Immuno-Dipstick for Colletotrichum gloeosporioides Detection: Towards On-Farm Application
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Preparation, Optimization, and Stability of AuNPs–Antibody Conjugates
2.3. Fabrication of an Immuno-Dipstick
2.4. Pathogen Sample Preparation
2.5. Pathogen DNA Detection at Immuno-Dipstick
2.6. Simplified DNA Extraction on Paper
2.7. Quantitative PCR (qPCR): Evaluation of Simplified DNA Extraction Protocol
3. Results
3.1. Detection of Fungal Pathogens Using Conventional Methods
3.2. Optimization and Stability of AuNPs–Antibody Conjugates
3.3. Detection of C. gloeosporioides DNA at Fabricated Immuno-Dipstick
3.4. Specificity of Fabricated Immuno-Dipstick
3.5. Simplified DNA Extraction Protocol for On-farm Use
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gupta, V.; Pandey, A.; Kumar, P.; Pandey, B.; Gaur, R.; Bajpai, V.; Sharma, N.; Sharma, S. Genetic Characterization of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. by Random Amplified Polymorphic DNA Analysis. Afr. J. Biotechnol. 2010, 9, 4009–4013. [Google Scholar]
- Rampersad, S.N.; Teelucksingh, L.D. Differential Responses of Colletotrichum gloeosporioides and C. truncatum Isolates from Different Hosts to Multiple Fungicides Based on Two Assays. Plant Dis. 2012, 96, 1526–1536. [Google Scholar] [CrossRef] [Scilit]
- Kelly, J.D.; Vallejo, V.A. A Comprehensive Review of the Major Genes Conditioning Resistance to Anthracnose in Common Bean. HortScience 2004, 39, 1196–1207. [Google Scholar] [CrossRef] [Scilit]
- Heydari, A.; Pessarakli, M. A Review on Biological Control of Fungal Plant Pathogens Using Microbial Antagonists. J. Biol. Sci. 2010, 10, 273–290. [Google Scholar] [CrossRef] [Scilit]
- Min, J.-S.; Kim, K.-S.; Kim, S.-W.; Jung, J.-H.; Lamsal, K.; Kim, S.-B.; Jung, M.-Y.; Lee, Y.-S. Effects of Colloidal Silver Nanoparticles on Sclerotium-Forming Phytopathogenic Fungi. Plant Pathol. J. 2009, 25, 376–380. [Google Scholar] [CrossRef] [Scilit]
- Jaiza, F.R.C.; Solange, A.S.; Evelynne, U.L.; Aloisio, F.C.J.; Marcos, V.G.; de Sousa Aguiar, R.W.; Rodrigo, R.F.; dos Santos, G.R. Sanitary Analysis, Transmissibility and Pathogenicity of Fungi Associated with Cashew Nuts. Afr. J. Agric. Res. 2017, 12, 229–236. [Google Scholar] [CrossRef] [Scilit]
- Nakpalo, S.; Kouabenan, A.; Brahima, C.; Sibirina, S.; Mariam, O.G.; Seydou, T.; Mongomake, K.; Daouda, K. Effect of Some Synthetic Fungicides on the in Vitro Growth of Colletotrichum gloeosporioides, Causative Agent of Cashew Tree Anthracnose in Côte d’ivoire. Asian J. Crop Sci. 2017, 9, 149–158. [Google Scholar] [CrossRef] [Scilit]
- de Lima Castro, S.A.; Gonçalves-Vidigal, M.C.; Gilio, T.A.S.; Lacanallo, G.F.; Valentini, G.; da Silva Ramos Martins, V.; Song, Q.; Galván, M.Z.; Hurtado-Gonzales, O.P.; Pastor-Corrales, M.A. Genetics and Mapping of a New Anthracnose Resistance Locus in Andean Common Bean Paloma. BMC Genom. 2017, 18, 306. [Google Scholar] [CrossRef] [Scilit]
- Saxena, A.; Raghuwanshi, R.; Gupta, V.K.; Singh, H.B. Chilli Anthracnose: The Epidemiology and Management. Front. Microbiol. 2016, 7, 1527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martinez-Culebras, P.V.; Querol, A.; Suarez-Fernandez, M.B.; Garcia-Lopez, M.D.; Barrio, E. Phylogenetic Relationships Among Colletotrichum Pathogens of Strawberry and Design of PCR Primers for Their Identification. J Phytopathol 2003, 151, 135–143. [Google Scholar] [CrossRef] [Scilit]
- Pingchai, P.; Cheewangkoon, R.; To-Anun, C. Controlling Anthracnose of Passion Fruit by Antagonistic Yeast. Int. J. Agric. Technol 2017, 13, 205–212. [Google Scholar]
- Freire, F.C.O.; Cardoso, J.E.; dos Santos, A.A.; Viana, F.M.P. Diseases of Cashew Nut Plants (Anacardium occidentale L.) in Brazil. Crop Prot. 2002, 21, 489–494. [Google Scholar] [CrossRef] [Scilit]
- Rivera-Vargas, L.I.; Lugo-Noel, Y.; McGovern, R.J.; Seijo, T.; Davis, M.J. Occurrence and Distribution of Colletotrichum spp. on Mango (Mangifera indica L.) in Puerto Rico and Florida, USA. Plant Pathol. J. 2006, 5, 191–198. [Google Scholar] [CrossRef] [Scilit]
- Arauz, L.F. Mango Anthracnose: Economic Impact and Current Options for Integrated Managaement. Plant Dis. 2000, 84, 600–611. [Google Scholar] [CrossRef] [Scilit]
- Kamle, M. A Species-Specific PCR Based Assay for Rapid Detection of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. and Sacc. J Plant Pathol Microb 2013, 4, 6. [Google Scholar] [CrossRef]
- Katoh, H.; Fukuda, T.; Nishigawa, H.; Natsuaki, T. Rapid Detection of Colletotrichum gloeosporioides in Infected Strawberry Plants Using Loop-Mediated Isothermal Amplification. J. Gen. Plant Pathol. 2016, 82, 190–198. [Google Scholar] [CrossRef] [Scilit]
- Mauk, M.G.; Song, J.; Liu, C.; Bau, H.H. Simple Approaches to Minimally-Instrumented, Microfluidic-Based Point-of-Care Nucleic Acid Amplification Tests. Biosensors 2018, 8, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmad, F.; Hashsham, S.A. Miniaturized Nucleic Acid Amplification Systems for Rapid and Point-of-Care Diagnostics: A Review. Anal. Chim. Acta 2012, 733, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Craw, P.; Balachandran, W. Isothermal Nucleic Acid Amplification Technologies for Point-of-Care Diagnostics: A Critical Review. Lab Chip 2012, 12, 2469–2486. [Google Scholar] [CrossRef] [Scilit]
- Notomi, T. Loop-Mediated Isothermal Amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [Scilit]
- Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-Mediated Isothermal Amplification (LAMP) of Gene Sequences and Simple Visual Detection of Products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef] [Scilit]
- Buchan, B.W.; Ledeboer, N.A. Emerging Technologies for the Clinical Microbiology Laboratory. Clin. Microbiol. Rev. 2014, 27, 783–822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hongwarittorrn, I.; Chaichanawongsaroj, N.; Laiwattanapaisal, W. Semi-Quantitative Visual Detection of Loop Mediated Isothermal Amplification (LAMP)-Generated DNA by Distance-Based Measurement on a Paper Device. Talanta 2017, 175, 135–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ranganathan, V.; Srinivasan, S.; Singh, A.; DeRosa, M.C. An Aptamer-Based Colorimetric Lateral Flow Assay for the Detection of Human Epidermal Growth Factor Receptor 2 (HER2). Anal. Biochem. 2020, 588, 113471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Safenkova, I.V.; Ivanov, A.V.; Slutskaya, E.S.; Samokhvalov, A.V.; Zherdev, A.V.; Dzantiev, B.B. Key Significance of DNA-Target Size in Lateral Flow Assay Coupled with Recombinase Polymerase Amplification. Anal. Chim. Acta 2020, 1102, 109–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mun’delanji, C.V.; Tamiya, E. Nanobiosensors and Nanobioanalyses: A Review. In Nanobiosensors Nanobioanalyses; Springer: Tokyo, Japan, 2015; pp. 3–20. [Google Scholar]
- Vestergaard, M.; Tamiya, E. A Rapid Sample Pretreatment Protocol: Improved Sensitivity in the Detection of a Low-Abundant Serum Biomarker for Prostate Cancer. Anal. Sci. 2007, 23, 1443–1446. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez, M.O.; Covián, L.B.; García, A.C.; Blanco-López, M.C. Silver and Gold Enhancement Methods for Lateral Flow Immunoassays. Talanta 2016, 148, 272–278. [Google Scholar] [CrossRef] [Scilit]
- Yuhi, T.; Nagatani, N.; Endo, T.; Kerman, K.; Takata, M.; Konaka, H.; Namiki, M.; Takamura, Y.; Tamiya, E. Gold Nanoparticle Based Immunochromatography Using a Resin Modified Micropipette Tip for Rapid and Simple Detection of Human Chorionic Gonadotropin Hormone and Prostate-Specific Antigen. Sci. Technol. Adv. Mater. 2006, 7, 276. [Google Scholar] [CrossRef] [Scilit]
- Chiao, D.-J.; Shyu, R.-H.; Hu, C.-S.; Chiang, H.-Y.; Tang, S.-S. Colloidal Gold-Based Immunochromatographic Assay for Detection of Botulinum Neurotoxin Type B. J. Chromatogr. B 2004, 809, 37–41. [Google Scholar] [CrossRef] [Scilit]
- Horisberger, M.; Vauthey, M. Labelling of Colloidal Gold with Protein. Histochemistry 1984, 80, 13–18. [Google Scholar] [CrossRef] [Scilit]
- Sajid, M.; Kawde, A.-N.; Daud, M. Designs, Formats and Applications of Lateral Flow Assay: A Literature Review. J. Saudi Chem. Soc. 2015, 19, 689–705. [Google Scholar] [CrossRef] [Scilit]
- Jauset-Rubio, M.; Svobodová, M.; Mairal, T.; McNeil, C.; Keegan, N.; Saeed, A.; Abbas, M.N.; El-Shahawi, M.S.; Bashammakh, A.S.; Alyoubi, A.O.; et al. Ultrasensitive, Rapid and Inexpensive Detection of DNA Using Paper Based Lateral Flow Assay. Sci. Rep. 2016, 6, 37732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagatani, N.; Yamanaka, K.; Ushijima, H.; Koketsu, R.; Sasaki, T.; Ikuta, K.; Saito, M.; Miyahara, T.; Tamiya, E. Detection of Influenza Virus Using a Lateral Flow Immunoassay for Amplified DNA by a Microfluidic RT-PCR Chip. Analyst 2012, 137, 3422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Cheng, N.; Xu, Y.; Huang, K.; Luo, Y.; Xu, W. Point-of-Care and Visual Detection of P. aeruginosa and Its Toxin Genes by Multiple LAMP and Lateral Flow Nucleic Acid Biosensor. Biosens. Bioelectron. 2016, 81, 317–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kelly, K.L.; Coronado, E.; Zhao, L.L.; Schatz, G.C. The Optical Properties of Metal Nanoparticles: The Influence of Size, Shape, and Dielectric Environment. J. Phys. Chem. B 2003, 107, 668–677. [Google Scholar] [CrossRef] [Scilit]
- Di Pasqua, A.J.; Mishler, R.E.; Ship, Y.-L.; Dabrowiak, J.C.; Asefa, T. Preparation of Antibody-Conjugated Gold Nanoparticles. Mater. Lett. 2009, 63, 1876–1879. [Google Scholar] [CrossRef] [Scilit]
- Soliman, H.; El-Matbouli, M. Loop Mediated Isothermal Amplification Combined with Nucleic Acid Lateral Flow Strip for Diagnosis of Cyprinid Herpes Virus-3. Mol. Cell. Probes 2010, 24, 38–43. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X. Detection and Management of Colletotrichum acutatum Sensu Lato on Strawberry. Ph.D. Thesis, Iowa State University, Ames, IA, USA, 2015; p. 8436143. [Google Scholar]
- Yuhi, T.; Nagatani, N.; Endo, T.; Kerman, K.; Takata, M.; Konaka, H.; Namiki, M.; Takamura, Y.; Tamiya, E. Resin-Based Micropipette Tip for Immunochromatographic Assays in Urine Samples. J. Immunol. Methods 2006, 312, 54–60. [Google Scholar] [CrossRef] [Scilit]
- Jazayeri, M.H.; Amani, H.; Pourfatollah, A.A.; Pazoki-Toroudi, H.; Sedighimoghaddam, B. Various Methods of Gold Nanoparticles (GNPs) Conjugation to Antibodies. Sens. Bio-Sens. Res. 2016, 9, 17–22. [Google Scholar] [CrossRef] [Scilit]
- Dykman, L.A.; Bogatyrev, V.A.; Khlebtsov, B.N.; Khlebtsov, N.G. A Protein Assay Based on Colloidal Gold Conjugates with Trypsin. Anal. Biochem. 2005, 341, 16–21. [Google Scholar] [CrossRef] [Scilit]
- Tripathi, K.; Driskell, J.D. Quantifying Bound and Active Antibodies Conjugated to Gold Nanoparticles: A Comprehensive and Robust Approach To Evaluate Immobilization Chemistry. ACS Omega 2018, 3, 8253–8259. [Google Scholar] [CrossRef] [Scilit]
- El-Sayed, I.H.; Huang, X.; El-Sayed, M.A. Surface Plasmon Resonance Scattering and Absorption of Anti-EGFR Antibody Conjugated Gold Nanoparticles in Cancer Diagnostics: Applications in Oral Cancer. Nano Lett. 2005, 5, 829–834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Byzova, N.A.; Safenkova, I.V.; Slutskaya, E.S.; Zherdev, A.V.; Dzantiev, B.B. Less Is More: A Comparison of Antibody–Gold Nanoparticle Conjugates of Different Ratios. Bioconjugate Chem. 2017, 28, 2737–2746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.; Aaron, J.; Sokolov, K. Directional Conjugation of Antibodies to Nanoparticles for Synthesis of Multiplexed Optical Contrast Agents with Both Delivery and Targeting Moieties. Nat. Protoc. 2008, 3, 314–320. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Wang, S.; Xu, H.; Wang, B.; Yao, C. Role of 5-Aminolevulinic Acid-Conjugated Gold Nanoparticles for Photodynamic Therapy of Cancer. J. Biomed. Opt. 2015, 20, 051043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leuvering, J.H.; Thal, P.; van der Waart, M.; Schuurs, A. Sol Particle Immunoassay (SPIA). J. Immunoass. 1980, 1, 77–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- MacKenzie, S.; Seijo, T.; Legard, D.; Timmer, L.; Peres, N. Selection for Pathogenicity to Strawberry in Populations of Colletotrichum gloeosporioides from Native Plants. Phytopathology 2007, 97, 1130–1140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Cho, K.-S.; Son, A. Ultrasonication as a Rapid and High Yield DNA Extraction Method for Bacterial Gene Quantification by NanoGene Assay. Biotechnol. Bioprocess Eng. 2015, 20, 1133–1140. [Google Scholar] [CrossRef] [Scilit]
- Chi, M.H.; Park, S.Y.; Lee, Y.H. A Quick and Safe Method for Fungal DNA Extraction. Plant Pathol. J. 2009, 25, 108–111. [Google Scholar] [CrossRef] [Scilit]
- Zou, Y.; Mason, M.G.; Wang, Y.; Wee, E.; Turni, C.; Blackall, P.J.; Trau, M.; Botella, J.R. Nucleic Acid Purification from Plants, Animals and Microbes in under 30 Seconds. PLoS Biol 2017, 15, e2003916. [Google Scholar] [CrossRef] [Scilit]
- Mason, M.G.; Botella, J.R. Rapid (30-Second), Equipment-Free Purification of Nucleic Acids Using Easy-to-Make Dipsticks. Nat. Protoc. 2020, 15, 3663–3677. [Google Scholar] [CrossRef] [Scilit]
- Nagatani, N.; Tanaka, R.; Yuhi, T.; Endo, T.; Kerman, K.; Takamura, Y.; Tamiya, E. Gold Nanoparticle-Based Novel Enhancement Method for the Development of Highly Sensitive Immunochromatographic Test Strips. Sci. Technol. Adv. Mater. 2006, 7, 270–275. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, R.; Yuhi, T.; Nagatani, N.; Endo, T.; Kerman, K.; Takamura, Y.; Tamiya, E. A Novel Enhancement Assay for Immunochromatographic Test Strips Using Gold Nanoparticles. Anal. Bioanal. Chem. 2006, 385, 1414–1420. [Google Scholar] [CrossRef] [Scilit]
- Giuffrida, M.C.; Spoto, G. Integration of Isothermal Amplification Methods in Microfluidic Devices: Recent Advances. Biosens. Bioelectron. 2017, 90, 174–186. [Google Scholar] [CrossRef] [Scilit]
- Obara, H.; Tanabe, M.; Kitajima, M.; Kitagawa, Y.; Aikawa, N.; Hori, S.; Hasegawa, N.; Ikeda, Y.; Okamoto, S.; Kobayashi, Y. The Role of a Real-Time PCR Technology for Rapid Detection and Identification of Bacterial and Fungal Pathogens in Whole-Blood Samples. J. Infect. Chemother. 2011, 17, 327–333. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Lowe, S.B.; Gooding, J.J. Brief Review of Monitoring Methods for Loop-Mediated Isothermal Amplification (LAMP). Biosens. Bioelectron. 2014, 61, 491–499. [Google Scholar] [CrossRef] [Scilit]
- Kaneko, H.; Kawana, T.; Fukushima, E.; Suzutani, T. Tolerance of Loop-Mediated Isothermal Amplification to a Culture Medium and Biological Substances. J. Biochem. Biophys. Methods 2007, 70, 499–501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Francois, P.; Tangomo, M.; Hibbs, J.; Bonetti, E.-J.; Boehme, C.C.; Notomi, T.; Perkins, M.D.; Schrenzel, J. Robustness of a Loop-Mediated Isothermal Amplification Reaction for Diagnostic Applications. FEMS Immunol. Med. Microbiol. 2011, 62, 41–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, N.; Mohamed, M.; Yean, C.Y. Development of Multiplex Loop Mediated Isothermal Amplification (m-LAMP) Label-Based Gold Nanoparticles Lateral Flow Dipstick Biosensor for Detection of Pathogenic Leptospira. Anal. Chim. Acta 2016, 903, 142–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Li, H.; Wang, Y.; Zhang, L.; Xu, J.; Ye, C. Loop-Mediated Isothermal Amplification Label-Based Gold Nanoparticles Lateral Flow Biosensor for Detection of Enterococcus Faecalis and Staphylococcus aureus. Front. Microbiol. 2017, 8, 192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mamba, T.S.; Mbae, C.K.; Kinyua, J.; Mulinge, E.; Mburugu, G.N.; Njiru, Z.K. Lateral Flow Loop-Mediated Isothermal Amplification Test with Stem Primers: Detection of Cryptosporidium Species in Kenyan Children Presenting with Diarrhea. J. Trop. Med. 2018, 2018, 7659730. [Google Scholar] [CrossRef] [Scilit]
- Fu, S.; Jiang, Y.; Jiang, X.; Zhao, Y.; Chen, S.; Yang, X.; Man, C. Probe-Free Label System for Rapid Detection of Cronobacter Genus in Powdered Infant Formula. AMB Expr. 2018, 8, 155. [Google Scholar] [CrossRef] [Scilit]
- Thongphueak, D.; Chansiri, K.; Sriyapai, T.; Areekit, S.; Santiwatanakul, S.; Wangroongsarb, P. Development of the Rapid Test Kit for the Identification of Campylobacter spp. Based on Loop-Mediated Isothermal Amplification (LAMP) in Combination with a Lateral Flow Dipstick (LFD) and Gold Nano-DNA Probe (AuNPs). Sci. Technol. Asia 2019, 24, 63–71. [Google Scholar]
- Rigano, L.A.; Marano, M.R.; Castagnaro, A.P.; Amaral, A.M.D.; Vojnov, A.A. Rapid and Sensitive Detection of Citrus Bacterial Canker by Loop-Mediated Isothermal Amplification Combined with Simple Visual Evaluation Methods. BMC Microbiol. 2010, 10, 176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jun-hai, N.; Yue-rong, G.; Jun-mei, Y.; Qing-yun, L.; Guang-sui, Y.; Cun, W.; Yu, R. Development and Evaluation of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Bacterial Blight Pathogen (Xanthomonas axonopodis pv. dieffenbachiae) in Anthurium. Eur. J. Plant Pathol. 2015, 142, 801–813. [Google Scholar] [CrossRef] [Scilit]
- Ali, M.; Sajid, M.; Khalid, M.A.U.; Kim, S.W.; Lim, J.H.; Huh, D.; Choi, K.H. A Fluorescent Lateral Flow Biosensor for the Quantitative Detection of Vaspin Using Upconverting Nanoparticles. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2020, 226, 117610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, W.; Shin, J.H. Low-Cost, Open-Source 3D Printed Antibody Dispenser for Development and Small-Scale Production of Lateral Flow Assay Strips. HardwareX 2021, 9, e00188. [Google Scholar] [CrossRef] [Scilit]







| Primer Name | Sequence (5′–3′) |
|---|---|
| Cg/f Int1 | GACCCTCCCGGCCTCCCGCC |
| ITS4 | TCCTCCGCTTATTGATATGC |
| ITS2 | GCTGCGTTCTTCATCGATGC |
| ITS1 | TCCGTAGGTGAACCTGCGG |
| FIP | GCCACTACCTTTGAGGGCCTACTTTCAACCCTCAAGCTCTGC |
| BIP | CGGAGCCTCCTTTGCGTAGTAAGGGTTTTACGGCAAGAGTCC |
| F3 | ATGCCTGTTCGAGCGTC |
| B3 | TCCGAGGTCAACCTTTGGAA |
| Cg/f Int1–Biotin | biotin—GACCCTCCCGGCCTCCCGCC |
| ITS4–FITC | FITC—TCCTCCGCTTATTGATATGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oussou-Azo, F.A.; Futagami, T.; Vestergaard, M.C.M. Immuno-Dipstick for Colletotrichum gloeosporioides Detection: Towards On-Farm Application. Biosensors 2022, 12, 49. https://doi.org/10.3390/bios12020049
Oussou-Azo FA, Futagami T, Vestergaard MCM. Immuno-Dipstick for Colletotrichum gloeosporioides Detection: Towards On-Farm Application. Biosensors. 2022; 12(2):49. https://doi.org/10.3390/bios12020049
Chicago/Turabian StyleOussou-Azo, Fifame Auriane, Taiki Futagami, and Mun’delanji Catherine M. Vestergaard. 2022. "Immuno-Dipstick for Colletotrichum gloeosporioides Detection: Towards On-Farm Application" Biosensors 12, no. 2: 49. https://doi.org/10.3390/bios12020049
APA StyleOussou-Azo, F. A., Futagami, T., & Vestergaard, M. C. M. (2022). Immuno-Dipstick for Colletotrichum gloeosporioides Detection: Towards On-Farm Application. Biosensors, 12(2), 49. https://doi.org/10.3390/bios12020049

