Molecular Detection of Colistin Resistance mcr-1 Gene in Multidrug-Resistant Escherichia coli Isolated from Chicken
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Study Area and Sampling
2.3. Isolation and Biochemical Identification of E. coli
2.4. Antimicrobial Susceptibility Testing
2.5. Extraction of Bacterial DNA
2.6. Molecular Detection of E. coli Pathotype and Colistin mcr-1 Resistance Gene
2.7. Sequences Analysis
2.8. Structural Analysis and Validation
2.9. Molecular Docking
3. Results
3.1. Identification of E. coli Isolates
3.2. Antimicrobial Susceptibility Testing
3.3. Detection of Multidrug Resistance E. coli Isolates Carrying the Colistin Resitance mcr-1 Gene
3.4. Phylogeny and Structural Analysis
3.5. Transmembrane Topology Analysis, Structural Modelling, Refinement, and Validation
3.6. Molecular Docking
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Roth, N.; Käsbohrer, A.; Mayrhofer, S.; Zitz, U.; Hofacre, C.; Domig, K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: A global overview. Poult. Sci. 2019, 98, 1791–1804. [Google Scholar] [CrossRef] [Scilit]
- Marshall, B.M.; Levy, S.B. Food animals and antimicrobials: Impacts on human health. Clin. Microbiol. Rev. 2011, 24, 718–733. [Google Scholar] [CrossRef] [Scilit]
- Van Boeckel, T.P.; Brower, C.; Gilbert, M.; Grenfell, B.T.; Levin, S.A.; Robinson, T.P.; Teillant, A.; Laxminarayan, R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. USA 2015, 112, 5649–5654. [Google Scholar] [CrossRef] [Scilit]
- Van Boeckel, T.P.; Gandra, S.; Ashok, A.; Caudron, Q.; Grenfell, B.T.; Levin, S.A.; Laxminarayan, R. Global antibiotic consumption 2000 to 2010: An analysis of national pharmaceutical sales data. Lancet Infect. Dis. 2014, 14, 742–750. [Google Scholar] [CrossRef] [Scilit]
- Hamid, M.A.; Rahman, M.A.; Ahmed, S.; Hossain, K.M. Status of Poultry Industry in Bangladesh and the Role of Private Sector for its Development. Asian J. Poult. Sci. 2016, 11, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Boamah, V.E.; Agyare, C.; Odoi, H.; Dalsgaard, A. Antibiotic Practices and Factors Influencing the Use of Antibiotics in Selected Poultry Farms in Ghana. J. Antimicrob. Agents 2016, 2, 2. [Google Scholar] [CrossRef]
- Landers, T.F.; Cohen, B.; Wittum, T.E.; Larson, E.L. A review of antibiotic use in food animals: Perspective, policy, and potential. Public Health Rep. 2012, 127, 4–22. [Google Scholar] [CrossRef] [Scilit]
- Castanon, J.I.R. History of the use of antibiotic as growth promoters in European poultry feeds. Poult. Sci. 2007, 86, 2466–2471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hammerum, A.M.; Heuer, O.E. Human Health Hazards from Antimicrobial-Resistant Escherichia coli of Animal Origin. Clin. Infect. Dis. 2009, 48, 916–921. [Google Scholar] [CrossRef] [Scilit]
- Radimersky, T.; Frolkova, P.; Janoszowska, D.; Dolejska, M.; Svec, P.; Roubalova, E.; Cikova, P.; Cizek, A.; Literak, I. Antibiotic resistance in faecal bacteria (Escherichia coli, Enterococcus spp.) in feral pigeons. J. Appl. Microbiol. 2010, 109, 1687–1695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benameur, Q.; Tali-Maamar, H.; Assaous, F.; Guettou, B.; Rahal, K.; Ben-Mahdi, M.H. Detection of multidrug resistant Escherichia coli in the ovaries of healthy broiler breeders with emphasis on extended-spectrum β-lactamases producers. Comp. Immunol. Microbiol. Infect. Dis. 2019, 64, 163–167. [Google Scholar] [CrossRef] [Scilit]
- Lazarus, B.; Paterson, D.L.; Mollinger, J.L.; Rogers, B.A. Do human extraintestinal Escherichia coli infections resistant to expanded-spectrum cephalosporins originate from food-producing animals? A systematic review. Clin. Infect. Dis. 2015, 60, 439–452. [Google Scholar] [CrossRef] [Scilit]
- Falgenhauer, L.; Imirzalioglu, C.; Oppong, K.; Akenten, C.W.; Hogan, B.; Krumkamp, R.; Poppert, S.; Levermann, V.; Schwengers, O.; Sarpong, N.; et al. Detection and characterization of ESBL-producing Escherichia coli from humans and poultry in Ghana. Front. Microbiol. 2019, 10, 3358. [Google Scholar] [CrossRef] [Scilit]
- Kempf, I.; Jouy, E.; Chauvin, C. Colistin use and colistin resistance in bacteria from animals. Int. J. Antimicrob. Agents 2016, 48, 598–606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Chen, L.; Wang, J.; Yassin, A.K.; Butaye, P.; Kelly, P.; Gong, J.; Guo, W.; Li, J.; Li, M.; et al. Molecular detection of colistin resistance genes (mcr-1, mcr-2 and mcr-3) in nasal/oropharyngeal and anal/cloacal swabs from pigs and poultry. Sci. Rep. 2018, 8, 3705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, W.; Li, H.; Shen, Y.; Liu, Z.; Wang, S.; Shen, Z.; Zhang, R.; Walsh, T.R.; Shen, J.; Wang, Y. Novel plasmid-mediated colistin resistance gene mcr-3 in Escherichia coli. mBio 2017, 8, e00543-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uddin, M.B.; Hossain, S.B.; Hasan, M.; Alam, M.N.; Debnath, M.; Begum, R.; Roy, S.; Harun-Al-rashid, A.; Chowdhury, M.S.R.; Rahman, M.M.; et al. Multidrug antimicrobial resistance and molecular detection of MCR-1 gene in Salmonella species isolated from chicken. Animals 2021, 11, 206. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Hou, M.; Xu, Y.; Srinivas, S.; Huang, M.; Liu, L.; Feng, Y. Action and mechanism of the colistin resistance enzyme MCR-4. Commun. Biol. 2019, 2, 36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, R.; Hu, Y.; Li, Z.; Sun, J.; Wang, Q.; Lin, J.; Ye, H.; Liu, F.; Srinivas, S.; Li, D.; et al. Dissemination and Mechanism for the MCR-1 Colistin Resistance. PLoS Pathog. 2016, 12, e1005957. [Google Scholar] [CrossRef] [Scilit]
- Antunes, P.; Mourão, J.; Campos, J.; Peixe, L. Salmonellosis: The role of poultry meat. Clin. Microbiol. Infect. 2016, 22, 110–121. [Google Scholar] [CrossRef] [Scilit]
- Elkenany, R.; Elsayed, M.M.; Zakaria, A.I.; El-Sayed, S.A.E.S.; Rizk, M.A. Antimicrobial resistance profiles and virulence genotyping of Salmonella enterica serovars recovered from broiler chickens and chicken carcasses in Egypt. BMC Vet. Res. 2019, 15, 124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Zhang, R.; Li, J.; Wu, Z.; Yin, W.; Schwarz, S.; Tyrrell, J.M.; Zheng, Y.; Wang, S.; Shen, Z.; et al. Comprehensive resistome analysis reveals the prevalence of NDM and MCR-1 in Chinese poultry production. Nat. Microbiol. 2017, 2, 16260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gad, A.H.; Abo-Shama, U.H.; Harclerode, K.K.; Fakhr, M.K. Prevalence, serotyping, molecular typing, and antimicrobial resistance of Salmonella isolated from conventional and organic retail ground poultry. Front. Microbiol. 2018, 9, 2653. [Google Scholar] [CrossRef] [Scilit]
- Clothier, K.A.; Kim, P.; Mete, A.; Hill, A.E. Frequency, serotype distribution, and antimicrobial susceptibility patterns of Salmonella in small poultry flocks in California. J. Vet. Diagn. Investig. 2018, 30, 471–475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baron, S.; Hadjadj, L.; Rolain, J.M.; Olaitan, A.O. Molecular mechanisms of polymyxin resistance: Knowns and unknowns. Int. J. Antimicrob. Agents 2016, 48, 583–591. [Google Scholar] [CrossRef] [Scilit]
- Rolain, J.M.; Olaitan, A.O. Plasmid-mediated colistin resistance: The final blow to colistin? Int. J. Antimicrob. Agents 2016, 47, 4–5. [Google Scholar] [CrossRef] [Scilit]
- Sobur, M.A.; Ievy, S.; Haque, Z.F.; Nahar, A.; Zaman, S.B.; Rahman, M.T. Emergence of colistin-resistant Escherichia coli in poultry, house flies, and pond water in Mymensingh, Bangladesh. J. Adv. Vet. Anim. Res. 2019, 6, 50–53. [Google Scholar] [CrossRef] [Scilit]
- Islam, A.; Rahman, Z.; Monira, S.; Rahman, M.A.; Camilli, A.; George, C.M.; Ahmed, N.; Alam, M. Colistin resistant Escherichia coli carrying mcr-1 in urban sludge samples: Dhaka, Bangladesh. Gut Pathog. 2017, 9, 77. [Google Scholar] [CrossRef] [Scilit]
- Bayer, A.W.; Kirby, W.M.M.; Sherris, J.C.; Turck, M. Antibiotic Susceptibility Testing by a Standardized Single Disk Method. Am. J. Clin. Pathol. 2018, 45, 493–496. [Google Scholar] [CrossRef] [Scilit]
- Clinical and Laboratory Standards Institute. Supplement M100: Performance Standards for Antimicrobial Susceptibility Testing; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2014; Volume 23. [Google Scholar]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing Supplement M100S, 26th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2016; ISBN 1-56238-923-8. [Google Scholar]
- Satlin, M.J.; Weinstein, M.P.; Patel, J.; Romney, M.; Kahlmeter, G.; Giske, C.G.; Turnidge, J. Clinical and Laboratory Standards Institute and European Committee on Antimicrobial Susceptibility Testing Position Statements on Polymyxin B and Colistin Clinical Breakpoints. Clin. Infect. Dis. 2020, 71, e523–e529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sweeney, M.T.; Lubbers, B.V.; Schwarz, S.; Watts, J.L. Applying definitions for multidrug resistance, extensive drug resistance and pandrug resistance to clinically significant livestock and companion animal bacterial pathogens. J. Antimicrob. Chemother. 2018, 73, 1460–1463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dashti, A.A.; Jadaon, M.M.; Abdulsamad, A.M.; Dashti, H.M. Heat treatment of bacteria: A simple method of DNA extraction for molecular techniques. Kuwait Med. J. 2009, 41, 117–122. [Google Scholar]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; Mcgettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
- Krogh, A.; Larsson, B.; Von Heijne, G.; Sonnhammer, E.L.L. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y. I-TASSER server for protein 3D structure prediction. BMC Bioinform. 2008, 9, 40. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.; Zhang, Y. Improving the physical realism and structural accuracy of protein models by a two-step atomic-level energy minimization. Biophys. J. 2011, 101, 2525–2534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Liang, Y.; Zhang, Y. Atomic-level protein structure refinement using fragment-guided molecular dynamics conformation sampling. Structure 2011, 19, 1784–1795. [Google Scholar] [CrossRef] [Scilit]
- Lovell, S.C.; Davis, I.W.; Adrendall, W.B.; de Bakker, P.I.W.; Word, J.M.; Prisant, M.G.; Richardson, J.S.; Richardson, D.C. Structure validation by Calpha geometry: Phi,psi and Cbeta deviation. Proteins-Struct. Funct. Genet. 2003, 50, 437–450. [Google Scholar] [CrossRef] [Scilit]
- Irwin, J.J.; Shoichet, B.K. ZINC—A free database of commercially available compounds for virtual screening. J. Chem. Inf. Model. 2005, 45, 177–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deshpande, N.; Addess, K.J.; Bluhm, W.F.; Merino-Ott, J.C.; Townsend-Merino, W.; Zhang, Q.; Knezevich, C.; Xie, L.; Chen, L.; Feng, Z.; et al. The RCSB Protein Databa Bank: A redesigned query system and relational database based on the mmCIF schema. Nucleic Acids Res. 2005, 33, 233–237. [Google Scholar] [CrossRef] [Scilit]
- Dallakyan, S.; Olson, A.J. Small-molecule library screening by docking with PyRx. In Chemical Biology; Humana Press: New York, NY, USA, 2014; pp. 243–250. ISBN 978-1-4939-2268-0. [Google Scholar]
- Temml, V.; Kaserer, T.; Kutil, Z.; Landa, P.; Vanek, T.; Schuster, D. Pharmacophore modeling for COX-1 and-2 inhibitors with LigandScout in comparison to Discovery Studio. Future Med. Chem. 2014, 6, 1869–1881. [Google Scholar] [CrossRef] [Scilit]
- Barlaam, A.; Parisi, A.; Spinelli, E.; Caruso, M.; Di Taranto, P.; Normanno, G. Global emergence of colistin-resistant Escherichia coli in food chains and associated food safety implications: A review. J. Food Prot. 2019, 82, 1440–1448. [Google Scholar] [CrossRef] [Scilit]
- Bythwood, T.N.; Soni, V.; Lyons, K.; Hurley-Bacon, A.; Lee, M.D.; Hofacre, C.; Sanchez, S.; Maurer, J.J. Antimicrobial Resistant Salmonella enterica Typhimurium Colonizing Chickens: The Impact of Plasmids, Genotype, Bacterial Communities, and Antibiotic Administration on Resistance. Front. Sustain. Food Syst. 2019, 3, 20. [Google Scholar] [CrossRef] [Scilit]
- World Organisation for Animal Health. Terrestrial Animal Health Code. In Prevention, Detection, and Control of Salmonella in Poultry; World Organisation for Animal Health: Paris, France, 2019; Chapter 6.6; pp. 287–291. Available online: https://rr-europe.oie.int/wp-content/uploads/2020/08/oie-terrestrial-code-1_2019_en.pdf (accessed on 2 January 2021).
- Clifford, K.; Desai, D.; da Costa, C.P.; Meyer, H.; Klohe, K.; Winkler, A.; Rahman, T.; Islam, T.; Zaman, M.H. Antimicrobial resistance in livestock and poor quality veterinary medicines. Bull. World Health Organ. 2018, 96, 662–664. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, I.; Rabbi, M.B.; Sultana, S. Antibiotic resistance in Bangladesh: A systematic review. Int. J. Infect. Dis. 2019, 80, 54–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Islam, K.B.M.S.; Shiraj-um-mahmuda, S. Antibiotic Usage Patterns in Selected Broiler Farms of Bangladesh and their Public Health Implications. J. Public Health Dev. Ctries 2016, 2, 276–284. [Google Scholar]
- Wasyl, D.; Kern-Zdanowicz, I.; Domańska-Blicharz, K.; Zajac, M.; Hoszowski, A. High-level fluoroquinolone resistant Salmonella enterica serovar Kentucky ST198 epidemic clone with IncA/C conjugative plasmid carrying blaCTX-M-25 gene. Vet. Microbiol. 2015, 175, 85–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iwamoto, M.; Reynolds, J.; Karp, B.E.; Tate, H.; Fedorka-Cray, P.J.; Plumblee, J.R.; Hoekstra, R.M.; Whichard, J.M.; Mahon, B.E. Ceftriaxone-resistant nontyphoidal salmonella from humans, retail meats, and food animals in the United States, 1996–2013. Foodborne Pathog. Dis. 2017, 14, 74–83. [Google Scholar] [CrossRef] [Scilit]
- Tribble, D.R. Resistant pathogens as causes of traveller’s diarrhea globally and impact(s) on treatment failure and recommendations. J. Travel Med. 2017, 24, S6–S12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chantziaras, I.; Boyen, F.; Callens, B.; Dewulf, J. Correlation between veterinary antimicrobial use and antimicrobial resistance in food-producing animals: A report on seven countries. J. Antimicrob. Chemother. 2014, 69, 827–834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Havelaar, A.H.; Kirk, M.D.; Torgerson, P.R.; Gibb, H.J.; Hald, T.; Lake, R.J.; Praet, N.; Bellinger, D.C.; de Silva, N.R.; Gargouri, N.; et al. World Health Organization Global Estimates and Regional Comparisons of the Burden of Foodborne Disease in 2010. PLoS Med. 2015, 12, e1001923. [Google Scholar] [CrossRef] [Scilit]
- Fitzgerald, S.F.; Beckett, A.E.; Palarea-Albaladejo, J.; McAteer, S.; Shaaban, S.; Morgan, J.; Ahmad, N.I.; Young, R.; Mabbott, N.A.; Morrison, L.; et al. Shiga toxin sub-type 2a increases the efficiency of Escherichia coli O157 transmission between animals and restricts epithelial regeneration in bovine enteroids. PLoS Pathog. 2019, 15, e1008003. [Google Scholar] [CrossRef] [Scilit]
- Abd El-Mongy, M.; Abd-El-Moneam, G.M.; Moawad, A.A.; Mohammed, A.B.A. Serotyping and virulence genes detection in Escherichia coli isolated from broiler chickens. J. Biol. Sci. 2017, 18, 46–50. [Google Scholar] [CrossRef] [Scilit]
- Sary, K.; Fairbrother, J.M.; Arsenault, J.; De Lagarde, M.; Boulianne, M. Antimicrobial Resistance and Virulence Gene Profiles among Escherichia coli Isolates from Retail Chicken Carcasses in Vietnam. Foodborne Pathog. Dis. 2019, 16, 298–306. [Google Scholar] [CrossRef] [Scilit]
- Parvej, M.S.; Rahman, M.; Uddin, M.F.; Nazir, K.N.H.; Jowel, M.S.; Khan, M.F.R.; Rahman, M.B. Isolation and Characterization of Salmonella enterica serovar Typhimurium Circulating Among Healthy Chickens of Bangladesh. Turk. J. Agric. Food Sci. Technol. 2016, 4, 519. [Google Scholar] [CrossRef] [Scilit]
- Rahaman, M.T.; Rahman, M.; Rahman, M.B.; Khan, M.F.R.; Hossen, M.L.; Parvej, M.S.; Ahmed, S. Poultry Salmonella Specific Bacteriophage Isolation and Characterization. Bangladesh J. Vet. Med. 2014, 12, 107–114. [Google Scholar] [CrossRef] [Scilit]
- Kamal Niaz, F. Emerging Issue of Escherichia coli Resistance: A Threat to Public Health. Health Sci. J. 2016, 10, e14. [Google Scholar]
- Zhang, L.; Fu, Y.; Xiong, Z.; Ma, Y.; Wei, Y.; Qu, X.; Zhang, H.; Zhang, J.; Liao, M. Highly prevalent multidrug-resistant Salmonella from chicken and pork meat at retail markets in Guangdong, China. Front. Microbiol. 2018, 9, 2104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jahantigh, M.; Samadi, K.; Dizaji, R.E.; Salari, S. Antimicrobial resistance and prevalence of tetracycline resistance genes in Escherichia coli isolated from lesions of colibacillosis in broiler chickens in Sistan, Iran. BMC Vet. Res. 2020, 16, 267. [Google Scholar] [CrossRef] [Scilit]
- Sinwat, N.; Angkittitrakul, S.; Chuanchuen, R. Characterization of Antimicrobial Resistance in Salmonella enterica Isolated from Pork, Chicken Meat, and Humans in Northeastern Thailand. Foodborne Pathog. Dis. 2015, 12, 759–765. [Google Scholar] [CrossRef] [Scilit]
- Pormohammad, A.; Nasiri, M.J.; Azimi, T. Prevalence of antibiotic resistance in escherichia coli strains simultaneously isolated from humans, animals, food, and the environment: A systematic review and meta-analysis. Infect. Drug Resist. 2019, 12, 1181–1197. [Google Scholar] [CrossRef] [Scilit]
- Asif, M.; Rahman, H.; Qasim, M.; Khan, T.A.; Ullah, W.; Jie, Y. Molecular detection and antimicrobial resistance profile of zoonotic Salmonella enteritidis isolated from broiler chickens in Kohat, Pakistan. J. Chin. Med. Assoc. 2017, 80, 303–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarker, M.S.; Mannan, M.S.; Ali, M.Y.; Bayzid, M.; Ahad, A.; Bupasha, Z.B. Antibiotic resistance of Escherichia coli isolated from broilers sold at live bird markets in Chattogram, Bangladesh. J. Adv. Vet. Anim. Res. 2019, 6, 272–277. [Google Scholar] [CrossRef] [Scilit]
- Amin, M.B.; Sraboni, A.S.; Hossain, M.I.; Roy, S.; Mozmader, T.A.U.; Unicomb, L.; Rousham, E.K.; Islam, M.A. Occurrence and genetic characteristics of mcr-1-positive colistin-resistant E. coli from poultry environments in Bangladesh. J. Glob. Antimicrob. Resist. 2020, 22, 546–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al Azad, M.A.R.; Rahman, M.M.; Amin, R.; Begum, M.I.A.; Fries, R.; Husna, A.; Khairalla, A.S.; Badruzzaman, A.T.M.; El Zowalaty, M.E.; Lampang, K.N.; et al. Susceptibility and multidrug resistance patterns of Escherichia coli isolated from cloacal swabs of live broiler chickens in Bangladesh. Pathogens 2019, 8, 118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maciuca, I.E.; Cummins, M.L.; Cozma, A.P.; Rimbu, C.M.; Guguianu, E.; Panzaru, C.; Licker, M.; Szekely, E.; Flonta, M.; Djordjevic, S.P.; et al. Genetic Features of mcr-1 Mediated Colistin Resistance in CMY-2-Producing Escherichia coli From Romanian Poultry. Front. Microbiol. 2019, 10, 2267. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Tian, G.B.; Zhang, R.; Shen, Y.; Tyrrell, J.M.; Huang, X.; Zhou, H.; Lei, L.; Li, H.Y.; Doi, Y.; et al. Prevalence, risk factors, outcomes, and molecular epidemiology of mcr-1-positive Enterobacteriaceae in patients and healthy adults from China: An epidemiological and clinical study. Lancet Infect. Dis. 2017, 17, 390–399. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Van Dorp, L.; Shaw, L.P.; Bradley, P.; Wang, Q.; Wang, X.; Jin, L.; Zhang, Q.; Liu, Y.; Rieux, A.; et al. The global distribution and spread of the mobilized colistin resistance gene mcr-1. Nat. Commun. 2018, 9, 1179. [Google Scholar] [CrossRef] [Scilit]
- Islam, S.; Urmi, U.L.; Rana, M.; Sultana, F.; Jahan, N.; Hossain, B.; Iqbal, S.; Hossain, M.M.; Mosaddek, A.S.M.; Nahar, S. High abundance of the colistin resistance gene mcr-1 in chicken gut bacteria in Bangladesh. Sci. Rep. 2020, 10, 17292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schrauwen, E.J.A.; Huizinga, P.; van Spreuwel, N.; Verhulst, C.; Kluytmans-van den Bergh, M.F.Q.; Kluytmans, J.A.J.W. High prevalence of the mcr-1 gene in retail chicken meat in the Netherlands in 2015. Antimicrob. Resist. Infect. Control 2017, 6, 4–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quesada, A.; Ugarte-Ruiz, M.; Iglesias, M.R.; Porrero, M.C.; Martínez, R.; Florez-Cuadrado, D.; Campos, M.J.; García, M.; Píriz, S.; Sáez, J.L.; et al. Detection of plasmid mediated colistin resistance (MCR-1) in Escherichia coli and Salmonella enterica isolated from poultry and swine in Spain. Res. Vet. Sci. 2016, 105, 134–135. [Google Scholar] [CrossRef] [Scilit]
- Shafiq, M.; Huang, J.; Ur Rahman, S.; Shah, J.M.; Chen, L.; Gao, Y.; Wang, M.; Wang, L. High incidence of multidrug-resistant Escherichia coli coharboring mcr-1 and blaCTX-M-15 recovered from pigs. Infect. Drug Resist. 2019, 12, 2135–2149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Liu, J.H. Monitoring Colistin Resistance in Food Animals, An Urgent Threat. Expert Rev. Anti-Infect. Ther. 2018, 16, 443–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, X.; Yu, L.; Chen, X.; Zhi, C.; Yao, X.; Liu, Y.; Wu, S.; Guo, Z.; Yi, L.; Zeng, Z.; et al. High prevalence of colistin resistance and mcr-1 gene in Escherichia coli isolated from food animals in China. Front. Microbiol. 2017, 8, 562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Y.; Wei, W.; Lei, S.; Lin, J.; Srinivas, S.; Feng, Y. An evolutionarily conserved mechanism for intrinsic and transferable polymyxin resistance. mBio 2018, 9, e02317-17. [Google Scholar] [CrossRef] [Scilit]
- Manageiro, V.; Clemente, L.; Romão, R.; Silva, C.; Vieira, L.; Ferreira, E.; Caniça, M. IncX4 plasmid carrying the new mcr-1.9 gene variant in a CTX-M-8-producing Escherichia coli isolate recovered from swine. Front. Microbiol. 2019, 10, 367. [Google Scholar] [CrossRef] [Scilit]
- Fan, J.; Zhang, L.; He, J.; Zhao, M.; Loh, B.; Leptihn, S.; Yu, Y.; Hua, X. Plasmid Dynamics of mcr-1-Positive Salmonella spp. in a General Hospital in China. Front. Microbiol. 2020, 11, 3320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Zhu, B.; Liang, B.; Xu, X.; Qiu, S.; Jia, L.; Li, P.; Yang, L.; Li, Y.; Xiang, Y.; et al. A novel mcr-1 variant carried by an IncI2-type plasmid identified from a multidrug resistant enterotoxigenic Escherichia coli. Front. Microbiol. 2018, 9, 815. [Google Scholar] [CrossRef] [Scilit]






| Target Gene | Pathotype | Primer Name | Primer Sequence (5′-3′) | Amplicon Size (bp) |
|---|---|---|---|---|
| Lambda | Internal Control | LF | CAGATCTCCAGCACGGAACTATTGAGTACGAACG | 1000 |
| LR | GCATAAAATGCGGGGATTCACTGGCTGC | |||
| ipaH | EIEC | Ip-F | GATGCCGTGACAGCATGGTTCC | 718 |
| Ip-R | CAGCCGGTCAGCCACCCTCTG | |||
| Vt1 | EHEC | V1-F | GTCATTCGCCCTGCAATAGGTACTCC | 599 |
| V1-R | AGTCTTGTCCATGATAGTCAGGCAGGAC | |||
| vt2 | EHEC | V2-F | CGGACAGAGATATCGACCCCTCTTGAAC | 481 |
| V2-R | CCTGACGAAATTCTCTCTGTATCTGCCTGAAG | |||
| bfpA | EPEC | Bf-F | CAGAATGCTATTTCAGAAGTAATGAGCGCAAC | 400 |
| Bf-R | CAGTTGCCGCTTCAGCAGGAGTAATAG | |||
| aggR | EAEC | Ag-F | GGTCAAAAGGAATAATTGTAGCTGATGCTGACGAT | 341 |
| Ag-R | GCTGCTTTGCTCATTCTTGATTGCATAAGGATCTGG | |||
| eaeA | EPEC | Ea-F | CCAGGCTTCGTCACAGTTGCAGGC | 291 |
| Ea-R | CGCCACCAATACCTAAACGGGTATTATCACC | |||
| stp | ETEC | Sp-F | CCGTGAAACAACATGACGGGAGGTAACATGAAAAAGC | 234 |
| Sp-R | GCACAGGCAGGATTACAACAAAGTTCACAGCAG | |||
| sth | ETEC | Sh-F | TTCACCTTTCGCTCAGGATGCTAAACCAG | 171 |
| Sh-R | AGCACCCGGTACAAGCAGGATTACAACAC | |||
| lt | ETEC | Lt-F | GCAGGTTTCCCACCGGATCACCAAGC | 127 |
| Lt-R | CAGATTCTGGGTCTCCTCATTACAAGTATCACCTG |
| Target Gene | Primer Name | Primer Sequence | Size (bp) |
|---|---|---|---|
| MCR1 | MCR1-P1F MCR1-P1R | F: CAGTATGGGATTGCGCAATGATT R: TTATCCATCACGCCTTTTGAGTC | 1197 |
| MCR1 | MCR1-P2F MCR1-P2R | F: TGTCGATACCGCCAAATACCAAG R: GGAGTGTGCGGTGGGTTTG | 799 |
| Antimicrobial Agents | Susceptible (S) | Intermediate (I) | Resistance (R) | I + R | |||
|---|---|---|---|---|---|---|---|
| Number of Isolates | % | Number of Isolates | % | Number of Isolates | % | ||
| Penicillins | |||||||
| Ampicillin (AMP, 10 μg) | 79 | 84.04 | 6 | 6.38 | 9 | 9.57 | 15.96 |
| Amoxycillin/clavulanate (AMC, 20/10 µg) | 55 | 58.51 | 27 | 28.72 | 12 | 12.77 | 41.49 |
| Piperacillin/tazobactam (PTZ, 100/10 μg) | 72 | 76.60 | 14 | 14.89 | 8 | 8.51 | 23.40 |
| Aminoglycosides | |||||||
| Amikacin (AMK, 30 μg) | 58 | 61.70 | 19 | 20.21 | 17 | 18.09 | 38.30 |
| Gentamicin (GEN, 10 μg) | 60 | 73.17 | 20 | 26.83 | 14 | 17.07 | 43.90 |
| Cephalosporins | |||||||
| Cefuroxime (CFX, 30 μg) | 53 | 56.38 | 23 | 24.47 | 18 | 19.15 | 43.62 |
| Cefuroxime axetil (CFA, 30 μg) | 59 | 62.77 | 23 | 24.47 | 12 | 12.77 | 37.23 |
| Ceftriaxone (CTR, 30 μg) | 62 | 75.61 | 11 | 11.34 | 24 | 24.74 | 36.08 |
| Cefoperazone/sulbactam (CFS, 75/30 μg) | 53 | 56.38 | 30 | 31.91 | 11 | 11.70 | 43.62 |
| Cefepime (CFP, 30 μg) | 51 | 54.26 | 17 | 18.09 | 26 | 27.66 | 45.74 |
| Carbapenems | |||||||
| Ertapenem (ETP, 10 μg) | 62 | 65.96 | 23 | 24.47 | 9 | 9.57 | 34.04 |
| Imipenem (IMP, 10 μg) | 62 | 65.96 | 20 | 21.28 | 12 | 12.77 | 34.04 |
| Meropenem (MPM, 10 μg) | 63 | 67.02 | 22 | 23.40 | 9 | 9.57 | 32.98 |
| Tetracyclines | |||||||
| Tigecycline (TIG, 15 μg) | 9 | 9.57 | 14 | 14.89 | 71 | 75.53 | 90.43 |
| Quinolones & Fluoroquinolones | |||||||
| Ciprofloxacin (CIP, 5 μg) | 14 | 14.89 | 7 | 7.45 | 73 | 77.66 | 85.11 |
| Enrofloxacin (ENR, 10 μg) | 23 | 24.47 | 4 | 4.26 | 67 | 71.28 | 75.53 |
| Nalidixic acid (NAL, 30 μg) | 15 | 15.96 | 10 | 10.64 | 69 | 73.40 | 84.04 |
| Nitrofurans | |||||||
| Nitrofurantoin (NIT, 300 µg) | 58 | 61.70 | 17 | 18.09 | 19 | 20.21 | 38.30 |
| Polymyxins | |||||||
| Colistin (COL, 10 μg) | 3 | 3.19 | 8 | 8.51 | 83 | 88.30 | 96.81 |
| Folate Pathway Inhibitors | |||||||
| Trimethoprim/Sulfamethoxazole (SXT, 1.25/23.75 µg) | 9 | 9.57 | 13 | 13.83 | 72 | 76.60 | 90.43 |
| E. coli | COL | SXT | CIP | ENR | TIG | AMC | CTR | GEN | AMK | IMP | MPM | NIT | Antibiotic |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Isolate Number | Resistance (n=) | ||||||||||||
| SAUVM E1 | R | R | R | R | R | S | S | R | R | S | R | S | 8 |
| SAUVM E2 | R | R | R | S | S | R | R | R | R | S | S | S | 7 |
| SAUVM E3 | R | R | R | R | R | S | S | S | S | S | S | S | 5 |
| SAUVM E5 | R | R | R | R | R | S | S | S | S | R | R | R | 8 |
| SAUVM E6 | R | S | R | R | R | S | S | S | S | S | S | S | 4 |
| SAUVM E7 | R | R | R | R | R | S | S | S | S | R | R | S | 7 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Uddin, M.B.; Alam, M.N.; Hasan, M.; Hossain, S.M.B.; Debnath, M.; Begum, R.; Samad, M.A.; Hoque, S.F.; Chowdhury, M.S.R.; Rahman, M.M.; et al. Molecular Detection of Colistin Resistance mcr-1 Gene in Multidrug-Resistant Escherichia coli Isolated from Chicken. Antibiotics 2022, 11, 97. https://doi.org/10.3390/antibiotics11010097
Uddin MB, Alam MN, Hasan M, Hossain SMB, Debnath M, Begum R, Samad MA, Hoque SF, Chowdhury MSR, Rahman MM, et al. Molecular Detection of Colistin Resistance mcr-1 Gene in Multidrug-Resistant Escherichia coli Isolated from Chicken. Antibiotics. 2022; 11(1):97. https://doi.org/10.3390/antibiotics11010097
Chicago/Turabian StyleUddin, Md Bashir, Mohammad Nurul Alam, Mahmudul Hasan, S. M. Bayejed Hossain, Mita Debnath, Ruhena Begum, Mohammed A. Samad, Syeda Farjana Hoque, Md. Shahidur Rahman Chowdhury, Md. Mahfujur Rahman, and et al. 2022. "Molecular Detection of Colistin Resistance mcr-1 Gene in Multidrug-Resistant Escherichia coli Isolated from Chicken" Antibiotics 11, no. 1: 97. https://doi.org/10.3390/antibiotics11010097
APA StyleUddin, M. B., Alam, M. N., Hasan, M., Hossain, S. M. B., Debnath, M., Begum, R., Samad, M. A., Hoque, S. F., Chowdhury, M. S. R., Rahman, M. M., Hossain, M. M., Hassan, M. M., Lundkvist, Å., Järhult, J. D., El Zowalaty, M. E., & Ahmed, S. S. U. (2022). Molecular Detection of Colistin Resistance mcr-1 Gene in Multidrug-Resistant Escherichia coli Isolated from Chicken. Antibiotics, 11(1), 97. https://doi.org/10.3390/antibiotics11010097

