Antimicrobial Resistance and β-Lactamase Production in Clinically Significant Gram-Negative Bacteria Isolated from Hospital and Municipal Wastewater
Abstract
:1. Introduction
2. Results
2.1. Bacterial Isolation
2.2. Identification of Isolates
2.3. Determination of the Antimicrobial Susceptibility Pattern of the Isolates
2.4. Screening for β-Lactamases
2.5. Detection of Resistance Genes by PCR
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Bacterial Isolates
4.3. Antimicrobial Sensitivity
4.4. Phenotypic Detection of β-Lactamases
4.5. Analysis of Gene Molecules of ESBL and Carbapenemase
4.5.1. DNA Extraction
4.5.2. Detection of Genes Encoding ESBL and Carbapenemase
5. Conclusions and Future Perspectives
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jelic, A.; Rodriguez-Mozaz, S.; Barceló, D.; Gutierrez, O. Impact of In-Sewer Transformation on 43 Pharmaceuticals in a Pressurized Sewer under Anaerobic Conditions. Water Res. 2015, 68, 98–108. [Google Scholar] [CrossRef]
- Karkman, A.; Pärnänen, K.; Larsson, D.G.J. Fecal Pollution Can Explain Antibiotic Resistance Gene Abundances in Anthropogenically Impacted Environments. Nat. Commun. 2019, 10, 80. [Google Scholar] [CrossRef] [Green Version]
- Aldrazi, F.A.; Rabaan, A.A.; Alsuliman, S.A.; Aldrazi, H.A.; Alabdalslam, M.J.; Alsadiq, S.A.; Alhani, H.M.; Bueid, A.S. ESBL Expression and Antibiotic Resistance Patterns in a Hospital in Saudi Arabia: Do Healthcare Staff Have the Whole Picture? J. Infect. Public Health 2020, 13, 759–766. [Google Scholar] [CrossRef]
- Liu, H.; Zhou, H.; Li, Q.; Peng, Q.; Zhao, Q.; Wang, J.; Liu, X. Molecular Characteristics of Extended-Spectrum β-Lactamase-Producing Escherichia Coli Isolated from the Rivers and Lakes in Northwest China. BMC Microbiol. 2018, 18, 125. [Google Scholar] [CrossRef] [Green Version]
- Čornejová, T.; Venglovsky, J.; Gregova, G.; Kmetova, M.; Kmet, V. Extended Spectrum Beta-Lactamases in Escherichia Coli from Municipal Wastewater. Ann. Agric. Environ. Med. 2015, 22, 447–450. [Google Scholar] [CrossRef] [Green Version]
- Lépesová, K.; Olejníková, P.; Mackuľak, T.; Cverenkárová, K.; Krahulcová, M.; Bírošová, L. Hospital Wastewater—Important Source of Multidrug Resistant Coliform Bacteria with ESBL-Production. Int. J. Environ. Res. Public Health 2020, 17, 7827. [Google Scholar] [CrossRef]
- Mustafa, S.S.; Batool, R.; Kamran, M.; Javed, H.; Jamil, N. Evaluating the Role of Wastewaters as Reservoirs of Antibiotic-Resistant ESKAPEE Bacteria Using Phenotypic and Molecular Methods. Infect. Drug Resist. 2022, 15, 5715–5728. [Google Scholar] [CrossRef]
- Rizzo, L.; Manaia, C.; Merlin, C.; Schwartz, T.; Dagot, C.; Ploy, M.C.; Michael, I.; Fatta-Kassinos, D. Urban Wastewater Treatment Plants as Hotspots for Antibiotic Resistant Bacteria and Genes Spread into the Environment: A Review. Sci. Total Envron. 2013, 447, 345–360. [Google Scholar] [CrossRef] [Green Version]
- Chau, K.K.; Barker, L.; Budgell, E.P.; Vihta, K.D.; Sims, N.; Kasprzyk-Hordern, B.; Harriss, E.; Crook, D.W.; Read, D.S.; Walker, A.S.; et al. Systematic Review of Wastewater Surveillance of Antimicrobial Resistance in Human Populations. Environ. Int. 2022, 162, 107171. [Google Scholar] [CrossRef]
- Sirot, D. Extended-Spectrum Plasmid-Mediated Beta-Lactamases. J. Antimicrob. Chemother. 1995, 36 (Suppl. SA), 19–34. [Google Scholar] [CrossRef]
- Bush, K.; Bradford, P.A. β-Lactams and β-Lactamase Inhibitors: An Overview. Cold Spring Harb. Perspect. Med. 2016, 6, a025247. [Google Scholar] [CrossRef]
- Bush, K. The ABCD’s of β-Lactamase Nomenclature. J. Infect. Chemother. 2013, 19, 549–559. [Google Scholar] [CrossRef]
- Hussein, K.; Raz-Pasteur, A.; Finkelstein, R.; Neuberger, A.; Shachor-Meyouhas, Y.; Oren, I.; Kassis, I. Impact of Carbapenem Resistance on the Outcome of Patients’ Hospital-Acquired Bacteraemia Caused by Klebsiella Pneumoniae. J. Hosp. Infect. 2013, 83, 307–313. [Google Scholar] [CrossRef]
- Alhumaidy, A.; Alahmadi, R.; Eisa, S.; Alotaibi, M.; Filfilan, S.; Alzayer, M.; Okdah, L.; Doumith, M.; Taha, O.; Albishri, B.; et al. Molecular Characterization of Carbapenemase Producing Acinetobacter Baumannii and Pseudomonas Aeruginosa from Tertiary Care Hospitals in Mecca—Saudi Arabia. J. Infect. Public Health 2020, 13, 335. [Google Scholar] [CrossRef]
- Alahmadi, R.; Alhumaidy, A.; Eisa, S.; Alotaibi, M.; Filfilan, S.; Taha, O.; Albishri, B.; Mulana, A.; Alshelgani, A.; Alzeyadi, Z. Molecular Detection of Common Carbapenemase Resistance Genes in Nosocomial Pathogens Isolated from Neonatal ICU at a Major Tertiary Care Hospital in Mecca. J. Infect. Public Health 2020, 13, 332. [Google Scholar] [CrossRef]
- Yezli, S.; Shibl, A.M.; Memish, Z.A. The Molecular Basis of β-Lactamase Production in Gram-Negative Bacteria from Saudi Arabia. J Med Microbiol 2015, 64, 127–136. [Google Scholar] [CrossRef] [Green Version]
- Al-Agamy, M.H.; Shibl, A.M.; Elkhizzi, N.A.; Meunier, D.; Turton, J.F.; Livermore, D.M. Persistence of Klebsiella Pnemoniae Clones with OXA-48 or NDM Carbapenemases Causing Bacteraemias in a Riyadh Hospital. Diagn Microbiol. Infect Dis. 2013, 76, 214–216. [Google Scholar] [CrossRef]
- Garbati, M.A.; Sakkijha, H.; Abushaheen, A. Infections Due to Carbapenem Resistant Enterobacteriaceae among Saudi Arbian Hospitalized Patients: A Matched Case-Control Study. BioMed. Res. Int. 2016, 2016, e3961684. [Google Scholar] [CrossRef] [Green Version]
- Al-Zahrani, I.A.; Alasiri, B.A. The Emergence of Carbapenem-Resistant Klebsiella Pneumoniae Isolates Producing OXA-48 and NDM in the Southern (Asir) Province, Saudi Arabia. Saudi Med. J. 2018, 39, 23–30. [Google Scholar] [CrossRef]
- Irfan, M.; Almotiri, A.; AlZeyadi, Z.A. Antimicrobial Resistance and Its Drivers—A Review. Antibiotics 2022, 11, 1362. [Google Scholar] [CrossRef]
- Galler, H.; Feierl, G.; Petternel, C.; Reinthaler, F.F.; Haas, D.; Habib, J.; Kittinger, C.; Luxner, J.; Zarfel, G. Multiresistant Bact ria Isolated from Activated Sludge in Austria. Int. J. Environ. Res. Public Health 2018, 15, 479. [Google Scholar] [CrossRef] [Green Version]
- Manaia, C.M. Assessing the Risk of Antibiotic Resistance Transmission from the Environment to Humans: Non-Direct Proportionality between Abundance and Risk. Trends Microbiol. 2017, 25, 173–181. [Google Scholar] [CrossRef] [Green Version]
- Oliveira, P.H.; Touchon, M.; Cury, J.; Rocha, E.P.C. The Chromosomal Organization of Horizontal Gene Transfer in Bacteria. Nat. Commun. 2017, 8, 841. [Google Scholar] [CrossRef] [Green Version]
- Martínez, J.L. Ecology and Evolution of Chromosomal Gene Transfer between Environmental Microorganisms and Pathogens. Microbiol. Spectr. 2018, 6, 6.1.06. [Google Scholar] [CrossRef]
- Elgayar, K.E.; Essa, A.M. Characterization of Bacteria Isolated from Domestic Wastewater In Jazan, Saudi Arabia. Egypt. J. Exp. Biol. 2018, 14, 331. [Google Scholar] [CrossRef]
- Röderová, M.; Sedláková, M.H.; Pudová, V.; Hricová, K.; Silová, R.; Imwensi, P.E.O.; Bardoň, J.; Kolář, M. Occurrence of Bacteria Producing Broad-Spectrum Beta-Lactamases and Qnr Genes in Hospital and Urban Wastewater Samples. New Microbiol. 2016, 39, 124–133. [Google Scholar]
- Homeier-Bachmann, T.; Heiden, S.E.; Lübcke, P.K.; Bachmann, L.; Bohnert, J.A.; Zimmermann, D.; Schaufler, K. Antibiotic-Resistant Enterobacteriaceae in Wastewater of Abattoirs. Antibiotics 2021, 10, 568. [Google Scholar] [CrossRef]
- Marathe, N.P.; Berglund, F.; Razavi, M.; Pal, C.; Dröge, J.; Samant, S.; Kristiansson, E.; Larsson, D.G.J. Sewage Effluent from an Indian Hospital Harbors Novel Carbapenemases and Integron-Borne Antibiotic Resistance Genes. Microbiome 2019, 7, 97. [Google Scholar] [CrossRef] [Green Version]
- Qin, J.; Maixnerová, M.; Nemec, M.; Feng, Y.; Zhang, X.; Nemec, A.; Zong, Z. Acinetobacter Cumulans Sp. Nov., Isolated from Hospital Sewage and Capable of Acquisition of Multiple Antibiotic Resistance Genes. Syst. Appl. Microbiol. 2019, 42, 319–325. [Google Scholar] [CrossRef]
- Wang, Q.; Wang, P.; Yang, Q. Occurrence and Diversity of Antibiotic Resistance in Untreated Hospital Wastewater. Sci. Total Environ. 2018, 621, 990–999. [Google Scholar] [CrossRef]
- Higgins, P.G.; Hrenovic, J.; Seifert, H.; Dekic, S. Characterization of Acinetobacter Baumannii from Water and Sludge Line of Secondary Wastewater Treatment Plant. Water Res. 2018, 140, 261–267. [Google Scholar] [CrossRef]
- Bréchet, C.; Plantin, J.; Sauget, M.; Thouverez, M.; Talon, D.; Cholley, P.; Guyeux, C.; Hocquet, D.; Bertrand, X. Wastewater Treatment Plants Release Large Amounts of Extended-Spectrum β-Lactamase–Producing Escherichia Coli Into the Environment. Clin. Infect. Dis. 2014, 58, 1658–1665. [Google Scholar] [CrossRef] [Green Version]
- Pfaller, M.A.; Jones, R.N.; Doern, G.V. Multicenter Evaluation of the Antimicrobial Activity for Six Broad-Spectrum Beta-Lactams in Venezuela: Comparison of Data from 1997 and 1998 Using the Etest Method. Venezuelan Antimicrobial Resistance Study Group. Diagn Microbiol. Infect Dis. 1999, 35, 153–158. [Google Scholar] [CrossRef]
- Faidah, H.S.; Momenah, A.M.; El-Said, H.M.; Barhameen, A.A.A.; Ashgar, S.S.; Johargy, A.; Elsawy, A.; Almalki, W.; Qurashi, S.A. Trends in the Annual Incidence of Carbapenem Resistant among Gram Negative Bacilli in a Large Teaching Hospital in Makah City, Saudi Arabia. J. Tuberc. Res. 2017, 5, 229–236. [Google Scholar] [CrossRef] [Green Version]
- Khan, M.; Faiz, A. Frequency of Carbapenemase Producing Klebsiella Pneumoniae in Makkah, Saudi Arabia. J. Microbiol. Infect. Dis. 2016, 6, 121–127. [Google Scholar] [CrossRef] [Green Version]
- Korzeniewska, E.; Harnisz, M. Beta-Lactamase-Producing Enterobacteriaceae in Hospital Effluents. J. Env. Manag. 2013, 123, 1–7. [Google Scholar] [CrossRef]
- Amador, P.P.; Fernandes, R.M.; Prudêncio, M.C.; Barreto, M.P.; Duarte, I.M. Antibiotic Resistance in Wastewater: Occurrence and Fate of Enterobacteriaceae Producers of Class A and Class C β-Lactamases. J. Env. Sci. Health A Tox Hazard Subst Env. Eng. 2015, 50, 26–39. [Google Scholar] [CrossRef]
- Zieliński, W.; Buta, M.; Hubeny, J.; Korzeniewska, E.; Harnisz, M.; Nowrotek, M.; Płaza, G. Prevalence of Beta Lactamases Genes in Sewage and Sludge Treated in Mechanical-Biological Wastewater Treatment Plants. J. Ecol. Eng. 2019, 20, 80–86. [Google Scholar] [CrossRef]
- Smyth, C.; O’Flaherty, A.; Walsh, F.; Do, T.T. Antibiotic Resistant and Extended-Spectrum β-Lactamase Producing Faecal Coliforms in Wastewater Treatment Plant Effluent. Env. Pollut 2020, 262, 114244. [Google Scholar] [CrossRef]
- Zieliński, W.; Korzeniewska, E.; Harnisz, M.; Drzymała, J.; Felis, E.; Bajkacz, S. Wastewater Treatment Plants as a Reservoir of Integrase and Antibiotic Resistance Genes—An Epidemiological Threat to Workers and Environment. Env. Int. 2021, 156, 106641. [Google Scholar] [CrossRef]
- Osińska, A.; Korzeniewska, E.; Harnisz, M.; Felis, E.; Bajkacz, S.; Jachimowicz, P.; Niestępski, S.; Konopka, I. Small-Scale Wastewater Treatment Plants as a Source of the Dissemination of Antibiotic Resistance Genes in the Aquatic Environment. J. Hazard. Mater. 2020, 381, 121221. [Google Scholar] [CrossRef]
- Surleac, M.; Czobor Barbu, I.; Paraschiv, S.; Popa, L.I.; Gheorghe, I.; Marutescu, L.; Popa, M.; Sarbu, I.; Talapan, D.; Nita, M.; et al. Whole Genome Sequencing Snapshot of Multi-Drug Resistant Klebsiella Pneumoniae Strains from Hospitals and Receiving Wastewater Treatment Plants in Southern Romania. PLoS ONE 2020, 15, e0228079. [Google Scholar] [CrossRef] [Green Version]
- Khan, M.A.; Mohamed, A.M.; Faiz, A.; Ahmad, J. Enterobacterial Infection in Saudi Arabia: First Record of Klebsiella Pneumoniae with Triple Carbapenemase Genes Resistance. J. Infect Dev. Ctries. 2019, 13, 334–341. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teban-Man, A.; Farkas, A.; Baricz, A.; Hegedus, A.; Szekeres, E.; Pârvu, M.; Coman, C. Wastewaters, with or without Hospital Contribution, Harbour MDR, Carbapenemase-Producing, but Not Hypervirulent Klebsiella pneumoniae. Antibiotics 2021, 10, 361. [Google Scholar] [CrossRef]
- Gibbon, M.J.; Couto, N.; David, S.; Barden, R.; Standerwick, R.; Jagadeesan, K.; Birkwood, H.; Dulyayangkul, P.; Avison, M.B.; Kannan, A.; et al. A High Prevalence of BlaOXA-48 in Klebsiella (Raoultella) Ornithinolytica and Related Species in Hospital Wastewater in South West England. Microb. Genom. 2021, 7, mgen000509. [Google Scholar] [CrossRef] [PubMed]
- Parvez, S.; Khan, A.U. Hospital Sewage Water: A Reservoir for Variants of New Delhi Metallo-β-Lactamase (NDM)- and Extended-Spectrum β-Lactamase (ESBL)-Producing Enterobacteriaceae. Int. J. Antimicrob. Agents 2018, 51, 82–88. [Google Scholar] [CrossRef] [PubMed]
- Haller, L.; Chen, H.; Ng, C.; Le, T.H.; Koh, T.H.; Barkham, T.; Sobsey, M.; Gin, K.Y.-H. Occurrence and Characteristics of Extended-Spectrum β-Lactamase- and Carbapenemase- Producing Bacteria from Hospital Effluents in Singapore. Sci. Total Env. 2018, 615, 1119–1125. [Google Scholar] [CrossRef]
- Mahon, C.; Lehman, D. Textbook of Diagnostic Microbiology—7th Edition, 7th ed; Elsevier: Amsterdam, The Netherlands, 2022; ISBN 978-0-323-82997-7. [Google Scholar]
- M100Ed30; Performance Standards for Antimicrobial Susceptibility Testing, 30rd Edition. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020; ISBN 978-1-68440-067-6.
- Mashwal, F.A.; Safi, S.H.E.; George, S.K.; Adam, A.A.; Jebakumar, A.Z. Incidence and Molecular Characterization of the Extended Spectrum Beta Lactamase-Producing Escherichia Coli Isolated from Urinary Tract Infections in Eastern Saudi Arabia. Saudi Med. J. 2017, 38, 811–815. [Google Scholar] [CrossRef]
- Gharrah, M.M.; Mostafa El-Mahdy, A.; Barwa, R.F. Association between Virulence Factors and Extended Spectrum Beta-Lactamase Producing Klebsiella Pneumoniae Compared to Nonproducing Isolates. Interdiscip Perspect Infect Dis. 2017, 2017, 7279830. [Google Scholar] [CrossRef] [Green Version]
- Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a Set of Multiplex PCR Assays for the Detection of Genes Encoding Important β-Lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [Green Version]
- Nordmann, P.; Poirel, L.; Carrër, A.; Toleman, M.A.; Walsh, T.R. How To Detect NDM-1 Producers. J. Clin. Microbiol. 2011, 49, 718–721. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Bacteria Isolated/Number of Isolates | ||||
---|---|---|---|---|
Hospital (Wastewater) | Hospital (Treated Wastewater) | Municipal (Wastewater) | Municipal (Treated Wastewater) | |
Enterobacteriaceae | Klebsiella spp. (2) | No growth | E. coli (3) | Enterobacter spp. (1) |
Enterobacter spp. (1) | Klebsiella spp. (2) | |||
Enterobacter spp. (1) | ||||
Citrobacter spp. (2) | ||||
Proteus spp. (1) | ||||
Non-Enterobacteriaceae | Acinetobacter spp. (3) | No growth | Acinetobacter spp. (2) | Pseudomonas spp. (1) |
Pseudomonas spp. (1) | Pseudomonas spp. (3) |
Targeted Genes | Nucleotide Sequence (5′to 3′) | Amplicon Size (bp) | Annealing Temp | References |
---|---|---|---|---|
blaCTX-M | Forward—GTGATACCACTTCACCTC | 255 | 56 | [51] |
Reverse -AGTAAGTGACCAGAATCAG | ||||
blaSHV | Forward—ACTATCGCCAGCAGGATC | 356 | 53 | [51] |
Reverse—ATCGTCCACCATCCACTG | ||||
blaTEM | Forward—GATCTCAACAGCGGTAAG | 786 | 58 | [51] |
Reverse—CAGTGAGGCACCTATCTC | ||||
blaKPC | Forward—CATTCAAGGGCTTTCTTGCTGC | 538 | 55 | [52] |
Reverse—ACGACGGCATAGTCATTTGC | ||||
blaIMP | Forward—TTGACACTCCATTTACDG | 139 | 55 | [52] |
Reverse—GATYGAGAATTAAGCCACYCT | ||||
blaVIM | Forward—GATGGTGTTTGGTCGCATA | 390 | 55 | [52] |
Reverse—CGAATGCGCAGCACCAG | ||||
blaOXA-48 | Forward—GCTTGATCGCCCTCGATT | 281 | 57 | [52] |
Reverse—GATTTGCTCCGTGGCCGAAA | ||||
blaNDM-1 | Forward—GGTTTGGCGATCTGGTTTTC | 621 | 52 | [53] |
Reverse—CGGAATGGCTCATCACGATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Irfan, M.; Almotiri, A.; AlZeyadi, Z.A. Antimicrobial Resistance and β-Lactamase Production in Clinically Significant Gram-Negative Bacteria Isolated from Hospital and Municipal Wastewater. Antibiotics 2023, 12, 653. https://doi.org/10.3390/antibiotics12040653
Irfan M, Almotiri A, AlZeyadi ZA. Antimicrobial Resistance and β-Lactamase Production in Clinically Significant Gram-Negative Bacteria Isolated from Hospital and Municipal Wastewater. Antibiotics. 2023; 12(4):653. https://doi.org/10.3390/antibiotics12040653
Chicago/Turabian StyleIrfan, Mohammad, Alhomidi Almotiri, and Zeyad Abdullah AlZeyadi. 2023. "Antimicrobial Resistance and β-Lactamase Production in Clinically Significant Gram-Negative Bacteria Isolated from Hospital and Municipal Wastewater" Antibiotics 12, no. 4: 653. https://doi.org/10.3390/antibiotics12040653