A Three-Dimensional Printed Polycaprolactone–Biphasic-Calcium-Phosphate Scaffold Combined with Adipose-Derived Stem Cells Cultured in Xenogeneic Serum-Free Media for the Treatment of Bone Defects
Abstract
:1. Introduction
2. Materials and Methods
2.1. Scaffold Fabrication
2.2. Scaffold Morphologies and Structural Analysis
2.3. Mechanical Testing
2.4. Subject Enrollment
2.5. Isolating ADSCs from Fat Tissue
- XSF group: The fat issue was stored in XSFM (MesenCult™-XF, STEMCELL Technologies Inc, Vancouver, BC, Canada).
- FBS group: The tissue was stored in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FBS (Gibco, Thermo Fisher Scientific, Waltham, MA, USA).
2.6. Characterizing ADSCs
Flow Cytometry Analysis
2.7. In Vitro Proliferation and Osteogenic Differentiation of ADSCs Seeded on the PCL–BCP TDP Scaffolds
2.7.1. Assessment of Cell Proliferation
2.7.2. Assessment of Cell Differentiation
- XSF–OS group: cultured in xenogeneic serum-free OS medium (MesenCult™ Osteogenic Differentiation Human, STEMCELL Technologies Inc., Vancouver, BC, Canada).
- FBS–OS group: cultured in DMEM OS medium (DMEM supplemented with 10%FBS, 10 mM β-glycerophosphate (Sigma-Aldrich Inc., St. Louis, MO, USA), 10−7 M dexamethasone (Sigma, city, state, USA) and 50 μM ascorbic acid-2 phosphate (Sigma-Aldrich Inc., St. Louis, MO, USA).
- Control group: The osteoblasts (MC3T3-E1 cell line, subclone 4, ATCC, Manassas, VA, USA) were seeded onto the scaffolds using the same ADSC protocol and cultured in the FBS–OS medium.
2.7.3. SEM
2.8. Assessment of Efficacy of the Cell–Scaffold Constructs for Repairing Calvarial Defects in Rat Models
2.8.1. Preparing the Cell–Scaffold Constructs
2.8.2. The Animals
2.8.3. µ-CT Analysis
2.8.4. Histologic Processing and Histological Assessment
2.9. Statistical Analysis
3. Results
3.1. Scaffold Morphologies
3.2. Structural Analysis of the Scaffolds
3.3. Mechanical Properties
3.4. Demographic Data
3.5. Cell Morphologies
3.6. Flow Cytometry Analysis
3.7. Cell Proliferation
3.8. Cell Differentiation
3.9. Morphologies of the Cell–Scaffold Constructs
3.10. Experiment In Vivo
3.10.1. µ-CT Analysis
3.10.2. Histological Assessment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Thuaksuban, N.; Luntheng, T.; Monmaturapoj, N. Physical characteristics and biocompatibility of the polycaprolactone-biphasic calcium phosphate scaffolds fabricated using the modified melt stretching and multilayer deposition. J. Biomater. Appl. 2016, 30, 1460–1472. [Google Scholar] [CrossRef] [PubMed]
- Thuaksuban, N.; Monmaturapoj, N.; Luntheng, T. Effects of polycaprolactone-biphasic calcium phosphate scaffolds on enhancing growth and differentiation of osteoblasts. Biomed. Mater. Eng. 2018, 29, 159–176. [Google Scholar] [CrossRef] [PubMed]
- Thuaksuban, N.; Pannak, R.; Boonyaphiphat, P.; Monmaturapoj, N. In vivo biocompatibility and degradation of novel Polycaprolactone-Biphasic Calcium phosphate scaffolds used as a bone substitute. Biomed. Mater. Eng. 2018, 29, 253–267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wongsupa, N.; Nuntanaranont, T.; Kamolmattayakul, S.; Thuaksuban, N. Assessment of bone regeneration of a tissue-engineered bone complex using human dental pulp stem cells/poly(epsilon-caprolactone)-biphasic calcium phosphate scaffold constructs in rabbit calvarial defects. J. Mater. Sci. Mater. Med. 2017, 28, 77. [Google Scholar] [CrossRef]
- Wongsupa, N.; Nuntanaranont, T.; Kamolmattayakul, S.; Thuaksuban, N. Biological characteristic effects of human dental pulp stem cells on poly-epsilon-caprolactone-biphasic calcium phosphate fabricated scaffolds using modified melt stretching and multilayer deposition. J. Mater. Sci. Mater. Med. 2017, 28, 25. [Google Scholar] [CrossRef]
- Rittipakorn, P.; Thuaksuban, N.; Mai-Ngam, K.; Charoenla, S.; Noppakunmongkolchai, W. Bioactivity of a novel polycaprolactone-hydroxyapatite scaffold used as a carrier of low dose BMP-2: An in vitro study. Polymers 2021, 13, 466. [Google Scholar] [CrossRef]
- Chuenjitkuntaworn, B.; Inrung, W.; Damrongsri, D.; Mekaapiruk, K.; Supaphol, P.; Pavasant, P. Polycaprolactone/hydroxyapatite composite scaffolds: Preparation, characterization, and in vitro and in vivo biological responses of human primary bone cells. J. Biomed. Mater. Res. A 2010, 94, 241–251. [Google Scholar] [CrossRef]
- Darie-Nita, R.N.; Rapa, M.; Frackowiak, S. Special features of polyester-based materials for medical applications. Polymers 2022, 14, 951. [Google Scholar] [CrossRef]
- Elfick, A.P. Poly(epsilon-caprolactone) as a potential material for a temporary joint spacer. Biomaterials 2002, 23, 4463–4467. [Google Scholar] [CrossRef]
- Hutmacher, D.W. Scaffolds in tissue engineering bone and cartilage. Biomaterials 2000, 21, 2529–2543. [Google Scholar] [CrossRef]
- Bose, S.; Tarafder, S. Calcium phosphate ceramic systems in growth factor and drug delivery for bone tissue engineering: A review. Acta Biomater. 2012, 8, 1401–1421. [Google Scholar] [CrossRef] [Green Version]
- De Oliveira Lomelino, R.; Castro-Silva, I.I.; Linhares, A.B.R.; Alves, G.G.; de Albuquerque Santos, S.R.; Gameiro, V.S.; Rossi, A.M.; Granjeiro, J.M. The association of human primary bone cells with biphasic calcium phosphate (betaTCP/HA 70:30) granules increases bone repair. J. Mater. Sci. Mater. Med. 2012, 23, 781–788. [Google Scholar] [CrossRef]
- Chen, W.; Liu, X.; Chen, Q.; Bao, C.; Zhao, L.; Zhu, Z.; Xu, H.H. Angiogenic and osteogenic regeneration in rats via calcium phosphate scaffold and endothelial cell co-culture with human bone marrow mesenchymal stem cells (MSCs), human umbilical cord MSCs, human induced pluripotent stem cell-derived MSCs and human embryonic stem cell-derived MSCs. J. Tissue Eng. Regen. Med. 2018, 12, 191–203. [Google Scholar]
- Diomede, F.; Zini, N.; Gatta, V.; Fulle, S.; Merciaro, I.; D’aurora, M.; La Rovere, R.M.; Traini, T.; Pizzicannella, J.; Ballerini, P.; et al. Human periodontal ligament stem cells cultured onto cortico-cancellous scaffold drive bone regenerative process. Eur. Cell Mater. 2016, 32, 181–201. [Google Scholar] [CrossRef]
- Lendeckel, S.; Jödicke, A.; Christophis, P.; Heidinger, K.; Wolff, J.; Fraser, J.K.; Hedrick, M.H.; Berthold, L.; Howaldt, H.-P. Autologous stem cells (adipose) and fibrin glue used to treat widespread traumatic calvarial defects: Case report. J. Craniomaxillofac. Surg. 2004, 32, 370–373. [Google Scholar] [CrossRef]
- Nuntanaranont, T.; Promboot, T.; Sutapreyasri, S. Effect of expanded bone marrow-derived osteoprogenitor cells seeded into polycaprolactone/tricalcium phosphate scaffolds in new bone regeneration of rabbit mandibular defects. J. Mater. Sci. Mater. Med. 2018, 29, 24. [Google Scholar] [CrossRef]
- Schantz, J.-T.; Hutmacher, D.W.; Lam, C.X.F.; Brinkmann, M.; Wong, K.M.; Lim, T.C.; Chou, N.; Guldberg, R.E.; Teoh, S.H. Repair of calvarial defects with customised tissue-engineered bone grafts II. Evaluation of cellular efficiency and efficacy in vivo. Tissue Eng. 2003, 9 (Suppl. 1), S127–S139. [Google Scholar] [CrossRef]
- Shao, X.X.; Hutmacher, D.W.; Ho, S.T.; Goh, J.C.; Lee, E.H. Evaluation of a hybrid scaffold/cell construct in repair of high-load-bearing osteochondral defects in rabbits. Biomaterials 2006, 27, 1071–1080. [Google Scholar] [CrossRef]
- Zhou, Y.; Chen, F.; Ho, S.T.; Woodruff, M.A.; Lim, T.M.; Hutmacher, D.W. Combined marrow stromal cell-sheet techniques and high-strength biodegradable composite scaffolds for engineered functional bone grafts. Biomaterials 2007, 28, 814–824. [Google Scholar] [CrossRef]
- Farre-Guasch, E.; Marti-Page, C.; Hernadez-Alfaro, F.; Klein-Nulend, J.; Casals, N. Buccal fat pad, an oral access source of human adipose stem cells with potential for osteochondral tissue engineering: An in vitro study. Tissue Eng. Part C Methods 2010, 16, 1083–1094. [Google Scholar] [CrossRef] [Green Version]
- Karantalis, V.; Hare, J.M. Use of mesenchymal stem cells for therapy of cardiac disease. Circ. Res. 2015, 116, 1413–1430. [Google Scholar] [CrossRef]
- Kern, S.; Eichler, H.; Stoeve, J.; Kluter, H.; Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells 2006, 24, 1294–1301. [Google Scholar] [CrossRef]
- Suzuki, E.; Fujita, D.; Takahashi, M.; Oba, S.; Nishimatsu, H. Adipose tissue-derived stem cells as a therapeutic tool for cardiovascular disease. World J. Cardiol. 2015, 7, 454–465. [Google Scholar] [CrossRef]
- Zuk, P.A.; Zhu, M.; Ashjian, P.; De Ugarte, D.A.; Huang, J.I.; Mizuno, H.; Alfonso, Z.C.; Fraser, J.K.; Benhaim, P.; Hedrick, M.H. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell 2002, 13, 4279–4295. [Google Scholar] [CrossRef]
- Broccaioli, E.; Niada, S.; Rasperini, G.; Ferreira, L.M.; Arrigoni, E.; Yenagi, V.; Brini, A.T. Mesenchymal stem cells from Bichat’s fat pad: In vitro comparison with adipose-derived stem cells from subcutaneous tissue. Biores. Open Access 2013, 2, 107–117. [Google Scholar] [CrossRef]
- Niada, S.; Ferreira, L.M.; Arrigoni, E.; Addis, A.; Campagnol, M.; Broccaioli, E.; Brini, A.T. Porcine adipose-derived stem cells from buccal fat pad and subcutaneous adipose tissue for future preclinical studies in oral surgery. Stem Cell Res. Ther. 2013, 4, 148. [Google Scholar] [CrossRef] [Green Version]
- Khojasteh, A.; Sadeghi, N. Application of buccal fat pad-derived stem cells in combination with autogenous iliac bone graft in the treatment of maxillomandibular atrophy: A preliminary human study. Int. J. Oral Maxillofac. Surg. 2016, 45, 864–871. [Google Scholar] [CrossRef]
- Gottipamula, S.; Muttigi, M.S.; Kolkundkar, U.; Seetharam, R.N. Serum-free media for the production of human mesenchymal stromal cells: A review. Cell Prolif. 2013, 46, 608–627. [Google Scholar] [CrossRef]
- Cimino, M.; Goncalves, R.M.; Barrias, C.C.; Martins, M.C.L. Xeno-free strategies for safe human mesenchymal stem/stromal cell expansion: Supplements and coatings. Stem Cells Int. 2017, 2017, 6597815. [Google Scholar] [CrossRef] [Green Version]
- Al-Saqi, S.H.; Saliem, M.; Asikainen, S.; Quezada, H.C.; Ekblad, Å.; Hovatta, O.; Le Blanc, K.; Jonasson, A.F.; Götherström, C. Defined serum-free media for in vitro expansion of adipose-derived mesenchymal stem cells. Cytotherapy 2014, 16, 915–926. [Google Scholar] [CrossRef]
- Chase, L.G.; Lakshmipathy, U.; Solchaga, L.A.; Rao, M.S.; Vemuri, M.C. A novel serum-free medium for the expansion of human mesenchymal stem cells. Stem Cell Res. Ther. 2010, 1, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chase, L.G.; Yang, S.; Zachar, V.; Yang, Z.; Lakshmipathy, U.; Bradford, J.; Boucher, S.E.; Vemuri, M.C. Development and characterization of a clinically compliant xeno-free culture medium in good manufacturing practice for human multipotent mesenchymal stem cells. Stem Cells Transl. Med. 2012, 1, 750–758. [Google Scholar] [CrossRef] [PubMed]
- Julavijitphong, S.; Wichitwiengrat, S.; Tirawanchai, N.; Ruangvutilert, P.; Vantanasiri, C.; Phermthai, T. A xeno-free culture method that enhances Wharton’s jelly mesenchymal stromal cell culture efficiency over traditional animal serum-supplemented cultures. Cytotherapy 2014, 16, 683–691. [Google Scholar] [CrossRef]
- Kandoi, S.; Patra, B.; Vidyasekar, P.; Sivanesan, D.; Verma, R.S. Evaluation of platelet lysate as a substitute for FBS in explant and enzymatic isolation methods of human umbilical cord MSCs. Sci. Rep. 2018, 8, 12439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Simões, I.N.; Boura, J.S.; dos Santos, F.; Andrade, P.Z.; Cardoso, C.M.; Gimble, J.M.; da Silva, C.L.; Cabral, J.M. Human mesenchymal stem cells from the umbilical cord matrix: Successful isolation and ex vivo expansion using serum-/xeno-free culture media. Biotechnol. J. 2013, 8, 448–458. [Google Scholar] [CrossRef] [PubMed]
- Swamynathan, P.; Venugopal, P.; Kannan, S.; Thej, C.; Kolkundar, U.; Bhagwat, S.; Ta, M.; Majumdar, A.S.; Balasubramanian, S. Are serum-free and xeno-free culture conditions ideal for large scale clinical grade expansion of Wharton’s jelly derived mesenchymal stem cells? A comparative study. Stem Cell Res. Ther. 2014, 5, 88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dominici, M.L.B.K.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.C.; Krause, D.S.; Deans, R.J.; Keating, A.; Prockop, D.J.; Horwitz, E.M. Minimal criteria for defining multipotent mesenchymal stromal cells. The international society for cellular therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [PubMed]
- Thuaksuban, N.; Nuntanaranont, T.; Pattanachot, W.; Suttapreyasri, S.; Cheung, L.K. Biodegradable polycaprolactone-chitosan three-dimensional scaffolds fabricated by melt stretching and multilayer deposition for bone tissue engineering: Assessment of the physical properties and cellular response. Biomed. Mater. 2011, 6, 015009. [Google Scholar] [CrossRef]
- Lee, S.H.; Shin, H. Matrices and scaffolds for delivery of bioactive molecules in bone and cartilage tissue engineering. Adv. Drug Deliv. Rev. 2007, 59, 339–359. [Google Scholar] [CrossRef]
- Barradas, A.M.; Yuan, H.; van Blitterswijk, C.A.; Habibovic, P. Osteoinductive biomaterials: Current knowledge of properties, experimental models and biological mechanisms. Eur. Cell Mater. 2011, 21, 407–429. [Google Scholar] [CrossRef]
- Koegler, P.; Clayton, A.; Thissen, H.; Santos, G.N.; Kingshott, P. The influence of nanostructured materials on biointerfacial interactions. Adv. Drug Deliv. Rev. 2012, 64, 1820–1839. [Google Scholar] [CrossRef]
- LeGeros, R.Z. Calcium phosphate-based osteoinductive materials. Chem. Rev. 2008, 108, 4742–4753. [Google Scholar] [CrossRef]
- Wu, X.; Itoh, N.; Taniguchi, T.; Nakanishi, T.; Tanaka, K. Requirement of calcium and phosphate ions in expression of sodium-dependent vitamin C transporter 2 and osteopontin in MC3T3-E1 osteoblastic cells. Biochim. Biophys. Acta 2003, 1641, 65–70. [Google Scholar] [CrossRef] [Green Version]
- Aronowitz, J.A.; Lockhart, R.A.; Hakakian, C.S. Mechanical versus enzymatic isolation of stromal vascular fraction cells from adipose tissue. Springerplus 2015, 4, 713. [Google Scholar] [CrossRef] [Green Version]
- Raposio, E.; Simonacci, F.; Perrotta, R.E. Adipose-derived stem cells: Comparison between two methods of isolation for clinical applications. Ann. Med. Surg. 2017, 20, 87–91. [Google Scholar] [CrossRef]
- Karantalis, V.; Schulman, I.H.; Balkan, W.; Hare, J.M. Allogeneic cell therapy: A new paradigm in therapeutics. Circ. Res. 2015, 116, 12–15. [Google Scholar] [CrossRef]
- Golpanian, S.; Schulman, I.H.; Ebert, R.F.; Heldman, A.W.; DiFede, D.L.; Yang, P.C.; Wu, J.C.; Bolli, R.; Perin, E.C.; Moyé, L.; et al. Concise review: Review and perspective of cell dosage and routes of administration from preclinical and clinical studies of stem cell therapy for heart disease. Stem Cells Transl. Med. 2016, 5, 186–191. [Google Scholar] [CrossRef]
- Aldahmash, A.; Haack-Sorensen, M.; Al-Nbaheen, M.; Harkness, L.; Abdallah, B.M.; Kassem, M. Human serum is as efficient as fetal bovine serum in supporting proliferation and differentiation of human multipotent stromal (mesenchymal) stem cells in vitro and in vivo. Stem Cell Rev. Rep. 2011, 7, 860–868. [Google Scholar] [CrossRef]
- Bieback, K.; Hecker, A.; Kocaömer, A.; Lannert, H.; Schallmoser, K.; Strunk, D.; Klüter, H. Human alternatives to fetal bovine serum for the expansion of mesenchymal stromal cells from bone marrow. Stem Cells 2009, 27, 2331–2341. [Google Scholar] [CrossRef]
- Kocaoemer, A.; Kern, S.; Kluter, H.; Bieback, K. Human AB serum and thrombin-activated platelet-rich plasma are suitable alternatives to fetal calf serum for the expansion of mesenchymal stem cells from adipose tissue. Stem Cells 2007, 25, 1270–1278. [Google Scholar] [CrossRef] [Green Version]
- Tateishi, K.; Ando, W.; Higuchi, C.; Hart, D.A.; Hashimoto, J.; Nakata, K.; Yoshikawa, H.; Nakamura, N. Comparison of human serum with fetal bovine serum for expansion and differentiation of human synovial MSC: Potential feasibility for clinical applications. Cell Transplant. 2008, 17, 549–557. [Google Scholar] [CrossRef] [Green Version]
- Jena, D.; Kharche, S.D.; Singh, S.P.; Rani, S.; Dige, M.S.; Ranjan, R.; Singh, S.K.; Kumar, H. Growth and proliferation of caprine bone marrow mesenchymal stem cells on different culture media. Tissue Cell 2020, 67, 101446. [Google Scholar] [CrossRef]
- Hoang, V.T.; Trinh, Q.-M.; Phuong, D.T.M.; Bui, H.T.H.; Hang, L.M.; Ngan, N.T.H.; Anh, N.T.T.; Nhi, P.Y.; Nhung, T.T.H.; Lien, H.T.; et al. Standardized xeno- and serum-free culture platform enables large-scale expansion of high-quality mesenchymal stem/stromal cells from perinatal and adult tissue sources. Cytotherapy 2021, 23, 88–99. [Google Scholar] [CrossRef]
- Bourin, P.; Bunnell, B.A.; Casteilla, L.; Dominici, M.; Katz, A.J.; March, K.L.; Redl, H.; Rubin, J.P.; Yoshimura, K.; Gimble, J.M. Stromal cells from the adipose tissue-derived stromal vascular fraction and culture expanded adipose tissue-derived stromal/stem cells: A joint statement of the International Federation for Adipose Therapeutics and Science (IFATS) and the International Society for Cellular Therapy (ISCT). Cytotherapy 2013, 15, 641–648. [Google Scholar]
- Billon, N.; Iannarelli, P.; Monteiro, M.C.; Glavieux-Pardanaud, C.; Richardson, W.D.; Kessaris, N.; Dani, C.; Dupin, E. The generation of adipocytes by the neural crest. Development 2007, 134, 2283–2292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- D’Aquino, R.; De Rosa, A.; Laino, G.; Caruso, F.; Guida, L.; Rullo, R.; Checchi, V.; Laino, L.; Tirino, V.; Papaccio, G. Human dental pulp stem cells: From biology to clinical applications. J. Exp. Zool. B Mol. Dev. Evol. 2009, 312, 408–415. [Google Scholar] [CrossRef] [PubMed]
- Lv, F.J.; Tuan, R.S.; Cheung, K.M.; Leung, V.Y. Concise review: The surface markers and identity of human mesenchymal stem cells. Stem. Cells 2014, 32, 1408–1419. [Google Scholar] [CrossRef] [PubMed]
- Navabazam, A.R.; Sadeghian Nodoshan, F.; Sheikhha, M.H.; Miresmaeili, S.M.; Soleimani, M.; Fesahat, F. Characterization of mesenchymal stem cells from human dental pulp, preapical follicle and periodontal ligament. Iran. J. Reprod. Med. 2013, 11, 235–242. [Google Scholar]
- Stevens, A.; Zuliani, T.; Olejnik, C.; LeRoy, H.; Obriot, H.; Kerr-Conte, J.; Formstecher, P.; Bailliez, Y.; Polakowska, R.R. Human dental pulp stem cells differentiate into neural crest-derived melanocytes and have label-retaining and sphere-forming abilities. Stem. Cells Dev. 2008, 17, 1175–1184. [Google Scholar] [CrossRef]
- Cuevas-Diaz Duran, R.; Gonzalez-Garza, M.T.; Cardenas-Lopez, A.; Chavez-Castilla, L.; Cruz-Vega, D.E.; Moreno-Cuevas, J.E. Age-related yield of adipose-derived stem cells bearing the low-affinity nerve growth factor receptor. Stem. Cells Int. 2013, 2013, 372164. [Google Scholar] [CrossRef]
- Quirici, N.; Scavullo, C.; DE Girolamo, L.; Lopa, S.; Arrigoni, E.; Deliliers, G.L.; Brini, A.T. Anti-L-NGFR and -CD34 monoclonal antibodies identify multipotent mesenchymal stem cells in human adipose tissue. Stem. Cells Dev. 2010, 19, 915–925. [Google Scholar] [CrossRef]
- Bui, H.T.H.; Nguyen, L.T.; Than, U.T.T. Influences of xeno-free media on mesenchymal stem cell expansion for clinical application. Tissue Eng. Regen. Med. 2021, 18, 15–23. [Google Scholar] [CrossRef]
- Bobis-Wozowicz, S.; Kmiotek, K.; Kania, K.; Karnas, E.; Labedz-Maslowska, A.; Sekula, M.; Kedracka-Krok, S.; Kolcz, J.; Boruczkowski, D.; Madeja, Z.; et al. Diverse impact of xeno-free conditions on biological and regenerative properties of hUC-MSCs and their extracellular vesicles. J. Mol. Med. 2017, 95, 205–220. [Google Scholar] [CrossRef] [Green Version]
- Brohlin, M.; Kelk, P.; Wiberg, M.; Kingham, P.J. Effects of a defined xeno-free medium on the growth and neurotrophic and angiogenic properties of human adult stem cells. Cytotherapy 2017, 19, 629–639. [Google Scholar] [CrossRef]
- Cimino, M.; Gonçalves, R.M.; Bauman, E.; Barroso-Vilares, M.; Logarinho, E.; Barrias, C.C.; Martins, M.C.L. Optimization of the use of a pharmaceutical grade xeno-free medium for in vitro expansion of human mesenchymal stem/stromal cells. J. Tissue Eng. Regen. Med. 2018, 12, e1785–e1795. [Google Scholar] [CrossRef]
- Gottipamula, S.; Ashwin, K.M.; Muttigi, M.S.; Kannan, S.; Kolkundkar, U.; Seetharam, R.N. Isolation, expansion and characterization of bone marrow-derived mesenchymal stromal cells in serum-free conditions. Cell Tissue Res. 2014, 356, 123–135. [Google Scholar] [CrossRef]


















| Genes | Primer Sequence (5′-3′) | GenBank Accession No. |
|---|---|---|
| Collagen type 1 (Col-1) | R: ACCAGGTTCACCGCTGTTAC | NC_000017.11 |
| F: GTGCTAAAGGTGCCCAATGGT | ||
| Bone sialoprotein (BSP) | R: AGGATAAAAGTAGGCATGCTTG | NC_000004.12 |
| F: ATGGCCTGTGCTTTCTCAATG | ||
| Alkaline phosphatase (ALP) | R: GCGGCAGACTTTGGTTTC | NM_001127501 |
| F: CCACCAGCCCGTGACAGA | ||
| Runt-related transcription factor 2 (RUNX-2) | R: TGCTTTGGTCTTGAAATCACA | NC_10472 |
| F: TCTTAGAACAAATTCTGCCCTTT | ||
| Osteocalcin (OCN) | R: CTTTGTGTCCAAGCAGGAGG | NM_00582.2 |
| F: CTGAAAGCCGATGTGGTCAG | ||
| Bone morphogenetic protein-2 (BMP-2) | R: AAGAGACATGTGAGGATTAGCAGGT | NM_007553 |
| F: GCTTCCGCCTGTTTGTGTTTG | ||
| Osteopontin (OPN) | R: TGTGAGGTGATGTCCTCGTCTGT | NM_00582.2 |
| F: ACACATATTGATGGCCGAAGGTGA | ||
| GAPDH | R: CCACCACCCTGTTGCTGTA | NM_001289745.1 |
| F: GCATCCTGGGCTACACTGA |
| Mechanical Properties | Superior Aspect | Lateral Aspect |
|---|---|---|
| Compressive strength (MPa) | 2.98 ± 0.01 | 2.18 ± 0.09 |
| Strain at maximum load (%) | 36.53 ± 1.8 | 30 |
| Young’s modulus (MPa) | 13.68 ± 1.01 | 34.75 ± 3.52 |
| Maximum load (N) | 300 | 108.7 ± 4.06 |
| Case | Age | Gender | Fat Volume (mL) | Operations |
|---|---|---|---|---|
| 1 | 24 | Male | 5 | BSSRO setback |
| 2 | 21 | Female | 3 | Surgical removal #18 |
| 3 | 23 | Female | 3 | Surgical removal #28 |
| 4 | 36 | Female | 5 | BSSRO advancement |
| 5 | 21 | Male | 4 | BSSRO setback |
| 6 | 26 | Female | 5 | BSSRO setback |
| CD Markers (%) | FBS Group | XSF Group | |
|---|---|---|---|
| MSC markers | CD 73 | 80.12 ± 8.57% | 81.26 ± 7.06% |
| CD 90 | 66.26 ± 8.17% | 67.28 ± 8.04% | |
| CD 105 | 41.58 ± 8.11% * | 2.94 ± 1.29% | |
| Hematopoietic markers | CD14, 19, 34, 45 | 0.16 ± 0.22% | 0.25 ± 0.20% |
| HLA-DR | 0.42 ± 0.14% | 0.28 ± 0.08% | |
| CD271 | 7.54 ± 7.10% | 6.50 ± 3.45% | |
| CD146 | 4.08 ± 2.25% | 4.14 ± 1.94% | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Supphaprasitt, W.; Charoenmuang, L.; Thuaksuban, N.; Sangsuwan, P.; Leepong, N.; Supakanjanakanti, D.; Vongvatcharanon, S.; Suwanrat, T.; Srimanok, W. A Three-Dimensional Printed Polycaprolactone–Biphasic-Calcium-Phosphate Scaffold Combined with Adipose-Derived Stem Cells Cultured in Xenogeneic Serum-Free Media for the Treatment of Bone Defects. J. Funct. Biomater. 2022, 13, 93. https://doi.org/10.3390/jfb13030093
Supphaprasitt W, Charoenmuang L, Thuaksuban N, Sangsuwan P, Leepong N, Supakanjanakanti D, Vongvatcharanon S, Suwanrat T, Srimanok W. A Three-Dimensional Printed Polycaprolactone–Biphasic-Calcium-Phosphate Scaffold Combined with Adipose-Derived Stem Cells Cultured in Xenogeneic Serum-Free Media for the Treatment of Bone Defects. Journal of Functional Biomaterials. 2022; 13(3):93. https://doi.org/10.3390/jfb13030093
Chicago/Turabian StyleSupphaprasitt, Woraporn, Lalita Charoenmuang, Nuttawut Thuaksuban, Prawichaya Sangsuwan, Narit Leepong, Danaiya Supakanjanakanti, Surapong Vongvatcharanon, Trin Suwanrat, and Woraluk Srimanok. 2022. "A Three-Dimensional Printed Polycaprolactone–Biphasic-Calcium-Phosphate Scaffold Combined with Adipose-Derived Stem Cells Cultured in Xenogeneic Serum-Free Media for the Treatment of Bone Defects" Journal of Functional Biomaterials 13, no. 3: 93. https://doi.org/10.3390/jfb13030093
APA StyleSupphaprasitt, W., Charoenmuang, L., Thuaksuban, N., Sangsuwan, P., Leepong, N., Supakanjanakanti, D., Vongvatcharanon, S., Suwanrat, T., & Srimanok, W. (2022). A Three-Dimensional Printed Polycaprolactone–Biphasic-Calcium-Phosphate Scaffold Combined with Adipose-Derived Stem Cells Cultured in Xenogeneic Serum-Free Media for the Treatment of Bone Defects. Journal of Functional Biomaterials, 13(3), 93. https://doi.org/10.3390/jfb13030093

