 34 (37.8%) | 10.53 | 0.005 |
| Moderate (>5–10 mg/kg/week) | 54 (32.9%) | 22 (30%) | 32 (35.5%) | |||
| High (>10 mg/kg/week) | 61 (37.2%) | 37 (50%) | 24 (26.7%) | |||
| Pre-Selected Risk Factors (Codes 1) | Categorical Response Variable | β Coefficient | SE 2 | Prevalence Odd Ratio (OR) | (95% Confidence Level Range) | p-Value | ||
|---|---|---|---|---|---|---|---|---|
| ESBL E. coli | Non-ESBL E. coli | |||||||
| Age | <6 m. (0) | 14 | 26 | Baseline | 0.418 | |||
| ≥6 m.–12 m. (1) | 19 | 30 | −1.460 | 1.111 | 0.232 | 0.026–2.050 | 0.189 | |
| >12 m. (2) | 41 | 34 | −1.278 | 1.708 | 0.279 | 0.010–7.926 | 0.454 | |
| Housing system | Strict Cage system (0) | 26 | 52 | Baseline | ||||
| Free-range husbandry management system (1) | 48 | 38 | 3.401 | 1.538 | 30.00 | 1.471–611.79 | 0.027 | |
| Disinfection of drinking water | Yes (0) | 55 | 77 | Baseline | ||||
| No (1) | 19 | 13 | −0.113 | 0.525 | 0.893 | 0.319–2.50 | 0.830 | |
| Exposure to other animals/birds | No (0) | 32 | 53 | Baseline | ||||
| Yes (1) | 42 | 37 | −2.890 | 1.581 | 0.056 | 0.003–1.232 | 0.068 | |
| Antimicrobial Resistance Level | Non-MDR (0) | 25 | 47 | Baseline | ||||
| MDR (1) | 49 | 43 | −1.347 | 1.173 | 0.260 | 0.026–2.593 | 0.251 | |
| Antibacterial usage in last 6 months | Low (0) (≤5 mg/kg/week) | 15 | 34 | Baseline | 0.038 | |||
| Moderate (1) (>5–10 mg/kg/week) | 22 | 32 | 1.817 | 1.141 | 6.154 | 0.658–57.59 | 0.111 | |
| High (2) (>10 mg/kg/week) | 37 | 24 | 3.226 | 1.341 | 25.175 | 1.817–348.71 | 0.016 | |
| Constant | −0.619 | 0.331 | 0.538 | 0.062 | ||||
| Tehsil | No. of Cloacal Swabs | ||||
|---|---|---|---|---|---|
| Aseel Chicken | Golden Chicken | Misri Chicken | Naked Neck Chicken | Total | |
| Jhang | 20 | 20 | 20 | 20 | 80 |
| Shorkot | 20 | 20 | 20 | 20 | 80 |
| Athara Hazari | 20 | 20 | 20 | 20 | 80 |
| Ahmad Pur Sial | 20 | 20 | 20 | 20 | 80 |
| Total | 80 | 80 | 80 | 80 | 320 |
| Target Gene | Primer Name | Primer Sequences (5′ to 3′) | Product Size |
|---|---|---|---|
| blaTEM | TEM-SE | TCGCCGCATACACTATTCTCAGAATGA | 445 bp |
| TEM-AS | ACGCTCACCGGCTCCAGATTTAT | ||
| blaCTX-M | CTX-M-U1 | ATGTGCAGYACCAGTAARGTKATGGC | 593 bp |
| CTX-M-U2 | TGGGTRAARTARGTSACCAGAAYCAGCGG | ||
| blaSHV | SHV-SE | ATGCGTTATATTCGCCTGTG | 747 bp |
| SHV-AS | TGCTTTGTTATTCGGGCCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saeed, M.A.; Saqlain, M.; Waheed, U.; Ehtisham-ul-Haque, S.; Khan, A.U.; Rehman, A.u.; Sajid, M.; Atif, F.A.; Neubauer, H.; El-Adawy, H. Cross-Sectional Study for Detection and Risk Factor Analysis of ESBL-Producing Avian Pathogenic Escherichia coli Associated with Backyard Chickens in Pakistan. Antibiotics 2023, 12, 934. https://doi.org/10.3390/antibiotics12050934
Saeed MA, Saqlain M, Waheed U, Ehtisham-ul-Haque S, Khan AU, Rehman Au, Sajid M, Atif FA, Neubauer H, El-Adawy H. Cross-Sectional Study for Detection and Risk Factor Analysis of ESBL-Producing Avian Pathogenic Escherichia coli Associated with Backyard Chickens in Pakistan. Antibiotics. 2023; 12(5):934. https://doi.org/10.3390/antibiotics12050934
Chicago/Turabian StyleSaeed, Muhammad Adnan, Muhammad Saqlain, Usman Waheed, Syed Ehtisham-ul-Haque, Aman Ullah Khan, Aziz ur Rehman, Muhammad Sajid, Farhan Ahmad Atif, Heinrich Neubauer, and Hosny El-Adawy. 2023. "Cross-Sectional Study for Detection and Risk Factor Analysis of ESBL-Producing Avian Pathogenic Escherichia coli Associated with Backyard Chickens in Pakistan" Antibiotics 12, no. 5: 934. https://doi.org/10.3390/antibiotics12050934
APA StyleSaeed, M. A., Saqlain, M., Waheed, U., Ehtisham-ul-Haque, S., Khan, A. U., Rehman, A. u., Sajid, M., Atif, F. A., Neubauer, H., & El-Adawy, H. (2023). Cross-Sectional Study for Detection and Risk Factor Analysis of ESBL-Producing Avian Pathogenic Escherichia coli Associated with Backyard Chickens in Pakistan. Antibiotics, 12(5), 934. https://doi.org/10.3390/antibiotics12050934

