In Silico Design of Novel EpCAM-Binding Aptamers for Targeted Delivery of RNA Therapeutics
Abstract
:1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Song, K.M.; Lee, S.; Ban, C. Aptamers and their biological applications. Sensors 2012, 12, 612–631. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Rossi, J. Aptamers as targeted therapeutics: Current potential and challenges. Nat. Rev. Drug Discov. 2017, 16, 181–202. [Google Scholar] [CrossRef] [PubMed]
- Byun, J. Recent Progress and Opportunities for Nucleic Acid Aptamers. Life 2021, 11, 193. [Google Scholar] [CrossRef] [PubMed]
- Keefe, A.D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nat. Rev. Drug Discov. 2010, 9, 537–550. [Google Scholar] [CrossRef] [PubMed]
- Rosenberg, J.E.; Bambury, R.M.; Van Allen, E.M.; Drabkin, H.A.; Lara, P.N., Jr.; Harzstark, A.L.; Wagle, N.; Figlin, R.A.; Smith, G.W.; Garraway, L.A.; et al. A phase II trial of AS1411 (a novel nucleolin-targeted DNA aptamer) in metastatic renal cell carcinoma. Investig. New Drugs 2014, 32, 178–187. [Google Scholar] [CrossRef]
- Chan, M.Y.; Rusconi, C.P.; Alexander, J.H.; Tonkens, R.M.; Harrington, R.A.; Becker, R.C. A randomized, repeat-dose, pharmacodynamic and safety study of an antidote-controlled factor IXa inhibitor. J. Thromb. Haemost. 2008, 6, 789–796. [Google Scholar] [CrossRef]
- Lei, Z.; Maeda, T.; Tamura, A.; Nakamura, T.; Yamazaki, Y.; Shiratori, H.; Yashiro, K.; Tsukita, S.; Hamada, H. EpCAM contributes to formation of functional tight junction in the intestinal epithelium by recruiting claudin proteins. Dev. Biol. 2012, 371, 136–145. [Google Scholar] [CrossRef]
- Ng, V.Y.; Ang, S.N.; Chan, J.X.; Choo, A.B. Characterization of epithelial cell adhesion molecule as a surface marker on undifferentiated human embryonic stem cells. Stem Cells 2010, 28, 29–35. [Google Scholar] [CrossRef]
- de Boer, C.J.; van Krieken, J.H.; Janssen-van Rhijn, C.M.; Litvinov, S.V. Expression of Ep-CAM in normal, regenerating, metaplastic, and neoplastic liver. J. Pathol. 1999, 188, 201–206. [Google Scholar] [CrossRef]
- Brown, T.C.; Sankpal, N.V.; Gillanders, W.E. Functional Implications of the Dynamic Regulation of EpCAM during Epithelial-to-Mesenchymal Transition. Biomolecules 2021, 11, 956. [Google Scholar] [CrossRef]
- Gires, O.; Pan, M.; Schinke, H.; Canis, M.; Baeuerle, P.A. Expression and function of epithelial cell adhesion molecule EpCAM: Where are we after 40 years? Cancer Metastasis Rev. 2020, 39, 969–987. [Google Scholar] [CrossRef] [PubMed]
- Mohtar, M.A.; Syafruddin, S.E.; Nasir, S.N.; Low, T.Y. Revisiting the Roles of Pro-Metastatic EpCAM in Cancer. Biomolecules 2020, 10, 255. [Google Scholar] [CrossRef] [PubMed]
- Sulpice, L.; Rayar, M.; Turlin, B.; Boucher, E.; Bellaud, P.; Desille, M.; Meunier, B.; Clement, B.; Boudjema, K.; Coulouarn, C. Epithelial cell adhesion molecule is a prognosis marker for intrahepatic cholangiocarcinoma. J. Surg. Res. 2014, 192, 117–123. [Google Scholar] [CrossRef] [PubMed]
- Razumilava, N.; Gores, G.J. Cholangiocarcinoma. Lancet 2014, 383, 2168–2179. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Guo, X.; Yang, K.; Yang, Y.; Zhou, W.; Huang, Y.; Liang, X.; Su, J.; Jiang, L.; Li, J.; et al. EpCAM-targeting CAR-T cell immunotherapy is safe and efficacious for epithelial tumors. Sci. Adv. 2023, 9, eadg9721. [Google Scholar] [CrossRef]
- Zhang, C.; Sheng, W.; Al-Rawe, M.; Mohiuddin, T.M.; Niebert, M.; Zeppernick, F.; Meihold-Heerlein, I.; Hussain, A.F. EpCAM- and EGFR-Specific Antibody Drug Conjugates for Triple-Negative Breast Cancer Treatment. Int. J. Mol. Sci. 2022, 23, 6122. [Google Scholar] [CrossRef]
- Gondaliya, P.; Sayyed, A.A.; Yan, I.K.; Driscoll, J.; Ziemer, A.; Patel, T. Targeting PD-L1 in cholangiocarcinoma using nanovesicle-based immunotherapy. Mol. Ther. 2024, 32, 2762–2777. [Google Scholar] [CrossRef]
- Berman, H.M.; Westbrook, J.; Feng, Z.; Gilliland, G.; Bhat, T.N.; Weissig, H.; Shindyalov, I.N.; Bourne, P.E. The Protein Data Bank. Nucleic Acids Res. 2000, 28, 235–242. [Google Scholar] [CrossRef]
- Casaletto, J.B.; Geddie, M.L.; Abu-Yousif, A.O.; Masson, K.; Fulgham, A.; Boudot, A.; Maiwald, T.; Kearns, J.D.; Kohli, N.; Su, S.; et al. MM-131, a bispecific anti-Met/EpCAM mAb, inhibits HGF-dependent and HGF-independent Met signaling through concurrent binding to EpCAM. Proc. Nat. Acad. Sci. USA 2019, 116, 7533–7542. [Google Scholar] [CrossRef]
- Jung, Y.K.; Woo, M.A.; Soh, H.T.; Park, H.G. Aptamer-based cell imaging reagents capable of fluorescence switching. Chem. Commun. 2014, 50, 12329–12332. [Google Scholar] [CrossRef]
- Kim, J.W.; Kim, E.Y.; Kim, S.Y.; Byun, S.K.; Lee, D.; Oh, K.J.; Kim, W.K.; Han, B.S.; Chi, S.W.; Lee, S.C.; et al. Identification of DNA aptamers toward epithelial cell adhesion molecule via cell-SELEX. Mol. Cells 2014, 37, 742–746. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Zhu, Z.; An, Y.; Zhang, W.; Zhang, H.; Liu, D.; Yu, C.; Duan, W.; Yang, C.J. Selection of DNA aptamers against epithelial cell adhesion molecule for cancer cell imaging and circulating tumor cell capture. Anal. Chem. 2013, 85, 4141–4149. [Google Scholar] [CrossRef] [PubMed]
- Lieberman, J.; Zhang, Y. Methods and Compositions for Treating Cancer. U.S. Patent No. US20220340906A1, 27 October 2022. [Google Scholar]
- Wang, J.; Wang, J.; Huang, Y.; Xiao, Y. 3dRNA v2.0: An Updated Web Server for RNA 3D Structure Prediction. Int. J. Mol. Sci. 2019, 20, 4116. [Google Scholar] [CrossRef] [PubMed]
- Trebak, M.; Begg, G.E.; Chong, J.M.; Kanazireva, E.V.; Herlyn, D.; Speicher, D.W. Oligomeric state of the colon carcinoma-associated glycoprotein GA733-2 (Ep-CAM/EGP40) and its role in GA733-mediated homotypic cell-cell adhesion. J. Biol. Chem. 2001, 276, 2299–2309. [Google Scholar] [CrossRef] [PubMed]
- Matsuda, A.; Ishiguro, K.; Yan, I.K.; Patel, T. Extracellular Vesicle-Based Therapeutic Targeting of β-Catenin to Modulate Anticancer Immune Responses in Hepatocellular Cancer. Hepatol. Commun. 2019, 3, 525–541. [Google Scholar] [CrossRef]
- Cardinale, V.; Renzi, A.; Carpino, G.; Torrice, A.; Bragazzi, M.C.; Giuliante, F.; DeRose, A.M.; Fraveto, A.; Onori, P.; Napoletano, C.; et al. Profiles of cancer stem cell subpopulations in cholangiocarcinomas. Am. J. Pathol. 2015, 185, 1724–1739. [Google Scholar] [CrossRef]
- Sarcognato, S.; Sacchi, D.; Fassan, M.; Fabris, L.; Cadamuro, M.; Zanus, G.; Cataldo, I.; Capelli, P.; Baciorri, F.; Cacciatore, M.; et al. Cholangiocarcinoma. Pathologica 2021, 113, 158–169. [Google Scholar] [CrossRef]
- Matsuda, A.; Moirangthem, A.; Angom, R.S.; Ishiguro, K.; Driscoll, J.; Yan, I.K.; Mukhopadhyay, D.; Patel, T. Safety of bovine milk derived extracellular vesicles used for delivery of RNA therapeutics in zebrafish and mice. J. Appl. Toxicol. 2020, 40, 706–718. [Google Scholar] [CrossRef]
- Zhang, G.F.; Qiu, L.; Yang, S.L.; Wu, J.C.; Liu, T.J. Wnt/beta-catenin signaling as an emerging potential key pharmacological target in cholangiocarcinoma. Biosci. Rep. 2020, 40, BSR20193353. [Google Scholar] [CrossRef]
- Zhong, J.; Ding, J.; Deng, L.; Xiang, Y.; Liu, D.; Zhang, Y.; Chen, X.; Yang, Q. Selection of DNA Aptamers Recognizing EpCAM-Positive Prostate Cancer by Cell-SELEX for in vitro and in vivo MR Imaging. Drug Des. Dev. Ther. 2021, 15, 3985–3996. [Google Scholar] [CrossRef]
- Shigdar, S.; Lin, J.; Yu, Y.; Pastuovic, M.; Wei, M.; Duan, W. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci. 2011, 102, 991–998. [Google Scholar] [CrossRef]
- Bell, D.R.; Weber, J.K.; Yin, W.; Huynh, T.; Duan, W.; Zhou, R. In silico design and validation of high-affinity RNA aptamers targeting epithelial cellular adhesion molecule dimers. Proc. Natl. Acad. Sci. USA 2020, 117, 8486–8493. [Google Scholar] [CrossRef] [PubMed]
- Zhuo, Z.; Yu, Y.; Wang, M.; Li, J.; Zhang, Z.; Liu, J.; Wu, X.; Lu, A.; Zhang, G.; Zhang, B. Recent Advances in SELEX Technology and Aptamer Applications in Biomedicine. Int. J. Mol. Sci. 2017, 18, 2142. [Google Scholar] [CrossRef] [PubMed]
- Bavi, R.; Liu, Z.; Han, Z.; Zhang, H.; Gu, Y. In silico designed RNA aptamer against epithelial cell adhesion molecule for cancer cell imaging. Biochem. Biophys. Res. Commun. 2019, 509, 937–942. [Google Scholar] [CrossRef] [PubMed]
- Gilboa-Geffen, A.; Hamar, P.; Le, M.T.; Wheeler, L.A.; Trifonova, R.; Petrocca, F.; Wittrup, A.; Lieberman, J. Gene Knockdown by EpCAM Aptamer-siRNA Chimeras Suppresses Epithelial Breast Cancers and Their Tumor-Initiating Cells. Mol. Cancer Ther. 2015, 14, 2279–2291. [Google Scholar] [CrossRef]
- Zhou, F.; Fu, T.; Huang, Q.; Kuai, H.; Mo, L.; Liu, H.; Wang, Q.; Peng, Y.; Han, D.; Zhao, Z.; et al. Hypoxia-Activated PEGylated Conditional Aptamer/Antibody for Cancer Imaging with Improved Specificity. J. Am. Chem. Soc. 2019, 141, 18421–18427. [Google Scholar] [CrossRef]
- Sterner, R.C.; Sterner, R.M. CAR-T cell therapy: Current limitations and potential strategies. Blood Cancer J. 2021, 11, 69. [Google Scholar] [CrossRef]
- Timofeeva, A.M.; Paramonik, A.P.; Sedykh, S.S.; Nevinsky, G.A. Milk Exosomes: Next-Generation Agents for Delivery of Anticancer Drugs and Therapeutic Nucleic Acids. Int. J. Mol. Sci. 2023, 24, 10194. [Google Scholar] [CrossRef]
- Di Ruscio, A.; de Franciscis, V. Minding the gap: Unlocking the therapeutic potential of aptamers and making up for lost time. Mol. Ther. Nucleic Acids 2022, 29, 384–386. [Google Scholar] [CrossRef]
- Lincoff, A.M.; Mehran, R.; Povsic, T.J.; Zelenkofske, S.L.; Huang, Z.; Armstrong, P.W.; Steg, P.G.; Bode, C.; Cohen, M.G.; Buller, C.; et al. Effect of the REG1 anticoagulation system versus bivalirudin on outcomes after percutaneous coronary intervention (REGULATE-PCI): A randomised clinical trial. Lancet 2016, 387, 349–356. [Google Scholar] [CrossRef]
ID | Sequence 5′—3′ | Sequence Length |
---|---|---|
JYK-01 | 5′-AGCAGCACAGAGGTCAGATGTGAAGGTT CGTTGTTTCGGTGGGTGTAGACTCTTTAGAAGAGATACA GATTTTGGGAATGCCTATGCGTGCTACCGTGAA-3′ [20] | 100 |
Epp166 | 5′CGCGGAAGCGTGCTGGGCCAACAGAGGGACAAACGG GGGAAGATTTGACGTCGACGACACATAACCCAGAGGTC GAT-3′ [21] | 77 |
SYL3C | 5′-AGCGTCGAATACCACTACAGCACTACAGAGGTTGCGT CTGTCCCACGTTGTCATGGGGGGTTGGCCTGAGCGTCGA ATACCACTACAG-3′ [22] | 88 |
Seq ID 63 | 5′-TGCGGCACACACTTCTATCTTTGCGGAACTCC TGCGGCTC-3′ [23] | 40 |
Oligonucleotide ID | Sequence 5′—3′ | Sequence Length |
---|---|---|
PLD01 (DNA) | 5′-Biotin-C * A * C * ACTTCTAAGAGGG * AACAGACGTCGATCTTTGCGGAACT * CCTG * C * G-3′ | 47 |
PLD02 (DNA) | 5′-Biotin-G * A * C * CCACGGAGGTTG * CGTCCGTG* GGGG * A * C-3′ | 29 |
EpDT3 (RNA) | 5′-Biotin-GCGACUGGUUACCCGGUCG-3′ | 19 |
Cy5-PLD01-TEGChol | Cy5-C * A * C * ACTTCTAAGAGGG * AACAGACGTCGATCTTTGCGGAACT * CCTG * C * G- TEG-Cholesterol | 47 |
Cy5-PLD02-TEGChol | Cy5-G * A * C * CCACGGAGGTTG * CGTCCGTG * GG GG * A * C-TEG-Cholesterol | 29 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Driscoll, J.; Gondaliya, P.; Ziemer, A.; Yan, I.K.; Gupta, Y.; Patel, T. In Silico Design of Novel EpCAM-Binding Aptamers for Targeted Delivery of RNA Therapeutics. Nanomaterials 2024, 14, 1727. https://doi.org/10.3390/nano14211727
Driscoll J, Gondaliya P, Ziemer A, Yan IK, Gupta Y, Patel T. In Silico Design of Novel EpCAM-Binding Aptamers for Targeted Delivery of RNA Therapeutics. Nanomaterials. 2024; 14(21):1727. https://doi.org/10.3390/nano14211727
Chicago/Turabian StyleDriscoll, Julia, Piyush Gondaliya, Abbye Ziemer, Irene K. Yan, Yash Gupta, and Tushar Patel. 2024. "In Silico Design of Novel EpCAM-Binding Aptamers for Targeted Delivery of RNA Therapeutics" Nanomaterials 14, no. 21: 1727. https://doi.org/10.3390/nano14211727
APA StyleDriscoll, J., Gondaliya, P., Ziemer, A., Yan, I. K., Gupta, Y., & Patel, T. (2024). In Silico Design of Novel EpCAM-Binding Aptamers for Targeted Delivery of RNA Therapeutics. Nanomaterials, 14(21), 1727. https://doi.org/10.3390/nano14211727