Molecular Analysis of Streptomycin Resistance Genes in Clinical Strains of Mycobacterium tuberculosis and Biocomputational Analysis of the MtGidB L101F Variant
Abstract
1. Introduction
2. Results and Discussion
2.1. Molecular Analysis of the M. tuberculosis rpsL, rrs and gidB Genes
2.2. Significance of the Molecular Analysis
2.3. Biocomputational Analysis of the M. tuberculosis GidB L101F Variant
2.3.1. Structural and Functional Analysis
2.3.2. Polymorphic Site Interaction Analysis
2.3.3. Protein Dynamics Analysis
2.4. Significance of the Biocomputational Analysis
3. Materials and Methods
3.1. Sample Collection and Mycobacteriological Analysis
3.2. Molecular Methods
3.2.1. Mycobacterial DNA Extraction
3.2.2. PCR Amplification of Gene Fragments
3.2.3. Analysis and Purification of Amplicons
3.2.4. DNA Sequencing and Data Analysis
3.3. Biocomputational Methods
3.3.1. Sequence-Based Function Predictions
3.3.2. Template-Based Protein Modeling
3.3.3. Structure-Based Stability Predictions
3.3.4. Examination of the Interatomic Contacts
3.3.5. Coarse-Grained Molecular Dynamics Simulations
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mello, F.C.D.Q.; Silva, D.R.; Dalcolmo, M.P. Tuberculosis: Where are we? J. Bras. Pneumol. 2018, 44, 82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Health Organization. Global Tuberculosis Report 2020; WHO: Geneva, Switzerland, 2020; ISBN 9789240013131. [Google Scholar]
- Kurz, S.G.; Furin, J.J.; Bark, C.M. Drug-Resistant Tuberculosis. Infect. Dis. Clin. N. Am. 2016, 30, 509–522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seung, K.J.; Keshavjee, S.; Rich, M.L. Multidrug-Resistant Tuberculosis and Extensively Drug-Resistant Tuberculosis. Cold Spring Harb. Perspect. Med. 2015, 5, a017863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen, T.N.A.; Anton-Leberre, V.; Bañuls, A.-L.; Nguyen, T.V.A. Molecular Diagnosis of Drug-Resistant Tuberculosis; A Literature Review. Front. Microbiol. 2019, 10, 794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seki, M.; Choi, H.J.; Kim, K.; Whang, J.; Sung, J.; Mitarai, S. Tuberculosis: A persistent unpleasant neighbour of humans. J. Infect. Public Health 2021, 14, 508–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trubnikov, A.; Hovhannesyan, A.; Akopyan, K.; Ciobanu, A.; Sadirova, D.; Kalandarova, L.; Parpieva, N.; Gadoev, J. Effectiveness and Safety of a Shorter Treatment Regimen in a Setting with a High Burden of Multidrug-Resistant Tuberculosis. Int. J. Environ. Res. Public. Health 2021, 18, 4121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Health Organization. WHO Consolidated Guidelines on Drug-Resistant Tuberculosis Treatment; WHO: Geneva, Switzerland, 2019. [Google Scholar]
- Kerantzas, C.A.; Jacobs, W.R. Origins of Combination Therapy for Tuberculosis: Lessons for Future Antimicrobial Development and Application. mBio 2017, 8, e01586-16. [Google Scholar] [CrossRef] [Scilit]
- Murray, J.F.; Schraufnagel, D.; Hopewell, P.C. Treatment of Tuberculosis. A Historical Perspective. Ann. Am. Thorac. Soc. 2015, 12, 1749–1759. [Google Scholar] [CrossRef] [Scilit]
- Mase, S.R.; Chorba, T. Treatment of Drug-Resistant Tuberculosis. Clin. Chest Med. 2019, 40, 775–795. [Google Scholar] [CrossRef] [Scilit]
- Castro, E.A.T.; Mendes, M.; Freitas, S.; Roxo, P.C. Incidence and risk factors of major toxicity associated to first-line antituberculosis drugs for latent and active tuberculosis during a period of 10 years. Rev. Port. Pneumol. 2015, 21, 144–150. [Google Scholar] [CrossRef] [Scilit]
- Palomino, J.C.; Martin, A. Drug Resistance Mechanisms in Mycobacterium tuberculosis. Antibiotics 2014, 3, 317–340. [Google Scholar] [CrossRef] [Scilit]
- Nahid, P.; Mase, S.R.; Migliori, G.B.; Sotgiu, G.; Bothamley, G.H.; Brozek, J.L.; Cattamanchi, A.; Cegielski, J.P.; Chen, L.; Daley, C.L.; et al. Treatment of Drug-Resistant Tuberculosis. An Official ATS/CDC/ERS/IDSA Clinical Practice Guideline. Am. J. Respir. Crit. Care Med. 2019, 200, e93–e142. [Google Scholar] [CrossRef] [Scilit]
- Cohen, K.A.; Stott, K.E.; Munsamy, V.; Manson, A.L.; Earl, A.M.; Pym, A.S. Evidence for Expanding the Role of Streptomycin in the Management of Drug-Resistant Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2020, 64, e00860-20. [Google Scholar] [CrossRef] [Scilit]
- Dookie, N.; Rambaran, S.; Padayatchi, N.; Mahomed, S.; Naidoo, K. Evolution of drug resistance in Mycobacterium tuberculosis: A review on the molecular determinants of resistance and implications for personalized care. J. Antimicrob. Chemother. 2018, 73, 1138–1151. [Google Scholar] [CrossRef] [Scilit]
- Musser, J.M. Antimicrobial agent resistance in mycobacteria: Molecular genetic insights. Clin. Microbiol. Rev. 1995, 8, 496–514. [Google Scholar] [CrossRef]
- Arjomandzadegan, M.; Gravand, S. Analysis of rpsL and rrs genes mutations related to streptomycin resistance in Mdr and Xdr clinical isolates of Mycobacterium tuberculosis. Tuberk. Toraks 2015, 63, 235–242. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.-J.; Luo, J.-T.; Wong, S.-Y.; Lee, A.S.G. Analysis of rpsL and rrs mutations in Beijing and non-Beijing streptomycin-resistant Mycobacterium tuberculosis isolates from Singapore. Clin. Microbiol. Infect. 2010, 16, 287–289. [Google Scholar] [CrossRef] [Scilit]
- Jagielski, T.; Ignatowska, H.; Bakula, Z.; Dziewit, Ł.; Napiórkowska, A.; Augustynowicz-Kopeć, E.; Zwolska, Z.; Bielecki, J. Screening for Streptomycin Resistance-Conferring Mutations in Mycobacterium tuberculosis Clinical Isolates from Poland. PLoS ONE 2014, 9, e100078. [Google Scholar] [CrossRef] [Scilit]
- Wong, S.Y.; Lee, J.S.; Kwak, H.K.; Via, L.; Boshoff, H.I.M.; Barry, C.E. Mutations ingidBConfer Low-Level Streptomycin Resistance in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2011, 55, 2515–2522. [Google Scholar] [CrossRef] [Scilit]
- Khosravi, A.D.; Etemad, N.; Hashemzadeh, M.; Dezfuli, S.K.; Goodarzi, H. Frequency of rrs and rpsL mutations in streptomycin-resistant Mycobacterium tuberculosis isolates from Iranian patients. J. Glob. Antimicrob. Resist. 2017, 9, 51–56. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.; Zhang, C.; Xiang, L.; Pi, R.; Guo, Z.; Zheng, C.; Li, S.; Zhao, Y.; Tang, K.; Luo, M.; et al. Characterization of mutations in streptomycin-resistant Mycobacterium tuberculosis isolates in Sichuan, China and the association between Beijing-lineage and dual-mutation in gidB. Tuberculosis 2016, 96, 102–106. [Google Scholar] [CrossRef] [Scilit]
- Spies, F.S.; Ribeiro, A.W.; Ramos, D.; Ribeiro, M.O.; Martin, A.; Palomino, J.C.; Rossetti, M.L.R.; Da Silva, P.E.A.; Zaha, A. Streptomycin Resistance and Lineage-Specific Polymorphisms in Mycobacterium tuberculosis gidB Gene. J. Clin. Microbiol. 2011, 49, 2625–2630. [Google Scholar] [CrossRef] [Scilit]
- Verma, J.S.; Gupta, Y.; Nair, D.; Manzoor, N.; Rautela, R.S.; Rai, A.; Katoch, V.M. Evaluation of gidB alterations responsible for streptomycin resistance in Mycobacterium tuberculosis. J. Antimicrob. Chemother. 2014, 69, 2935–2941. [Google Scholar] [CrossRef] [Scilit]
- Okamoto, S.; Tamaru, A.; Nakajima, C.; Nishimura, K.; Tanaka, Y.; Tokuyama, S.; Suzuki, Y.; Ochi, K. Loss of a conserved 7-methylguanosine modification in 16S rRNA confers low-level streptomycin resistance in bacteria. Mol. Microbiol. 2007, 63, 1096–1106. [Google Scholar] [CrossRef] [Scilit]
- Wong, S.Y.; Javid, B.; Addepalli, B.; Piszczek, G.; Strader, M.B.; Limbach, P.A.; Barry, C.E. Functional Role of Methylation of G518 of the 16S rRNA 530 Loop by GidB in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2013, 57, 6311–6318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tudó, G.; Rey, E.; Borrell, S.; Alcaide, F.; Codina, G.; Coll, P.; Martín-Casabona, N.; Montemayor, M.; Moure, R.; Orcau, À.; et al. Characterization of mutations in streptomycin-resistant Mycobacterium tuberculosis clinical isolates in the area of Barcelona. J. Antimicrob. Chemother. 2010, 65, 2341–2346. [Google Scholar] [CrossRef] [Scilit]
- Smittipat, N.; Juthayothin, T.; Billamas, P.; Jaitrong, S.; Rukseree, K.; Dokladda, K.; Chaiyasirinroje, B.; Disratthakit, A.; Chaiprasert, A.; Mahasirimongkol, S.; et al. Mutations in rrs, rpsL and gidB in streptomycin-resistant Mycobacterium tuberculosis isolates from Thailand. J. Glob. Antimicrob. Resist. 2016, 4, 5–10. [Google Scholar] [CrossRef] [Scilit]
- Klopper, M.; Heupink, T.H.; Hill-Cawthorne, G.; Streicher, E.M.; Dippenaar, A.; De Vos, M.; Abdallah, A.M.; Limberis, J.; Merker, M.; Burns, S.; et al. A landscape of genomic alterations at the root of a near-untreatable tuberculosis epidemic. BMC Med. 2020, 18, 24. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Li, Q.; Gao, H.; Zhang, Z.; Liu, Y.; Lu, J.; Dai, E. The roles of rpsL, rrs, and gidB mutations in predicting streptomycin-resistant drugs used on clinical Mycobacterium tuberculosis isolates from Hebei Province, China. Int. J. Clin. Exp. Pathol. 2019, 12, 2713–2721. [Google Scholar]
- Perdigão, J.; Macedo, R.; Machado, D.; Silva, C.; Jordao, L.; Couto, I.; Viveiros, M.; Portugal, I. GidB mutation as a phylogenetic marker for Q1 cluster Mycobacterium tuberculosis isolates and intermediate-level streptomycin resistance determinant in Lisbon, Portugal. Clin. Microbiol. Infect. 2014, 20, O278–O284. [Google Scholar] [CrossRef] [Scilit]
- Sharma, P.; Kumar, B.; Singhal, N.; Katoch, V.M.; Venkatesan, K.; Chauhan, D.S.; Bisht, D. Streptomycin induced protein expression analysis in Mycobacterium tuberculosis by two-dimensional gel electrophoresis & mass spectrometry. Indian J. Med. Res. 2010, 132, 400–408. [Google Scholar] [PubMed]
- Sharma, P.; Kumar, B.; Gupta, Y.; Singhal, N.; Katoch, V.M.; Venkatesan, K.; Bisht, D. Proteomic analysis of streptomycin resistant and sensitive clinical isolates of Mycobacterium tuberculosis. Proteome Sci. 2010, 8, 59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, D.; Bisht, D. Secretory Proteome Analysis of Streptomycin-Resistant Mycobacterium tuberculosis Clinical Isolates. SLAS Discov. Adv. Life Sci. R&D 2017, 22, 1229–1238. [Google Scholar] [CrossRef] [Scilit]
- Martin, J.L. SAM (dependent) I AM: The S-adenosylmethionine-dependent methyltransferase fold. Curr. Opin. Struct. Biol. 2002, 12, 783–793. [Google Scholar] [CrossRef] [Scilit]
- Schubert, H.L.; Blumenthal, R.M.; Cheng, X. Many paths to methyltransfer: A chronicle of convergence. Trends Biochem. Sci. 2003, 28, 329–335. [Google Scholar] [CrossRef] [Scilit]
- Capriotti, E.; Fariselli, P.; Rossi, I.; Casadio, R. A three-state prediction of single point mutations on protein stability changes. BMC Bioinform. 2008, 9, S6. [Google Scholar] [CrossRef] [Scilit]
- Hollingsworth, S.A.; Dror, R.O. Molecular Dynamics Simulation for All. Neuron 2018, 99, 1129–1143. [Google Scholar] [CrossRef] [Scilit]
- Kmiecik, S.; Kouza, M.; Badaczewska-Dawid, A.E.; Kloczkowski, A.; Kolinski, A. Modeling of Protein Structural Flexibility and Large-Scale Dynamics: Coarse-Grained Simulations and Elastic Network Models. Int. J. Mol. Sci. 2018, 19, 3496. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; López, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [Scilit]
- Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef] [Scilit]
- Adzhubei, I.A.; Schmidt, S.; Peshkin, L.; Ramensky, V.E.; Gerasimova, A.; Bork, P.; Kondrashov, A.S.; Sunyaev, S.R. A meth-od and server for predicting damaging missense mutations. Nat. Methods 2010, 7, 248–249. [Google Scholar] [CrossRef] [Scilit]
- Adzhubei, I.; Jordan, D.; Sunyaev, S.R. Predicting Functional Effect of Human Missense Mutations Using PolyPhen-2. Curr. Protoc. Hum. Genet. 2013, 76, 7–20. [Google Scholar] [CrossRef] [Scilit]
- Cloete, R.; Akurugu, W.A.; Werely, C.J.; Van Helden, P.D.; Christoffels, A. Structural and functional effects of nucleotide variation on the human TB drug metabolizing enzyme arylamine N -acetyltransferase 1. J. Mol. Graph. Model. 2017, 75, 330–339. [Google Scholar] [CrossRef] [Scilit]
- Choi, Y.; Sims, G.E.; Murphy, S.; Miller, J.R.; Chan, A.P. Predicting the Functional Effect of Amino Acid Substitutions and Indels. PLoS ONE 2012, 7, e46688. [Google Scholar] [CrossRef] [Scilit]
- Choi, Y.; Chan, A.P. PROVEAN web server: A tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics 2015, 31, 2745–2747. [Google Scholar] [CrossRef] [Scilit]
- Sim, N.-L.; Kumar, P.; Hu, J.; Henikoff, S.; Schneider, G.; Ng, P.C. SIFT web server: Predicting effects of amino acid substitutions on proteins. Nucleic Acids Res. 2012, 40, W452–W457. [Google Scholar] [CrossRef] [Scilit]
- Roy, A.; Kucukural, A.; Zhang, Y. I-TASSER: A unified platform for automated protein structure and function prediction. Nat. Protoc. 2010, 5, 725–738. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Yan, R.; Roy, A.; Xu, D.; Poisson, J.; Zhang, Y. The I-TASSER Suite: Protein structure and function prediction. Nat. Methods 2015, 12, 7–8. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Zhang, Y. I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y. I-TASSER server for protein 3D structure prediction. BMC Bioinform. 2008, 9, 40. [Google Scholar] [CrossRef] [Scilit]
- Roy, A.; Xu, N.; Poisson, J.; Zhang, Y. A Protocol for Computer-Based Protein Structure and Function Prediction. J. Vis. Exp. 2011, 3259, e3259. [Google Scholar] [CrossRef] [Scilit]
- Shuid, A.N.; Kempster, R.; McGuffin, L.J. ReFOLD: A server for the refinement of 3D protein models guided by accurate quality estimates. Nucleic Acids Res. 2017, 45, W422–W428. [Google Scholar] [CrossRef] [Scilit]
- Adiyaman, R.; McGuffin, L.J. ReFOLD3: Refinement of 3D protein models with gradual restraints based on predicted local quality and residue contacts. Nucleic Acids Res. 2021, gkab300. [Google Scholar] [CrossRef] [Scilit]
- McGuffin, L.J.; Aldowsari, F.M.F.; Alharbi, A.S.M.; Adiyaman, R. ModFOLD8: Accurate global and local quality estimates for 3D protein models. Nucleic Acids Res. 2021, gkab321. [Google Scholar] [CrossRef] [Scilit]
- Laskowski, R.; MacArthur, M.W.; Moss, D.S.; Thornton, J. PROCHECK: A program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 1993, 26, 283–291. [Google Scholar] [CrossRef] [Scilit]
- Sippl, M.J. Recognition of errors in three-dimensional structures of proteins. Proteins Struct. Funct. Bioinform. 1993, 17, 355–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wiederstein, M.; Sippl, M.J. ProSA-web: Interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res. 2007, 35, W407–W410. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, H.; Wang, J.; He, L.; Qi, Y.; Zhang, J.Z. DeepDDG: Predicting the Stability Change of Protein Point Mutations Using Neural Networks. J. Chem. Inf. Model. 2019, 59, 1508–1514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pires, D.E.; Ascher, D.; Blundell, T.L. DUET: A server for predicting effects of mutations on protein stability using an integrated computational approach. Nucleic Acids Res. 2014, 42, W314–W319. [Google Scholar] [CrossRef] [Scilit]
- Pires, D.E.V.; Chen, J.; Blundell, T.L.; Ascher, D.B. In silico functional dissection of saturation mutagenesis: Interpreting the relationship between phenotypes and changes in protein stability, interactions and activity. Sci. Rep. 2016, 6, 19848. [Google Scholar] [CrossRef] [Scilit]
- Pires, D.E.V.; Ascher, D.; Blundell, T.L. mCSM: Predicting the effects of mutations in proteins using graph-based signatures. Bioinformatics 2014, 30, 335–342. [Google Scholar] [CrossRef] [Scilit]
- Worth, C.; Preissner, R.; Blundell, T.L. SDM—A server for predicting effects of mutations on protein stability and malfunction. Nucleic Acids Res. 2011, 39, W215–W222. [Google Scholar] [CrossRef] [Scilit]
- Pandurangan, A.P.; Ochoa-Montaño, B.; Ascher, D.B.; Blundell, T.L. SDM: A server for predicting effects of mutations on protein stability. Nucleic Acids Res. 2017, 45, W229–W235. [Google Scholar] [CrossRef] [Scilit]
- Jubb, H.C.; Higueruelo, A.; Ochoa-Montaño, B.; Pitt, W.; Ascher, D.B.; Blundell, T.L. Arpeggio: A Web Server for Calculating and Visualising Interatomic Interactions in Protein Structures. J. Mol. Biol. 2017, 429, 365–371. [Google Scholar] [CrossRef] [Scilit]
- Sobolev, V.; Sorokin, A.; Prilusky, J.; Abola, E.E.; Edelman, M. Automated analysis of interatomic contacts in proteins. Bioinformatics 1999, 15, 327–332. [Google Scholar] [CrossRef] [Scilit]
- Kmiecik, S.; Gront, D.; Kolinski, M.; Wieteska, L.; Badaczewska-Dawid, A.E.; Kolinski, A. Coarse-Grained Protein Models and Their Applications. Chem. Rev. 2016, 116, 7898–7936. [Google Scholar] [CrossRef] [Scilit]
- Voth, G.A. (Ed.) Coarse-Graining of Condensed Phase and Biomolecular Systems; CRC Press: Boca Raton, FL, USA, 2009; ISBN 9781420059557. [Google Scholar]
- Liwo, A.; Baranowski, M.; Czaplewski, C.; Gołaś, E.; He, Y.; Jagieła, D.; Krupa, P.; Maciejczyk, M.; Makowski, M.; Mozolewska, M.A.; et al. A unified coarse-grained model of biological macromolecules based on mean-field multipole–multipole interactions. J. Mol. Model. 2014, 20, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Czaplewski, C.; Karczynska, A.; Sieradzan, A.K.; Liwo, A. UNRES server for physics-based coarse-grained simulations and prediction of protein structure, dynamics and thermodynamics. Nucleic Acids Res. 2018, 46, W304–W309. [Google Scholar] [CrossRef] [Scilit]




| Isolate ID | rpsL | rrs | gidB | Group § |
|---|---|---|---|---|
| 01R | ND | ND | 301c>t (L101F) | II |
| 02R | ND | ND | 236t>c (L79S) | II |
| 03R | ND | 491c>t * | ND | I |
| 04R | ND | ND | ND | I |
| 05R | ND | ND | ND | I |
| 06R | ND | ND | ND | I |
| 07R | ND | ND | ND | I |
| 08R | ND | ND | 37g>c (G13R); 47t>g (L16R) | II |
| 09R | ND | ND | 236t>c (L79S) | II |
| 10R | ND | ND | 301c>t (L101F) | II |
| 11R | ND | ND | 236t>c (L79S) | II |
| Method | Score | Cutoff | Prediction |
|---|---|---|---|
| PolyPhen-2 | 1.00 | ≥0.85 | Probably Damaging |
| PROVEAN | −3.98 | ≤−2.5 | Deleterious |
| SIFT | 0.00 | ≤0.05 | Affect Function |
| Method | ΔΔG (Kcal/mol) | Prediction § | Assumption |
|---|---|---|---|
| DeepDDG | −1.83 | Destabilizing | Destabilizing |
| DUET | −1.75 | Destabilizing | Destabilizing |
| mCSM | −1.48 | Destabilizing | Destabilizing |
| SDM | −1.39 | Destabilizing | Destabilizing |
| Residue | Specific Contacts with L101 | Specific Contacts with F101 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| D (Å) | S (Å2) | HB | Arm | Pho | DC | D (Å) | S (Å2) | HB | Arm | Pho | DC | ||
| 71 | Gly | 4.8 | 4.5 | − | − | − | + | 3.4 | 33.4 | − | − | − | − |
| 72 | Ala | 3.5 | 32.3 | − | − | + | + | 3.2 | 13.9 | − | − | + | − |
| 73 | Gly | 3.8 | 7.9 | − | − | − | + | 3.2 | 26.7 | − | − | − | − |
| 90 | Leu | 3.7 | 31.4 | − | − | + | − | 4.1 | 23.1 | − | − | + | + |
| 92 | Glu | 4.9 | 11 | − | − | + | − | 3.5 | 28.9 | − | − | − | − |
| 97 | Arg | 2.9 | 19.4 | − | − | + | + | 2.9 | 12.6 | − | − | − | + |
| 98 | Thr | 3.5 | 20.6 | − | − | − | + | 3.1 | 31 | − | − | − | − |
| 100 | Phe | 1.3 | 91 | + | − | + | + | 1.4 | 82.5 | + | + | − | + |
| 102 | Arg | 1.4 | 52.5 | + | − | − | + | 1.3 | 52.9 | − | − | − | + |
| 104 | Met | 3.1 | 12.8 | − | − | + | + | 3.3 | 8.2 | − | − | + | − |
| 105 | Val | 2.8 | 40.7 | − | − | + | + | 2.8 | 40.6 | − | − | + | − |
| 114 | Ile | 4.3 | 11.7 | − | − | + | + | 3.9 | 20 | − | − | + | − |
| Gene | Primer § | Sequence (5′→3′) | Application |
|---|---|---|---|
| rpsL | MTRPSLF1 | gatgcctcggatgagacgaatc | PCR amplification |
| MTRPSLR1 | taaacaatgcgctcggccag | PCR amplification | |
| MTRPSLF2 | cgagtttgaggcaagctatg | DNA sequencing | |
| MTRPSLR2 | cccttcaacagaaccttgttcac | DNA sequencing | |
| rrs | MTRRSF1 | agtggggaatattgcacaatgg | PCR amplification |
| MTRRSR1 | gtcctgtgcatgtcaaacccag | PCR amplification | |
| MTRRSF2 | attgcacaatgggcgcaagc | DNA sequencing | |
| MTRRSR2 | ggtaaggttcttcgcgttgc | DNA sequencing | |
| gidB | MTGIDBF1 | cacagacctcacgagccgg | PCR amplification |
| MTGIDBR1 | gccccacggagcactcac | PCR amplification | |
| MTGIDBF2 | ccggcggagtgcgtaatg | DNA sequencing | |
| MTGIDBR2 | gcactcacgccgtccctc | DNA sequencing |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodríguez-García, Á.; Mares-Alejandre, R.E.; Muñoz-Muñoz, P.L.A.; Ruvalcaba-Ruiz, S.; González-Sánchez, R.A.; Bernáldez-Sarabia, J.; Meléndez-López, S.G.; Licea-Navarro, A.F.; Ramos-Ibarra, M.A. Molecular Analysis of Streptomycin Resistance Genes in Clinical Strains of Mycobacterium tuberculosis and Biocomputational Analysis of the MtGidB L101F Variant. Antibiotics 2021, 10, 807. https://doi.org/10.3390/antibiotics10070807
Rodríguez-García Á, Mares-Alejandre RE, Muñoz-Muñoz PLA, Ruvalcaba-Ruiz S, González-Sánchez RA, Bernáldez-Sarabia J, Meléndez-López SG, Licea-Navarro AF, Ramos-Ibarra MA. Molecular Analysis of Streptomycin Resistance Genes in Clinical Strains of Mycobacterium tuberculosis and Biocomputational Analysis of the MtGidB L101F Variant. Antibiotics. 2021; 10(7):807. https://doi.org/10.3390/antibiotics10070807
Chicago/Turabian StyleRodríguez-García, Álvaro, Rosa E. Mares-Alejandre, Patricia L. A. Muñoz-Muñoz, Samuel Ruvalcaba-Ruiz, Ricardo A. González-Sánchez, Johanna Bernáldez-Sarabia, Samuel G. Meléndez-López, Alexei F. Licea-Navarro, and Marco A. Ramos-Ibarra. 2021. "Molecular Analysis of Streptomycin Resistance Genes in Clinical Strains of Mycobacterium tuberculosis and Biocomputational Analysis of the MtGidB L101F Variant" Antibiotics 10, no. 7: 807. https://doi.org/10.3390/antibiotics10070807
APA StyleRodríguez-García, Á., Mares-Alejandre, R. E., Muñoz-Muñoz, P. L. A., Ruvalcaba-Ruiz, S., González-Sánchez, R. A., Bernáldez-Sarabia, J., Meléndez-López, S. G., Licea-Navarro, A. F., & Ramos-Ibarra, M. A. (2021). Molecular Analysis of Streptomycin Resistance Genes in Clinical Strains of Mycobacterium tuberculosis and Biocomputational Analysis of the MtGidB L101F Variant. Antibiotics, 10(7), 807. https://doi.org/10.3390/antibiotics10070807

