Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products
Abstract
:1. Introduction
2. Results
2.1. Prevalence of Pathogens in Salmonella Isolates
2.2. Antimicrobial Susceptibility
2.3. Prevalence of Resistance Genes
3. Discussion
4. Materials and Methods
4.1. Sampling
4.2. Susceptibility Testing
4.3. DNA Extraction Protocol
4.4. PCR Protocol for Confirmation of Pathogenic Strains
4.5. PCR Protocol for Resistance Gene Testing
4.6. Statistical Analysis
Gene | Nucleotide Sequence 5′–3′ | Product Size (pb) | Annealing t (°) | Antibiotic | Reference |
---|---|---|---|---|---|
tetA | F:TTGGCATTCTGCATTCACTC R:GTATAGCTTGCCGGAAGTCG | 494 | 55 | TET | [39] |
tetB | F:GTATAGCTTGCCGGAAGTCG R:CAGTGCTGTTGTGTCATTAA | 571 | 55 | TET | [39] |
tetC | F:GCTTGGAATACTGAGTGTAA R:CTTGAGAGCCTTCAACCCAG | 418 | 55 | TET | [39] |
Sul1 | F:CAAAGCCCCTTGCTTGTTAC R:TTTCCTGACCCTGCGCTCTAT | 793 | 55 | SMX, SXT | [40] |
Sul2 | F:GTGCGGACGTAGTCAGCGCCA R:CCTGTTTCGTCCGACACAGA | 667 | 55 | SMX, SXT | [40] |
cat1 | F:AACCAGACCGTTCAGCTGGAT R:CCTGCCACTCATCGCAGTAC | 549 | 55 | CHL | [41] |
cat2 | F:AACGGCATGAACCTGAA R:ATCCCAATGGCATCGTAAAG | 547 | 55 | CHL | [40] |
floR | F:ATGACCACCACACGCCCCG R:AGACGACTGGCGACTTCTTCG | 198 | 55 | CHL | [40] |
aac(3)11a, | F:CGGCCTGCTGAATCAGTTTC R:AAAGCCCACGACACCTTCTC | 439 | 55 | GEN | [39] |
aph(3)11a | F:TCTGAAACATGGCAAAGGTAG R:AGCCGTTTCTGTAATGAAGGA | 582 | 55 | GEN | [39] |
blaCMY-2 | F:TGG CCG TTG CCG TTA TCT AC R:CCC GTT TTA TGC ACC CAT GA | 870 | 55 | β-Lactams | [42] |
blaSHV-1 | F:GGC CGC GTA GGC ATG ATA GA R:CCC GGC GAT TTG CTG ATT TC | 714 | 55 | β-Lactams | [42] |
blaTEM-1 | F:CAG CGG TAA GAT CCT TGA GA R:ACT CCC CGT CGT GTA GAT AA | 643 | 55 | β-Lactams | [42] |
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Popa, G.L.; Papa, M.I. Salmonella spp. Infection—A continuous threat worldwide. Germs 2021, 11, 88–96. [Google Scholar] [CrossRef] [PubMed]
- European Food Safety Authority, European Centre for Disease Prevention and Control [EFSA]. The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, 40–67. [Google Scholar]
- Park, H.K.; Rhie, K.; Yeom, J.S.; Park, J.S.; Park, E.S.; Seo, J.H.; Lim, J.Y.; Park, C.H.; Woo, H.O.; Youn, H.S.; et al. Differences in Clinical and Laboratory Findings between Group D and Non-Group D Non-Typhoidal Salmonella Gastroenteritis in Children. Pediatr Gastroenterol. Hepatol. Nutr. 2015, 18, 85–93. [Google Scholar] [CrossRef] [Green Version]
- Ehuwa, O.; Jaiswal, A.K.; Jaiswal, S. Salmonella, Food Safety and Food Handling Practices. Foods 2021, 10, 907. [Google Scholar] [CrossRef]
- Rose, N.; Beaudeau, F.; Drouin, P.; Toux, J.Y.; Rose, V.; Colin, P. Risk factors for Salmonella enterica subsp. enterica contamination in French broiler-chicken flocks at the end of the rearing period. Prev. Vet. Med. 1999, 39, 265–277. [Google Scholar] [CrossRef]
- Centers for Disease Control and Prevention [CDC]. Available online: https://www.cdc.gov/foodsafety/communication/salmonella-food.html (accessed on 12 August 2022).
- Rohr, J.R.; Barrett, C.B.; Civitello, D.J. Emerging human infectious diseases and the links to global food production. Nat. Sustain. 2019, 2, 445–456. [Google Scholar] [CrossRef] [PubMed]
- De Cesare, A. Salmonella in Foods: A Reemerging Problem. Adv. Food Nutr. Res. 2018, 86, 137–179. [Google Scholar]
- European Centre for Disease Prevention and Control [ECDC]. Rapid Outbreak Assessment: Multi-Country Outbreak of Salmonella Enteritidis Sequence Type (ST)11 Infections Linked to Eggs and Egg Products (Europa.Eu). Available online: https://www.ecdc.europa.eu/en/publications-data/multi-country-outbreak-salmonella-enteritidis-sequence-type-st11-infections (accessed on 11 August 2022).
- Feiyang, M.A.; Shixin, X.U.; Zhaoxin, T.; Zekun, L.; Zhang, L. Use of antimicrobials in food animals and impact of transmission of antimicrobial resistance on humans. Biosaf. Health 2021, 3, 32–38. [Google Scholar]
- San Millan, A.; Escudero, J.A.; Gifford, D.R.; Mazel, D.; MacLean, R.C. Multicopy plasmids potentiate the evolution of antibiotic resistance in bacteria. Nat. Ecol. Evol. 2016, 7, 10. [Google Scholar] [CrossRef]
- Han, M.; Arbeithuber, B.; Marzia, A.C.; DeGiorgio, M.; Nekrutenko, A. A High-Resolution View of Adaptive Event Dynamics in a Plasmid. Genome Biol. Evol. 2019, 11, 3022–3034. [Google Scholar]
- Centers for Disease Control and Prevention (CDC). Antibiotic Resistance Threats in the United States. 2013. Available online: https://www.cdc.gov/drugresistance/threat-report-2013/pdf/ar-threats-2013-508.pdf (accessed on 12 September 2022).
- Centers for Disease Control and Prevention (CDC). National Antimicrobial Resistance Monitoring System for Enteric Bacteria (NARMS): Human Isolates Surveillance Report for 2015 (Final Report). 2018. Available online: https://www.cdc.gov/narms/pdf/2015-NARMS-Annual-Report-cleared_508.pdf (accessed on 12 September 2022).
- Hu, L.; Cao, G.; Brown, E.W.; Allard, M.W.; Ma, L.M.; Khan, A.A.; Zhang, G. Antimicrobial resistance and related gene analysis of Salmonella from egg and chicken sources by whole-genome sequencing. Poult. Sci. 2020, 99, 7076–7083. [Google Scholar] [CrossRef] [PubMed]
- Jajere, S.M. A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors, host specificity and antimicrobial resistance including multidrug resistance. Vet. World. 2019, 12, 504–521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castro-Vargas, R.E.; Herrera-Sánchez, M.P.; Rodríguez-Hernández, R.; Rondón-Barragán, I.S. Antibiotic resistance in Salmonella spp. isolated from poultry: A global overview. Vet. World. 2020, 13, 2070–2084. [Google Scholar] [CrossRef] [PubMed]
- Rusul, G.; Khair, J.; Radu, S.; Yassin, R. Prevalence of Salmonella in broilers at retail outlets, processing plants and farms in Malaysia. Int. J. Food Microbiol. 1996, 33, 183–194. [Google Scholar] [CrossRef]
- Siddiky, N.A.; Sarker, M.S.; Khan, M.; Rahman, S.; Begum, R.; Kabir, M. Virulence and Antimicrobial Resistance Profiles of Salmonella enterica Serovars Isolated from Chicken at Wet Markets in Dhaka, Bangladesh. Microorganisms 2021, 9, 952. [Google Scholar] [CrossRef]
- Thung, T.Y.; Radu, S.; Mahyudin, N.A.; Rukayadi, Y.; Zakaria, Z.; Mazlan, N.; Tan, B.H.; Lee, E.; Yeoh, S.L.; Chin, Y.Z.; et al. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia. Front. Microbiol. 2018, 11, 2697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tarabees, R.; Elsayed, M.S.A.; Shawish, R.; Basiouni, S.; Shehata, A.A. Isolation and characterization of Salmonella Enteritidis and Salmonella Typhimurium from chicken meat in Egypt. J. Infect. Dev. Ctries 2017, 11, 314–319. [Google Scholar] [CrossRef] [Green Version]
- Arkali, A.; Cetinkaya, B. Molecular identification and antibiotic resistance profiling of Salmonella species isolated from chickens in eastern Turkey. BMC Vet. Res. 2020, 16, 205. [Google Scholar]
- Bahramianfard, H.; Derakhshandeh, A.; Naziri, Z.; Khaltabadi Farahani, R. Prevalence, virulence factor and antimicrobial resistance analysis of Salmonella Enteritidis from poultry and egg samples in Iran. BMC Vet. Res. 2021, 17, 196. [Google Scholar] [CrossRef]
- Velasquez, C.G.; Macklin, K.S.; Kumar, S.; Bailey, M.; Ebner, P.E.; Oliver, H.F.; Martin-Gonzalez, F.S.; Singh, M. Prevalence and antimicrobial resistance patterns of Salmonella isolated from poultry farms in southeastern United States. Poultry Sci. 2018, 97, 2144–2152. [Google Scholar] [CrossRef]
- Schroeter, A.; Hoog, B.; Helmuth, R. Resistance of Salmonella isolates in Germany. J. Vet. Med. B Infect. Dis. Vet. Public Health 2004, 51, 389–392. [Google Scholar] [CrossRef] [PubMed]
- Huehn, S.; La Ragione, R.M.; Anjum, M.; Saunders, M.; Woodward, M.J.; Bunge, C.; Helmuth, R.; Hauser, E.; Guerra, B.; Beutlich, J.; et al. Virulotyping and antimicrobial resistance typing of Salmonella enterica serovars relevant to human health in Europe. Foodborne Pathog. Dis. 2010, 7, 523–535. [Google Scholar] [CrossRef] [PubMed]
- Cortés, V.; Sevilla-Navarro, S.; García, C.; Marín, C.; Catalá-Gregori, P. Monitoring antimicrobial resistance trends in Salmonella spp. from poultry in Eastern Spain. Poultry Sci. 2022, 101, 101832. [Google Scholar] [CrossRef] [PubMed]
- Khaltabadi Farahani, R.; Ehsani, P.; Ebrahimi-Rad, M.; Khaledi, A. Molecular Detection, Virulence Genes, Biofilm Formation, and Antibiotic Resistance of Salmonella enterica Serotype enteritidis Isolated from Poultry and Clinical Samples. Jundishapur J. Microbiol. 2018, 11, 9–13. [Google Scholar] [CrossRef] [Green Version]
- En-nassiri, H.; Es-soucratti, K.; Bouchrif, B. Emergence of multi-resistant Salmonella in Morocco. Rev. De L’entrepreneuriat Et De L’innovation 1 2017, 3, 1–5. [Google Scholar] [CrossRef]
- Ziyate, N.; Karraouan, B.; Kadiri, A.; Darkaoui, S.; Soulaymani, A.; Bouchrif, B. Prevalence and antimicrobial resistance of Salmonella isolates in Moroccan laying hens farms. J. Appl. Poult. Res. 2016, 25, 539–546. [Google Scholar] [CrossRef]
- Cortes Vélez, D.; Rodríguez, V.; Verjan García, N. Phenotypic and Genotypic Antibiotic Resistance of Salmonella from Chicken Carcasses Marketed at Ibague, Colombia. Rev. Bras. Cienc. Avic. 2017, 19, 347–354. [Google Scholar] [CrossRef] [Green Version]
- Pławinska-Czarnak, J.; Wódz, K.; Kizerwetter-Swida, M.; Bogdan, J.; Kwiecinski, P.; Nowak, T.; Strzałkowska, Z.; Anusz, K. Multi-Drug Resistance to Salmonella spp. When Isolated from Raw Meat Products. Antibiotics 2022, 11, 876. [Google Scholar] [CrossRef]
- Eng, S.K.; Pusparajah, P.; Mutalib, N.S.A. Salmonella: A review on pathogenesis, epidemiology and antibiotic resistance. Front. Life Sci. 2015, 8, 284–293. [Google Scholar] [CrossRef] [Green Version]
- International Organization for Standardization (ISO) 6579-1:2017, Microbiology of the Food Chain—Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella—Part 1: Detection of Salmonella spp. Available online: https://www.iso.org/standard/56712.html (accessed on 12 August 2021).
- M100-S23; Performance Standards for Antimicrobial Susceptibility Testing. Clinical & Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2013.
- M100; Performance Standards for Antimicrobial Susceptibility Testing, 28th ed. CLSI Supplement; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018; Volume 38.
- Mihaiu, L.; Lapusan, A.; Tanasuica, R.; Sobolu, R.; Mihaiu, R.; Oniga, O.; Mihaiu, M. First study of Salmonella in meat in Romania. J. Infect. Dev. Ctries. 2014, 8, 50–58. [Google Scholar] [CrossRef] [Green Version]
- Sen, P.K. Estimates of the regression coefficient based on Kendall’s tau. J. Am. Statistic Assoc. 1968, 63, 1379–1389. [Google Scholar] [CrossRef]
- Adesiji, Y.O.; Fagbami, A.H. Epidemiology of bacterial zoonosis in Nigeria. Niger. J. Health Biomed. Sci. 2006, 5, 20–25. [Google Scholar]
- Ma, M.; Wang, H.; Yu, Y. Detection of antimicrobial resistance genes of pathogenic Salmonella from swine with DNA microarray. J. Vet. Diagn Invest. 2007, 19, 161–167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, S.; White, D.G.; Ge, B.; Ayers, S.; Friedman, S.; English, L. Identification and characterization of integron-mediated antibiotic resistance among Shiga toxin producing Escherichia coli isolates. Appl. Environ. Microbiol. 2001, 67, 1558–1564. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, S.; Zhao, S.; White, D.G.; Schroeder, C.M.; Lu, R.; Yang, H.; McDermott, P.F.; Ayers, S.; Meng, J. Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from retail meats. App. Environ. Microb. 2004, 70, 1–7. [Google Scholar] [CrossRef]
Sample No./Year | Serotype | Product | Antimicrobial Resistance Profile | Antimicrobial Resistance Genes |
---|---|---|---|---|
1,2,3,4,5,6,7/2011 | S. enteritidis | Poultry meat (carcass) | S, TET | sulI, tetA |
8,9,10,11/2011 | S. enteritidis | Poultry meat (chicken breast) | NA, TET | tetA, tetB |
12,13/2012 | S. enteritidis | Poultry meat (carcass) | S, TET | sulI, dfr, tetA |
14/2012 | S. thyphimurium | Poultry meat (carcass) | AMP, TET, | sulI, sulII, tetA, |
15,16,17,18/2013 | S. enteritidis | Poultry meat (carcass) | SMX, TET | sulI, tetB, tetC |
19,20,21/2013 | S. thyphimurium | Poultry meat (carcass) | CHL, AMP, TET, NA | sulI, sulII, tetA, tetB, cat1 |
22,23,24,25/2013 | S. enteritidis | Poultry meat (carcass) | CAZ, NA, TET, S | sulI, sulII, tetA, tetC |
26,27,28/2013 | S. enteritidis | Poultry organs (liver) | SMX, AMP, TET, NA | sulI, sulII, tetA, tetB, |
29,30/2014 | S. enteritidis | Poultry meat (carcass) | TET, NA | sulI, tetB, tetA |
31,32,33/2014 | S. thyphimurium | Poultry meat (carcass) | S, AMP | sulI, sulII, tetA, tetB |
34,35/2014 | S. enteritidis | Poultry organs (liver) | AMP, NA, S, CAZ | dhfr1, sulI, tetA |
36,37,38,39/2014 | S. enteritidis | Poultry organs (liver) | NA, TET | blaTEM-1, aadA1, sulI, sulII, tetA, tetB |
40,41,42/2014 | S. thyphimurium | Poultry meat (breast) | AMP, TET | aadA1, sulI, sulII, tetB, |
43,44/2014 | S. thyphimurium | Poultry meat (chicken wings) | NA, TET | aadA1, sulI, sulII |
45,46/2014 | S. enteritidis | Poultry organs (hearts and gizzards) | NA, AMP | blaTEM-1, aadA1, dhfr1, sulI, tetA |
47,48/2015 | S. enteritidis | Poultry meat (carcass) | AMP, TET | aadA1, sulI, sulII, tetB |
49/2015 | S. thyphimurium | Poultry meat (carcass) | CHL, AMP, TET, SXT, NA | aadA1, sulI, sulII, tetA, tetB, tetC, cat1 |
50,51,52,53/2015 | S. enteritidis | Poultry meat (carcass) | AMP, TET | aadA1, sulI, sulII, tetB, |
54/2015 | S. thyphimurium | Poultry organs (liver) | NA, TET | sulI, sulII, tetA |
Sample No./Year | Serotype | Product | Antimicrobial Resistance Profile | Antimicrobial Resistance Genes |
---|---|---|---|---|
55/2016 | S. enteritidis | Poultry organs (hearts and gizzards) | NA, TET | sulI, sulII, tetA, tetB, tetC |
56/2017 | S. enteritidis | Poultry meat (carcass) | AMP, TET | aadA1, sulI, tetB, tetA, tetC |
57/2017 | S. thyphimurium | Poultry meat (carcass) | NA, AMP, TET, CAZ | aadA1, dhfr1, sulI, sulII, tetA, cat2 |
58,59,60/2018 | S. enteritidis | Poultry meat (carcass) | SMX, NA, GEN, AMP, TET, SXT | blaCMY-2, blaTEM-1, aadA1, aac(3)11a, sulI, sulII, tetA, tetC |
61,62/2018 | S. enteritidis | Poultry meat (chicken breast) | S, NA, AMP, TET, CHL | aadA1, sulI, sulII, tetB, blaTEM-1, cat1, floR |
63,64/2018 | S. thyphimurium | Poultry meat (carcass) | NA, TET | sulI, sulII, tetB |
65/2018 | S. thyphimurium | Poultry meat (carcass) | S, AMP, TET, SXT, CAZ, GEN | aadA1, sulI, sulII, tetB, blaTEM-1, cat1. aac(3)11a |
66/2018 | S. thyphimurium | Poultry organs (liver) | SUL, TET | sulI, tetA, tetB, tetC |
67,68/2019 | S. enteritidis | Poultry meat (carcass) | SMX, S, AMP, TET, SXT, CHL | aadA1, sulI, sulII, tetB, blaTEM-1, cat1 |
69,70/2019 | S. enteritidis | Poultry meat (carcass) | NA, TET | blaTEM-1, sulI, tetA |
71/2019 | S. enteritidis | Poultry organs (liver) | AMP, TET | aadA1, sulI, sulII, tetB, blaTEM-1 |
72,73/2020 | S. enteritidis | Poultry meat (carcass) | S, AMP, TET, CIP, SXT, CHL | aadA1, sulI, tetA, tetB, tetC, blaTEM-1, dhfr1, cat1 |
74,75/2020 | S. thyphimurium | Poultry meat (carcass) | NA, TET, | sulI, sulII, tetA, tetB, tetC |
76,77,78/2020 | S. enteritidis | Poultry organs (liver) | AMP, NA | dhfr1, sulI |
79,80/2020 | S. enteritidis | Poultry organs (liver) | SMX, NA, S, AMP, TET, SXT | blaCMY-2, blaTEM-1, aadA1, dhfr1, sulI, sulII, tetA, |
81,82,83/2020 | S. thyphimurium | Poultry meat (breast) | SMX, S, AMP, TET, SXT, NA, CHL | aadA1, sulI, sulII, tetB, blaTEM-1, cat1 |
84,85/2021 | S. thyphimurium | Poultry meat (chicken wings) | AMP, NA | aadA1, dhfr1, sulI, sulII |
86,87,88/2021 | S. enteritidis | Poultry meat (carcass) | S, AMP, NA, TET, SXT, CHL | aadA1, sulI, tetA, tetB, tetC, blaTEM-1, dhfr1, cat1, floR |
89,90/2021 | S. enteritidis | Poultry organs (liver) | SMX, S, AMP, NA, TET, SXT, CHL | aadA1, sulI, sulII, tetB, blaTEM-1, cat1, cat2, floR |
91/2021 | S. enteritidis | Poultry meat (carcass) | S, AMP, TET, CIP, SXT, NA, CHL | aadA1, sulI, tetA, tetB, tetC, blaTEM-1, dhfr1, cat1, floR |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Forgaciu, A.; Tabaran, A.; Colobatiu, L.; Mihaiu, R.; Dan, S.D.; Mihaiu, M. Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products. Antibiotics 2022, 11, 1469. https://doi.org/10.3390/antibiotics11111469
Forgaciu A, Tabaran A, Colobatiu L, Mihaiu R, Dan SD, Mihaiu M. Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products. Antibiotics. 2022; 11(11):1469. https://doi.org/10.3390/antibiotics11111469
Chicago/Turabian StyleForgaciu, Anca, Alexandra Tabaran, Liora Colobatiu, Romolica Mihaiu, Sorin Daniel Dan, and Marian Mihaiu. 2022. "Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products" Antibiotics 11, no. 11: 1469. https://doi.org/10.3390/antibiotics11111469
APA StyleForgaciu, A., Tabaran, A., Colobatiu, L., Mihaiu, R., Dan, S. D., & Mihaiu, M. (2022). Concerning Increase in Antimicrobial Resistance Patterns of Pathogenic Strains of Salmonella Isolated in Poultry Meat Products. Antibiotics, 11(11), 1469. https://doi.org/10.3390/antibiotics11111469