Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh
Abstract
1. Introduction
2. Results
2.1. Prevalence of E. coli in Frozen Chicken Meat
2.2. Antimicrobial Resistance Profiles of E. coli
2.3. Antimicrobial Resistance Genes (ARGs) in E. coli
2.4. Antimicrobial Resistance Phenotype and Genotype Association
3. Discussion
4. Materials and Methods
4.1. Collection of Whole Frozen Chicken
4.2. Sample Processing and Isolation of E. coli
4.3. Identification of E. coli by Polymerase Chain Reaction (PCR)
4.4. Antimicrobial Resistance Profiling (ARP) of the Isolates
4.5. Detection of Antimicrobial Resistance Genes (ARGs) in the Isolates
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kolár, M.; Urbánek, K.; Látal, T. Antibiotic selective pressure and development of bacterial resistance. Int. J. Antimicrob. Agents 2001, 17, 357–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Kinkelaar, D.; Huang, Y.; Li, Y.; Li, X.; Wang, H.H. Acquired antibiotic resistance: Are we born with it? Appl. Environ. Microbiol. 2011, 77, 7134–7141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, Y.; Zhang, W.; Wang, H. Specific patterns of gyrA mutations determine the resistance difference to ciprofloxacin and levofloxacin in Klebsiella pneumoniae and Escherichia coli. BMC Infect. Dis. 2013, 13, 8. [Google Scholar] [CrossRef] [Scilit]
- Centers for Disease Control and Prevention. Antimicrobial Resistance Threat Report. 2013. Available online: http://www.cdc.gov/drugresistance/threat-report-2013 (accessed on 21 October 2015).
- European Commission. Action Plan against the Rising Threats from Antimicrobial Resistance. Communication from the Commission to the European Parliament and the Council. COM (2011) 748. Available online: http://ec.europa.eu/dgs/health_food-safety/docs/communication_amr_2011_748_en.pdf (accessed on 21 October 2015).
- Byarugaba, D.K. A view on antimicrobial resistance in developing countries and responsible risk factors. Int. J. Antimicrob. Agents 2004, 24, 105–110. [Google Scholar] [CrossRef] [Scilit]
- Ayukekbong, J.A.; Ntemgwa, M.; Atabe, A.N. The threat of antimicrobial resistance in developing countries: Causes and control strategies. Antimicrob. Resist. Infect. Control. 2017, 6, 47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- WHO. List of Bacteria for Which New Antibiotics Are Urgently Needed. Available online: http://www.who.int/mediacentre/news/releases/2017/bacteria-antibiotics-needed/en/ (accessed on 27 February 2017).
- Alhaj, N.; Mariana, N.; Raha, A.; Ishak, Z. Prevalence of antimicrobial resistance among Escherichia coli from different sources in Malaysia. Int. J. Poultry Sci. 2007, 6, 293–297. [Google Scholar] [CrossRef] [Scilit]
- Saenz, Y.; Zarazaga, M.; Brinas, L.; Lantero, M.; Ruiz-Larrea, F.; Torres, C. Antibiotic resistance in Escherichia coli isolates obtained from animals, foods and humans in Spain. Int. J. Antimicrob. Agents 2001, 18, 353–358. [Google Scholar] [CrossRef] [Scilit]
- Scott, H.M.; Campbell, L.D.; Harvey, R.B.; Bischoff, K.M.; Alali, W.Q.; Barling, K.S.; Anderson, R.C. Patterns of antimicrobial resistance among commensal Escherichia coli isolated from integrated multi-site housing and worker cohorts of humans and swine. Foodborne Pathog. Dis. 2005, 2, 24–37. [Google Scholar] [CrossRef] [Scilit]
- Sorum, H.; Sunde, M. Resistance to antibiotics in the normal flora of animals. Vet. Res. 2001, 32, 227–241. [Google Scholar] [CrossRef] [Scilit]
- Pereira, J.G.; Fernandes, J.; Duarte, A.R.; Fernandes, S.M. β-Lactam Dosing in Critical Patients: A Narrative Review of Optimal Efficacy and the Prevention of Resistance and Toxicity. Antibiotics. 2022, 11, 1839. [Google Scholar] [CrossRef] [Scilit]
- Hammerum, A.M.; Heuer, O.E. Human health hazards from antimicrobial-resistant Escherichia coli of animal origin. Clin. Infect. Dis. 2009, 48, 916–921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, J.R.; McCabe, J.S.; White, D.G.; Johnston, B.; Kuskowski, M.A.; McDermott, P. Molecular Analysis of Escherichia coli from retail meats (2002–2004) from the United States National Antimicrobial Resistance Monitoring System. Clin. Infect. Dis. 2009, 49, 195–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, J.R.; Sannes, M.R.; Croy, C.; Johnston, B.; Clabots, C.; Kuskowski, M.A.; Bender, J.; Smith, K.E.; Winokur, P.L.; Belongia, E.A. Antimicrobial drug-resistant Escherichia coli from humans and poultry products, Minnesota and Wisconsin, 2002-2004. Emerg. Infect. Dis. 2007, 13, 838–846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Von, B.; Marre, R. Antimicrobial resistance of Escherichia coli and therapeutic implications. Int. J. Med. Microbiol. 2005, 295, 503–511. [Google Scholar]
- Kikuvi, G.M.; Schwarz, S.; Ombui, J.N.; Mitema, E.S.; Kehrenberg, C. Streptomycin and chloramphenicol resistance genes in Escherichia coli isolates from cattle, pigs, and chicken in Kenya. Microb. Drug Resist. 2007, 1, 62–68. [Google Scholar] [CrossRef] [Scilit]
- Vieira, A.R. Association between antimicrobial resistance in Escherichia coli isolates from food animals and blood stream isolates from humans in Europe: An ecological study. Foodborne Pathog. Dis. 2011, 8, 1295–1301. [Google Scholar] [CrossRef] [Scilit]
- Blake, D.P.; Hillman, K.; Fenlon, D.R.; Low, J.C. Transfer of antibiotic resistance between commensal and pathogenic members of the Enterobacteriaceae under ideal conditions. J. Appl. Microbiol. 2003, 95, 428–436. [Google Scholar] [CrossRef] [Scilit]
- Mathew, A.G.; Liamthong, S.; Lin, J.; Hong, Y. Evidence of class 1 integron transfer between Escherichia coli and Salmonella spp. on livestock farms. Foodborne Pathog. Dis. 2009, 6, 959–964. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walsh, C.; Duffy, G.; Nally, P.; O’Mahoney, R.; McDowell, D.A.; Fanning, S. Transfer of ampicillin resistance from Salmonella Typhimurium DT104 to Escherichia coli K12 in food. Lett. Appl. Microbiol. 2008, 46, 210–215. [Google Scholar] [CrossRef] [Scilit]
- Poppe, C.; Martin, L.C.; Gyles, C.L.; Reid-Smith, R.; Boerlin, P.; McEwen, S.A.; Prescott, J.F.; Forward, K.R. Acquisition of resistance to extended-spectrum cephalosporins by Salmonella Newport and Escherichia coli in the intestinal tract of turkey poults. Appl. Environ. Microbiol. 2005, 71, 1184–1192. [Google Scholar] [CrossRef] [Scilit]
- Rahman, M.S.; Jang, D.H.; Yu, C.J. Poultry industry of Bangladesh: Entering a new phase. Korean J. Agric. Sci. 2017, 44, 272–282. [Google Scholar]
- Parvin, M.S.; Talukder, S.; Ali, M.Y.; Chowdhury, E.H.; Rahman, M.T.; Islam, M.T. Antimicrobial resistance pattern of Escherichia coli isolated from frozen chicken meat in Bangladesh. Pathogens 2020, 9, 420. [Google Scholar] [CrossRef] [Scilit]
- Uddin, J.; Hossain, K.; Hossain, S.; Saha, K.; Jubyda, F.T.; Haque, R.; Billah, B.; Talukder, A.A.; Parvez, A.K.; Dey, S.K. Bacteriological assessments of foodborne pathogens in poultry meat at different super shops in Dhaka, Bangladesh. Ital. J. Food Saf. 2019, 8, 6720. [Google Scholar] [CrossRef] [Scilit]
- Alam, S.T.; Howard, M.; Fatema, K.; Haque, K.M.F. Antibiogram of pre-processed raw chicken meat from different super shops of Dhaka city, Bangladesh. J. Allied Health Sci. 2015, 2, 45–52. [Google Scholar]
- Al-Amin, M.; Hoque, M.N.; Siddiki, A.Z.; Saha, S.; Kamal, M.M. Antimicrobial resistance situation in animal health of Bangladesh. Vet. World. 2020, 13, 2713–2727. [Google Scholar] [CrossRef] [Scilit]
- Rosengren, L.B.; Waldner, C.L.; Reid-Smith, R.J. Associations between antimicrobial resistance phenotypes, antimicrobial resistance genes, and virulence genes of fecal E. coli isolates from healthy grow-finish pigs. Appl. Environ. Microbiol. 2009, 75, 1373–1380. [Google Scholar] [CrossRef] [Scilit]
- Gow, S.P.; Waldner, C.L.; Harel, J.; Boerlin, P. Associations between antimicrobial resistance genes in fecal generic E. coli isolates from cow-calf herds in western Canada. Appl. Environ. Microbiol. 2008, 74, 3658–3666. [Google Scholar] [CrossRef] [Scilit]
- Ewers, C.; Janßen, T.; Kießling, S.; Philipp, H.-C.; Wieler, L.H. Molecular epidemiology of avian pathogenic Escherichia coli (APEC) isolated from colisepticemia in poultry. Vet. Microbiol. 2004, 104, 91–101. [Google Scholar] [CrossRef] [Scilit]
- Turtura, G.C.; Massa, S.; Chazvinizadeh, H. Antibiotic resistance among coliform bacteria isolated from carcasses of commercially slaughtered chickens. Int. J. Food Microbiol. 1990, 11, 351–354. [Google Scholar] [CrossRef] [Scilit]
- Angulo, F.J.; Johnson, K.R.; Tauxe, R.V.; Cohen, M.L. Origins and consequences of antimicrobial-resistant nontyphoidal Salmonella: Implications for the use of fluoroquinolones in food animals. Microb. Drug Resist. 2000, 6, 77–83. [Google Scholar] [CrossRef] [Scilit]
- Miles, T.D.; McLaughlin, W.; Brown, P.D. Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Vet. Res. 2006, 2, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Rahman, M.M.; Husna, A.; Elshabrawy, H.A.; Alam, J.; Runa, N.Y.; Badruzzaman, A.T.M.; Banu, N.A.; Al Mamun, M.; Paul, B.; Das, S.; et al. Isolation and molecular characterization of multidrug-resistant Escherichia coli from chicken meat. Sci. Rep. 2020, 10, 21999. [Google Scholar] [CrossRef] [Scilit]
- Akond, M.A.; Hassan, S.M.R.; Alam, S.; Shirin, M. Antibiotic Resistance of Escherichia Coli Isolated From Poultry and Poultry Environment of Bangladesh. Am. J. Environ. Sci. 2009, 5, 47–52. [Google Scholar]
- Hasan, B.; Faruque, R.; Drobni, M.; Waldenström, J.; Sadique, A.; Ahmed, K.U.; Islam, Z.; Parvez, M.B.; Olsen, B.; Alam, M. High prevalence of antibiotic resistance in pathogenic Escherichia coli from large- and small-scale poultry farms in Bangladesh. Avian Dis. 2011, 55, 689–692. [Google Scholar] [CrossRef] [Scilit]
- Sader, H.S.; Pignatari, A.C.C. E Test: A novel technique for antimicrobial susceptibility testing. Sao Paulo Med. J. 1994, 112, 635–638. [Google Scholar] [CrossRef] [Scilit]
- Dickert, H.; Machka, K.; Braveny, I. The uses and limitations of disc diffusion in the antibiotic sensitivity testing of bacteria. Infection 1981, 9, 18–24. [Google Scholar] [CrossRef] [Scilit]
- Klancnik, A.; Piskernik, S.; Jersek, B.; Mozina, S.S. Evaluation of diffusion and dilution methods to determine the antibacterial activity of plant extracts. J. Microbiol. Methods 2010, 81, 121–126. [Google Scholar] [CrossRef] [Scilit]
- Al Azad, M.; Rahman, A.; Rahman, M.; Amin, R.; Begum, M.; Ara, I.; Fries, R.; Husna, A.; Khairalla, A.S.; Badruzzaman, A. Susceptibility and multidrug resistance patterns of Escherichia coli isolated from cloacal swabs of live broiler chickens in Bangladesh. Pathogens 2019, 8, 118. [Google Scholar] [CrossRef] [Scilit]
- Parvez, M.A.K.; Marzan, M.; Liza, S.M.; Mou, T.J.; Azmi, I.J.; Rahman, M.S.; Mahmud, Z.H. Prevalence of inhibitor resistant beta lactamase producing E. coli in human and poultry origin of Bangladesh. J. Bacteriol. Parasitol. 2016, 7, 1–3. [Google Scholar]
- Aarts, H.J.M.; Guerra, B.; Malorny, B. Molecular methods for detection of antimicrobial resistance. In Aarestrup (ed) Antimicrobial Resistance in Bacteria of Animal Origin; ASM Press: Washington, DC, USA, 2006. [Google Scholar]
- O’Connor, A.M.; Poppe, C.; McEwen, S.A. Changes in the prevalence of resistant E. coli in cattle receiving subcutaneously injectable oxytetracycline in addition to in-feed chlortetracycline comparing with cattle receiving only in-feed chlortetracycline. Can. J. Vet. Res. 2002, 66, 145–150. [Google Scholar]
- Yang, Y.; Du, H.; Zou, G.; Song, Z.; Zhou, Y.; Li, H.; Tan, C.; Chen, H.; Fischetti, V.A.; Li, J. Encapsulation and delivery of phage as a novel method for gut flora manipulation in situ: A review. J. Control. Release 2022, 1, S0168–S3659. [Google Scholar] [CrossRef] [Scilit]
- WHO. Laboratory protocol. In Isolation of Salmonella spp. From Food and Animal Faeces, 5th ed.; WHO: Geneva, Switzerland, 2010; Volume 13, pp. 4–8. [Google Scholar]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2001. [Google Scholar]
- Tsen, H.Y.; Lin, C.K.; Chi, W.R. Development and use of 16S rRNA gene targeted PCR primers for the identification of Escherichia coli cells in water. J. Appl. Microbiol. 1998, 85, 554–560. [Google Scholar] [CrossRef] [Scilit]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 28th ed.; CLSI supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit]
- Randall, L.P.; Cooles, S.W.; Osborn, M.K.; Piddock, L.J.V.; Woodward, M.J. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J. Antimicrob. Chemother. 2004, 53, 208–216. [Google Scholar] [CrossRef] [Scilit]
- Van, T.T.; Chin, J.; Chapman, T.; Tran, L.T.; Coloe, P.J. Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int. J. Food. Microbiol. 2008, 124, 217–223. [Google Scholar] [CrossRef] [Scilit]
- Toro, C.; Farfán, M.; Contreras, I.; Flores, O.; Navarro, N.; Mora, G.; Prado, V. Genetic analysis of antibiotic-resistance determinants in multidrug-resistant Shigella strains isolated from Chilean children. Epidemiol. Infect. 2005, 133, 81–86. [Google Scholar] [CrossRef] [Scilit]
- Landis, J.R.; Koch, G.G. The measurement of observer agreement for categorical data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef] [Scilit]



| Location | Number of Supermarkets | No. of Chicken Sample | Sources of Chicken | No. of Positive Sample | Prevalence (%) |
|---|---|---|---|---|---|
| Gulshan | 4 | 40 | Contract farmers | 8 | 20.0 |
| Dhanmondi | 4 | 40 | Contract farmers | 14 | 35.0 |
| Mirpur | 4 | 40 | Contract farmers | 16 | 40.0 |
| Uttara | 4 | 40 | Contract farmers | 12 | 30.0 |
| Overall | 160 | 50 | 31.25 |
| Antimicrobial Class | Antimicrobial Agent (Conc.) | No. of E. coli Tested | No. of Isolates (%) | ||
|---|---|---|---|---|---|
| Resistance | Intermediate | Sensitive | |||
| Aminoglycosides | Streptomycin (10 µg) | 50 | 19 (38.0) | 10 (20.0) | 21 (42.0) |
| Gentamicin (10 µg) | 50 | 8 (16.0) | 14 (28.0) | 28 (56.0) | |
| Tetracyclines | Tetracycline (30 µg) | 50 | 33 (66.0) | 0 (0.0) | 17 (34.0) |
| Beta-lactams | Ampicillin (10 µg) | 50 | 19 (38.0) | 3 (6.0) | 28 (56.0) |
| Macrolides | Erythromycin (15 µg) | 50 | 21 (42.0) | 10 (20.0) | 19 (38.0) |
| Phenicols | Chloramphenicol (30 µg) | 50 | 11 (22.0) | 4 (8.0) | 35 (70.0) |
| Sulfonamides | Sulfonamide (300 µg) | 50 | 14 (28.0) | 15 (30.0) | 21 (42.0) |
| Overall | 350 | 125 (35.7) | 56 (16.0) | 169 (48.3) | |
| Antibiotic Class | No. of Antimicrobials | No. of Isolate Resistant (%) | MDR a No. of Isolate (%) |
|---|---|---|---|
| 1 | 1 | 3 (6.00) | No |
| 2 | 2 | 2 (4.00) | |
| 3 | 3 (6.00) | ||
| 3 | 3 | 16 (32.00) | Yes |
| 4 | 4 (8.00) | 45 (90.00) | |
| 4 | 4 | 13 (26.00) | |
| 5 | 3 (6.00) | ||
| 5 | 5 | 3 (6.00) | |
| 6 | 2 (4.00) | ||
| 6 | 7 | 1 (2.00) |
| Antimicrobial Class | Antimicrobial Agent | ARGs | No. of E. coli Positive (%) | No. of E. coli Negative (%) |
|---|---|---|---|---|
| Aminoglycosides | Streptomycin | aadA1 | 28 (56.0) | 22 (44.0) |
| Gentamicin | aac(3)-IV | 22 (44.0) | 28 (56.0) | |
| Tetracyclines | Tetracycline | tet(A) | 33 (66.0) | 17 (34.0) |
| tet(B) | 30 (60.0) | 20 (40.0) | ||
| Beta-lactams | Ampicillin | blaCITM | 24 (48.0) | 26 (52.0) |
| blaSHV | 20 (40.0) | 30 (60.0) | ||
| Macrolides | Erythromycin | ereA | 32 (64.0) | 18 (36.0) |
| Phenicols | Chloramphenicol | cmlA | 17 (34.0) | 33 (66.0) |
| cat1 | 18 (36.0) | 32 (64.0) | ||
| Sulfonamides | Sulfonamide | sul1 | 28 (56.0) | 22 (44.0) |
| Antimicrobial | NP | ARG | NG | P+/G+ | P+/G- | P-/G+ | P-/G- | Odds Ratio | 95% CI | p |
|---|---|---|---|---|---|---|---|---|---|---|
| Streptomycin | 29 | aadA1 | 28 | 27 | 2 | 1 | 20 | 270.00 | 22.86–3189.39 | <0.0001 |
| Gentamycin | 22 | aac(3)-IV | 22 | 19 | 3 | 3 | 25 | 52.78 | 9.57–291.19 | <0.0001 |
| Tetracycline | 33 | tet(A) | 33 | 32 | 1 | 1 | 16 | 512.00 | 30.03–8728.99 | <0.0001 |
| tet(B) | 30 | 20 | 12 | 10 | 8 | 1.33 | 0.41–4.31 | 0.63 | ||
| Ampicillin | 22 | blaCITM | 24 | 15 | 7 | 9 | 19 | 4.52 | 1.37–14.98 | 0.01 |
| blaSHV | 20 | 13 | 9 | 7 | 21 | 4.33 | 1.30–14.47 | 0.02 | ||
| Erythromycin | 31 | ereA | 32 | 30 | 1 | 2 | 17 | 255.00 | 21.50–3024.21 | <0.0001 |
| Chloramphenicol | 15 | cmlA | 17 | 11 | 4 | 6 | 29 | 13.29 | 3.14–56.27 | 0.0004 |
| cat1 | 18 | 12 | 3 | 6 | 29 | 19.33 | 4.14–90.24 | 0.0002 | ||
| Sulfonamide | 29 | sulI | 28 | 26 | 3 | 2 | 19 | 82.33 | 12.51–542.00 | <0.0001 |
| Antimicrobial Agent | Resistance Gene | Sequence (5″-3″) | Size (bp) | Annealing Temp (°C) | References |
|---|---|---|---|---|---|
| Streptomycin | Adenylyl transferases (aadA1) | F- TATCCAGCTAAGCGCGAACT | 447 | 58 | [51] |
| R- ATTTGCCGACTACCTTGGTC | |||||
| Gentamicin | Aminoglycoside acetyltransferases (aac(3)-IV) | F- CTTCAGGATGGCAAGTTGGT | 286 | 55 | [52] |
| R- TCATCTCGTTCTCCGCTCAT | |||||
| Tetracycline | Efflux pump resistance (tet(A)) | F- GGTTCACTCGAACGACGTCA | 577 | 57 | [51] |
| R- CTGTCCGACAAGTTGCATGA | |||||
| Efflux pump resistance (tet(B)) | F -CCTCAGCTTCTCAACGCGTG | 634 | 56 | ||
| R- GCACCTTGCTGATGACTCTT | |||||
| Ampicillin | β-lactamase encoding penicillin resistance (BlaSHV) | F- TCGCCTGTGTATTATCTCCC | 768 | 52 | [52] |
| R- CGCAGATAAATCACCACAATG | |||||
| β-lactamase encoding cephalosporin resistance (BlaCITM) | F- TGGCCAGAACTGACAGGCAAA | 462 | 47 | ||
| R- TTTCTCCTGAACGTGGCTGGC | |||||
| Erythromycin | Erythromycin esterase (ereA) | F- GCCGGTGCTCATGAACTTGAG | 419 | 60 | |
| R- CGACTCTATTCGATCAGAGGC | |||||
| Chloramphenicol | Acetyltransferases (catA1) | F-AGTTGCTCAATGTACCTATAACC | 547 | 55 | |
| R- TTGTAATTCATTAAGCATTCTGCC | |||||
| Transporter resistance (cmlA) | F- CCGCCACGGTGTTGTTGTTATC | 698 | 33 | ||
| R- CACCTTGCCTGCCCATCATTAG | |||||
| Sulfonamide | Dihydropteroate synthase (sul1) | F- TTCGGCATTCTGAATCTCAC | 822 | 47 | [53] |
| R- ATGATCTAACCCTCGGTCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hossain, M.M.K.; Islam, M.S.; Uddin, M.S.; Rahman, A.T.M.M.; Ud-Daula, A.; Islam, M.A.; Rubaya, R.; Bhuiya, A.A.; Alim, M.A.; Jahan, N.; et al. Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh. Antibiotics 2023, 12, 41. https://doi.org/10.3390/antibiotics12010041
Hossain MMK, Islam MS, Uddin MS, Rahman ATMM, Ud-Daula A, Islam MA, Rubaya R, Bhuiya AA, Alim MA, Jahan N, et al. Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh. Antibiotics. 2023; 12(1):41. https://doi.org/10.3390/antibiotics12010041
Chicago/Turabian StyleHossain, Mridha. Md. Kamal, Md. Sharifull Islam, Md. Salah Uddin, A. T. M. Mijanur Rahman, Asad Ud-Daula, Md. Ariful Islam, Rubaya Rubaya, Anjuman Ara Bhuiya, Md. Abdul Alim, Nusrat Jahan, and et al. 2023. "Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh" Antibiotics 12, no. 1: 41. https://doi.org/10.3390/antibiotics12010041
APA StyleHossain, M. M. K., Islam, M. S., Uddin, M. S., Rahman, A. T. M. M., Ud-Daula, A., Islam, M. A., Rubaya, R., Bhuiya, A. A., Alim, M. A., Jahan, N., Li, J., & Alam, J. (2023). Isolation, Identification and Genetic Characterization of Antibiotic Resistant Escherichia coli from Frozen Chicken Meat Obtained from Supermarkets at Dhaka City in Bangladesh. Antibiotics, 12(1), 41. https://doi.org/10.3390/antibiotics12010041

