Anti-Inflammatory and Mineralization Effects of an ASP/PLGA-ASP/ACP/PLLA-PLGA Composite Membrane as a Dental Pulp Capping Agent
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of the ASP/ACP/PLLA Electrospun Membrane
2.2. Preparation of the ASP/PLGA-ASP/ACP/PLLA-PLGA Electrospun Composite Membrane
2.3. Characterization of the Composite Membrane
2.4. In Vitro Degradation Experiments
2.5. In Vitro Release Experiments
2.6. Cell Culture
2.7. Cell Proliferation Assay
2.8. Cell Adhesion and Migration
2.9. Alizarin Red Staining (ARS)
2.10. Quantitative Polymerase Chain Reaction (qPCR)
2.11. Enzyme-Linked Immunosorbent Assay (ELISA)
2.12. Western Blot
2.13. Pulp Capping in the Rat Model
2.14. Statistical Analysis
3. Results
3.1. Characterization of Electrospinning Composite Membranes
3.2. In Vitro Degradation and Release Experiments
3.3. Effects of the Composite Membrane on DPCs Proliferation, Adhesion and Migration
3.4. Effects of Composite Membrane on the Mineralization and Odontogenic Differentiation of iDPCs
3.5. Effects of the Composite Membrane on Inflammatory Cytokine Expression in iDPCs
3.6. Effect of the ASP/PLGA-ASP/ACP/PLLA-PLGA Composite Membrane for Dental-Pulp-Capping In Vivo
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| BSP | Bone Sialoprotein |
| DCM | Dichloromethane |
| DMF | Dimethyl Formamide |
| DMP | Dentin matrix protein |
| DPCs | Dental pulp stem cells |
| DSPP | Dentin sialophosphoprotein |
| EDS | Energy-dispersive spectrometer |
| GIC | Glass-ionomer cement |
| HDPCs | Human dental pulp cells |
| iDPCs | Inflamed dental pulp stem cells |
| IL | Interleukin |
| LPS | Lipopolysaccharide |
| MTA | Mineral trioxide aggregate |
| OCN | Osteocalcin |
| OPN | Osteopontin |
| PBS | Phosphate buffered solution |
| PLGA | Poly (lactic-co-glycolic acid) |
| PLLA | Poly (L-lactic acid) |
| qPCR | Quantitative Polymerase Chain Reaction |
| RNA | Ribonucleic Acid |
| SEM | Scanning electron microscope |
| SHED | Stem cells from human exfoliated deciduous teeth |
| TEM | Transmission electron microscope |
| TNF | Tumor necrosis factor |
| XRD | X-ray diffraction |
| α-MEM | Minimum Essential Medium-Alpha |
References
- Huang, G.T. Dental pulp and dentin tissue engineering and regeneration: Advancement and challenge. Front. Biosci. 2011, 3, 788–800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aguilar, P.; Linsuwanont, P. Vital pulp therapy in vital permanent teeth with cariously exposed pulp: A systematic review. J. Endod. 2011, 37, 581–587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanna, S.N.; Perez Alfayate, R.; Prichard, J. Vital Pulp Therapy an Insight Over the Available Literature and Future Expectations. Eur. Endod. J. 2020, 5, 46–53. [Google Scholar] [PubMed]
- Kunert, M.; Lukomska-Szymanska, M. Bio-Inductive Materials in Direct and Indirect Pulp Capping-A Review Article. Materials 2020, 13, 1204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.H.; Jang, J.H.; Lee, B.N. Bio-Inductive Materials in Direct and Indirect Pulp s of Human and Rat Dental Pulps In Vitro and In Vivo. J. Endod. 2018, 44, 1534–1541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zanini, M.; Meyer, E.; Simon, S. Pulp Inflammation Diagnosis from Clinical to Inflammatory Mediators: A Systematic Review. J. Endod. 2017, 43, 1033–1051. [Google Scholar] [CrossRef] [Scilit]
- Mejàre, I.A.; Axelsson, S.; Davidson, T.; Frisk, F.; Hakeberg, M.; Kvist, T.; Norlund, A.; Petersson, A.; Portenier, I.; Sandberg, H.; et al. Diagnosis of the condition of the dental pulp: A systematic review. Int. Endod. J. 2012, 45, 597–613. [Google Scholar] [CrossRef] [Scilit]
- Parirokh, M.; Torabinejad, M.; Dummer, P. Mineral trioxide aggregate and other bioactive endodontic cements: An updated overview—Part I: Vital pulp therapy. Int. Endod. J. 2017, 51, 177–205. [Google Scholar] [CrossRef] [Scilit]
- da Rosa, W.L.; Cocco, A.R.; Silva, T.M.; Mesquita, L.C.; Galarca, A.D.; Silva, A.F.; Piva, E. Current trends and future perspectives of dental pulp capping materials: A systematic review. J. Biomed. Mater. Res. B Appl. Biomater. 2018, 106, 1358–1368. [Google Scholar] [CrossRef] [Scilit]
- Tziafas, D.; Smith, A.; Lesot, H. Designing new treatment strategies in vital pulp therapy. J. Dent. 1999, 28, 77–92. [Google Scholar] [CrossRef] [Scilit]
- Di Bella, S.; Luzzati, R.; Principe, L. Aspirin and Infection: A Narrative Review. Biomedicines 2022, 10, 263. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Chen, C.; Liu, S.; Liu, D.; Xu, X.; Chen, X.; Shi, S. Acetylsalicylic Acid Treatment Improves Differentiation and Immunomodulation of SHED. J. Dent. Res. 2014, 94, 209–218. [Google Scholar] [CrossRef] [Scilit]
- Bienek, D.R.; Skrtic, D. Utility of Amorphous Calcium Phosphate-Based Scaffolds in Dental/Biomedical Applications. Biointerface Res. Appl. Chem. 2017, 7, 1989–1994. [Google Scholar]
- Niu, X.; Liu, Z.; Tian, F.; Chen, S.; Lei, L.; Jiang, T.; Feng, Q.; Fan, Y. Sustained delivery of calcium and orthophosphate ions from amorphous calcium phosphate and poly(L-lactic acid)-based electrospinning nanofibrous scaffold. Sci. Rep. 2017, 7, srep45655. [Google Scholar] [CrossRef] [Scilit]
- Anderson, J.M.; Shive, M.S. Biodegradation and biocompatibility of PLA and PLGA microspheres. Adv. Drug Deliv. Rev. 1997, 28, 5–24. [Google Scholar] [CrossRef] [Scilit]
- Su, Y.; Zhang, B.; Sun, R.; Liu, W.; Zhu, Q.; Zhang, X.; Wang, R.; Chen, C. PLGA-based biodegradable microspheres in drug delivery: Recent advances in research and application. Drug Deliv. 2021, 28, 1397–1418. [Google Scholar] [CrossRef] [Scilit]
- Vlachopoulos, A.; Karlioti, G.; Balla, E.; Daniilidis, V.; Kalamas, T.; Stefanidou, M.; Bikiaris, N.D.; Christodoulou, E.; Koumentakou, I.; Karavas, E.; et al. Poly(Lactic Acid)-Based Microparticles for Drug Delivery Applications: An Overview of Recent Advances. Pharmaceutics 2022, 14, 359. [Google Scholar] [CrossRef] [Scilit]
- Ding, D.; Zhu, Q. Recent advances of PLGA micro/nanoparticles for the delivery of biomacromolecular therapeutics. Mater. Sci. Eng. C 2018, 92, 1041–1060. [Google Scholar] [CrossRef] [Scilit]
- Martin, F.E.; Nadkarni, M.A.; Jacques, N.A.; Hunter, N. Quantitative Microbiological Study of Human Carious Dentine by Culture and Real-Time PCR: Association of Anaerobes with Histopathological Changes in Chronic Pulpitis. J. Clin. Microbiol. 2002, 40, 1698–1704. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.-I.; Min, K.-S.; Bae, W.-J.; Lee, Y.-M.; Lee, S.-Y.; Lee, E.-S.; Kim, E.-C. Role of SIRT1 in Heat Stress- and Lipopolysaccharide-induced Immune and Defense Gene Expression in Human Dental Pulp Cells. J. Endod. 2011, 37, 1525–1530. [Google Scholar] [CrossRef] [Scilit]
- Barron, M.J.; McDonnell, S.T.; MacKie, I.; Dixon, M.J. Hereditary dentine disorders: Dentinogenesis imperfecta and dentine dysplasia. Orphanet J. Rare Dis. 2008, 3, 31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crawford, P.J.; Aldred, M.; Bloch-Zupan, A. Amelogenesis imperfecta. Orphanet J. Rare Dis. 2007, 2, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minervini, G.; Romano, A.; Petruzzi, M.; Maio, C.; Serpico, R.; Lucchese, A.; Candotto, V.; Di Stasio, D. Telescopic overdenture on natural teeth: Prosthetic rehabilitation on (OFD) syndromic patient and a review on available literature. J. Biol. Regul. Homeost. Agents 2018, 32, 131–134. [Google Scholar] [PubMed]
- Kratunova, E.; Silva, D. Pulp therapy for primary and immature permanent teeth: An overview. Gen. Dent. 2018, 66, 30–38. [Google Scholar] [PubMed]
- Yong, D.; Cathro, P. Conservative pulp therapy in the management of reversible and irreversible pulpitis. Aust. Dent. J. 2021, 66 (Suppl. 1), S1–S14. [Google Scholar] [CrossRef] [Scilit]
- Dammaschke, T.; Leidinger, J.; Schäfer, E. Long-term evaluation of direct pulp capping--treatment outcomes over an average period of 6.1 years. Clin. Oral. Investig. 2010, 14, 559–567. [Google Scholar] [CrossRef] [Scilit]
- Torabinejad, M.; Corr, R.; Handysides, R.; Shabahang, S. Outcomes of nonsurgical retreatment and endodontic surgery: A systematic review. J. Endod. 2009, 35, 930–937. [Google Scholar] [CrossRef] [Scilit]
- Caplan, D.J.; Cai, J.; Yin, G.; White, B.A. Root Canal Filled Versus Non-Root Canal Filled Teeth: A Retrospective Comparison of Survival Times. J. Public Health Dent. 2005, 65, 90–96. [Google Scholar] [CrossRef] [Scilit]
- d’Aquino, R.; Graziano, A.; Sampaolesi, M.; Laino, G.; Pirozzi, G.; De Rosa, A.; Papaccio, G. Human postnatal dental pulp cells co-differentiate into osteoblasts and endotheliocytes: A pivotal synergy leading to adult bone tissue formation. Cell Death Differ. 2007, 14, 1162–1171. [Google Scholar] [CrossRef] [Scilit]
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef] [Scilit]
- Piva, E.; Tarlé, S.A.; Nör, J.E.; Zou, D.; Hatfield, E.; Guinn, T.; Eubanks, E.J.; Kaigler, D. Dental Pulp Tissue Regeneration Using Dental Pulp Stem Cells Isolated and Expanded in Human Serum. J. Endod. 2017, 43, 568–574. [Google Scholar] [CrossRef] [Scilit]
- Farges, J.-C.; Alliot-Licht, B.; Renard, E.; Ducret, M.; Gaudin, A.; Smith, A.J.; Cooper, P.R. Dental Pulp Defence and Repair Mechanisms in Dental Caries. Mediat. Inflamm. 2015, 2015, 230251. [Google Scholar] [CrossRef] [Scilit]
- Huang, H.; Zhao, N.; Xu, X.; Xu, Y.; Li, S.; Zhang, J.; Yang, P. Dose-specific effects of tumor necrosis factor alpha on osteogenic differentiation of mesenchymal stem cells. Cell Prolif. 2011, 44, 420–427. [Google Scholar] [CrossRef] [Scilit]
- Colombo, J.S.; Moore, A.N.; Hartgerink, J.D.; D’Souza, R.N. Scaffolds to Control Inflammation and Facilitate Dental Pulp Regeneration. J. Endod. 2014, 40, S6–S12. [Google Scholar] [CrossRef] [Scilit]
- Kearney, M.; Cooper, P.R.; Smith, A.J.; Duncan, H.F. Epigenetic Approaches to the Treatment of Dental Pulp Inflammation and Repair: Opportunities and Obstacles. Front. Genet. 2018, 9, 311. [Google Scholar] [CrossRef] [Scilit]
- Fujita, T.; Kutsumi, H.; Sanuki, T.; Hayakumo, T.; Azuma, T. Adherence to the preventive strategies for nonsteroidal anti-inflammatory drug- or low-dose aspirin-induced gastrointestinal injuries. J. Gastroenterol. 2013, 48, 559–573. [Google Scholar] [CrossRef] [Scilit]
- Trabert, B.; Ness, R.B.; Lo-Ciganic, W.-H.; Murphy, M.A.; Goode, E.L.; Poole, E.M.; Brinton, L.A.; Webb, P.M.; Nagle, C.M.; Jordan, S.J.; et al. Aspirin, Nonaspirin Nonsteroidal Anti-inflammatory Drug, and Acetaminophen Use and Risk of Invasive Epithelial Ovarian Cancer: A Pooled Analysis in the Ovarian Cancer Association Consortium. JNCI J. Natl. Cancer Inst. 2014, 106, djt431. [Google Scholar] [CrossRef] [Scilit]
- Chokshi, R.; Bennett, O.; Zhelay, T.; Kozak, J.A. NSAIDs Naproxen, Ibuprofen, Salicylate, and Aspirin Inhibit TRPM7 Channels by Cytosolic Acidification. Front. Physiol. 2021, 12, 727549. [Google Scholar] [CrossRef] [Scilit]
- Brox, R.; Hackstein, H. Physiologically relevant aspirin concentrations trigger immunostimulatory cytokine production by human leukocytes. PLoS ONE 2021, 16, e0254606. [Google Scholar] [CrossRef] [Scilit]
- Fattahi, R.; Mohebichamkhorami, F.; Khani, M.M.; Soleimani, M.; Hosseinzadeh, S. Aspirin effect on bone remodeling and skeletal regeneration: Review article. Tissue Cell 2022, 76, 101753. [Google Scholar] [CrossRef] [Scilit]
- Ren, L.; Pan, S.; Li, H.; Li, Y.; He, L.; Zhang, S.; Che, J.; Niu, Y. Effects of aspirin-loaded graphene oxide coating of a titanium surface on proliferation and osteogenic differentiation of MC3T3-E1 cells. Sci. Rep. 2018, 8, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, S.; Yamaza, T.; Akiyama, K. Is aspirin treatment an appropriate intervention to osteoporosis? Future Rheumatol. 2008, 3, 499–502. [Google Scholar] [PubMed]
- Müller, M.; Raabe, O.; Addicks, K.; Wenisch, S.; Arnhold, S. Effects of non-steroidal anti-inflammatory drugs on proliferation, differentiation and migration in equine mesenchymal stem cells. Cell Biol. Int. 2011, 35, 235–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, M.; Zhan, Y.; Hu, W.; Li, Y.; Xie, X.; Miao, N.; Jin, H.; Zhang, B. Aspirin promotes osteogenic differentiation of human dental pulp stem cells. Int. J. Mol. Med. 2018, 42, 1967–1976. [Google Scholar] [CrossRef] [Scilit]
- Rankin, R.; Lundy, F.T.; Schock, B.C. A connectivity mapping approach predicted acetylsalicylic acid (aspirin) to induce osteo/odontogenic differentiation of dental pulp cells. Int. Endod. J. 2020, 53, 834–845. [Google Scholar] [CrossRef] [Scilit]
- Chang, M.C.; Tsai, Y.L.; Chang, H.H. IL-1β-induced MCP-1 expression and secretion of human dental pulp cells is related to TAK1, MEK/ERK, and PI3K/Akt signaling pathways. Arch. Oral. Biol. 2016, 61, 16–22. [Google Scholar] [CrossRef] [Scilit]
- Li, J.Y.; Wang, S.N.; Dong, Y.M. Anti-inflammatory and repaired effects of non-steroidal anti-inflammatory drugs on human dental pulp cells. Beijing Da Xue Xue Bao Yi Xue Ban 2020, 52, 24–29. [Google Scholar]
- Marconi, G.D.; Fonticoli, L.; Guarnieri, S.; Cavalcanti, M.F.X.B.; Franchi, S.; Gatta, V.; Trubiani, O.; Pizzicannella, J.; Diomede, F. Ascorbic Acid: A New Player of Epigenetic Regulation in LPS-gingivalis Treated Human Periodontal Ligament Stem Cells. Oxid. Med. Cell. Longev. 2021, 2021, 6679708. [Google Scholar] [CrossRef] [Scilit]
- Zhu, N.; Chatzistavrou, X.; Ge, L.; Qin, M.; Papagerakis, P.; Wang, Y. Biological properties of modified bioactive glass on dental pulp cells. J. Dent. 2019, 83, 18–26. [Google Scholar] [CrossRef] [Scilit]
- Saga, R.; Matsuya, Y.; Takahashi, R.; Hasegawa, K.; Date, H.; Hosokawa, Y. 4-Methylumbelliferone administration enhances radiosensitivity of human fibrosarcoma by intercellular communication. Sci. Rep. 2021, 11, 8258. [Google Scholar] [CrossRef] [Scilit]
- Bindal, P.; Ramasamy, T.S.; Abu Kasim, N.H.; Gnanasegaran, N.; Chai, W.L. Immune responses of human dental pulp stem cells in lipopolysaccharide-induced microenvironment. Cell Biol. Int. 2018, 42, 832–840. [Google Scholar] [CrossRef] [Scilit]
- Rashid, F.; Shiba, H.; Mizuno, N.; Mouri, Y.; Fujita, T.; Shinohara, H.; Ogawa, T.; Kawaguchi, H.; Kurihara, H. The Effect of Extracellular Calcium Ion on Gene Expression of Bone-related Proteins in Human Pulp Cells. J. Endod. 2003, 29, 104–107. [Google Scholar] [CrossRef] [Scilit]
- Gandolfi, M.G.; Siboni, F.; Primus, C.M.; Prati, C. Ion Release, Porosity, Solubility, and Bioactivity of MTA Plus Tricalcium Silicate. J. Endod. 2014, 40, 1632–1637. [Google Scholar] [CrossRef] [Scilit]
- Niu, X.; Chen, S.; Tian, F.; Wang, L.; Feng, Q.; Fan, Y. Hydrolytic conversion of amorphous calcium phosphate into apatite accompanied by sustained calcium and orthophosphate ions release. Mater. Sci. Eng. C 2017, 70, 1120–1124. [Google Scholar] [CrossRef] [Scilit]
- Bose, S.; Tarafder, S. Calcium phosphate ceramic systems in growth factor and drug delivery for bone tissue engineering: A review. Acta Biomater. 2012, 8, 1401–1421. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Wang, J.; Chen, Y. Roles of calcium phosphate-mediated integrin expression and MAPK signaling pathways in the osteoblastic differentiation of mesenchymal stem cells. J. Mater. Chem. B 2016, 4, 2280–2289. [Google Scholar] [CrossRef] [Scilit]
- Petta, T.M.; Pedroni, A.C.F.; Saavedra, D.F.; Faial, K.D.C.F.; Marques, M.M.; Couto, R.S.D. The effect of three different pulp capping cements on mineralization of dental pulp stem cells. Dent. Mater. J. 2020, 39, 222–228. [Google Scholar] [CrossRef] [Scilit]
- Gröninger, O.; Hess, S.; Mohn, D. Directing Stem Cell Commitment by Amorphous Calcium Phosphate Nanoparticles Incorporated in PLGA: Relevance of the Free Calcium Ion Concentration. Int. J. Mol. Sci. 2020, 21, 2627. [Google Scholar] [CrossRef] [Scilit]
- Im, S.H.; Im, D.H.; Park, S.J.; Chung, J.J.; Jung, Y.; Kim, S.H. Stereocomplex Polylactide for Drug Delivery and Biomedical Applications: A Review. Molecules 2021, 26, 2846. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Hu, J.; Ma, P.X. Nanofiber-based delivery of bioactive agents and stem cells to bone sites. Adv. Drug Deliv. Rev. 2012, 64, 1129–1141. [Google Scholar] [CrossRef] [Scilit]
- Mathieu, S.; Jeanneau, C.; Sheibat-Othman, N.; Kalaji, N.; Fessi, H.; About, I. Usefulness of controlled release of growth factors in investigating the early events of dentin-pulp regeneration. J. Endod. 2013, 39, 228–235. [Google Scholar] [CrossRef] [Scilit]
- Capuana, E.; Lopresti, F.; Ceraulo, M.; La Carrubba, V. Poly-l-Lactic Acid (PLLA)-Based Biomaterials for Regenerative Medicine: A Review on Processing and Applications. Polymers 2022, 14, 1153. [Google Scholar] [CrossRef] [Scilit]
- Farah, S.; Anderson, D.G.; Langer, R. Physical and mechanical properties of PLA, and their functions in widespread applications—A comprehensive review. Adv. Drug Deliv. Rev. 2016, 107, 367–392. [Google Scholar] [CrossRef] [Scilit]
- Sadat Tabatabaei Mirakabad, F.; Nejati-Koshki, K.; Akbarzadeh, A. PLGA-based nanoparticles as cancer drug delivery systems. Asian Pac. J. Cancer Prev. 2014, 15, 517–535. [Google Scholar] [CrossRef] [Scilit]
- Panyam, J.; Labhasetwar, V. Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Adv. Drug Deliv. Rev. 2003, 55, 329–347. [Google Scholar] [CrossRef] [Scilit]
- Jain, R.A. The manufacturing techniques of various drug loaded biodegradable poly(lactide-co-glycolide) (PLGA) devices. Biomaterials 2000, 21, 2475–2490. [Google Scholar] [CrossRef] [Scilit]
- Parhizkar, A.; Asgary, S. Local Drug Delivery Systems for Vital Pulp Therapy: A New Hope. Int. J. Biomater. 2021, 2021, 5584268. [Google Scholar] [CrossRef] [Scilit]
- Moussa, D.G.; Aparicio, C. Present and future of tissue engineering scaffolds for dentin-pulp complex regeneration. J. Tissue Eng. Regen. Med. 2019, 13, 58–75. [Google Scholar] [CrossRef] [Scilit]
- Martins, C.; Sousa, F.; Araújo, F.; Sarmento, B. Functionalizing PLGA and PLGA Derivatives for Drug Delivery and Tissue Regeneration Applications. Adv. Healthc. Mater. 2018, 7, 10. [Google Scholar] [CrossRef] [Scilit]
- Oh, S.H.; Kim, J.H.; Song, K.S. Peripheral nerve regeneration within an asymmetrically porous PLGA/Pluronic F127 nerve guide conduit. Biomaterials 2008, 29, 1601–1609. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.; Yu, M.; Zong, X. Control of degradation rate and hydrophilicity in electrospun non-woven poly (D, L-lactide) nanofiber scaffolds for biomedical applications. Biomaterials 2003, 24, 4977–4985. [Google Scholar] [CrossRef] [Scilit]
- Alves, C.M.; Yang, Y.; Marton, D.; Carnes, D.L.; Ong, J.L.; Sylvia, V.L.; Dean, D.D.; Reis, R.L.; Agrawal, C.M. Plasma surface modification of poly(D,L-lactic acid) as a tool to enhance protein adsorption and the attachment of different cell types. J. Biomed. Mater. Res. Part B Appl. Biomater. 2008, 87B, 59–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Saux, G.; Wu, M.C.; Toledo, E. Cell-Cell Adhesion-Driven Contact Guidance and Its Effect on Human Mesenchymal Stem Cell Differentiation. ACS Appl. Mater. Interfaces 2020, 12, 22399–22409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, J.; Rajangam, T.; Rhie, J.; Kim, S. Characterization of cell signaling, morphology, and differentiation potential of human mesenchymal stem cells based on cell adhesion mechanism. J. Cell Physiol. 2020, 235, 6915–6928. [Google Scholar] [CrossRef] [Scilit]
- Rocha, C.V.; Gonçalves, V.; da Silva, M.C.; Bañobre-López, M.; Gallo, J. PLGA-Based Composites for Various Biomedical Applications. Int. J. Mol. Sci. 2022, 23, 2034. [Google Scholar] [CrossRef] [Scilit]
- Sui, G.; Yang, X.; Mei, F. Poly-L-lactic acid/hydroxyapatite hybrid membrane for bone tissue regeneration. J. Biomed. Mater. Res. A 2007, 82, 445–454. [Google Scholar] [CrossRef] [Scilit]
- Sittinger, M.; Reitzel, D.; Dauner, M. Resorbable polyesters in cartilage engineering: Affinity and biocompatibility of polymer fiber structures to chondrocytes. J. Biomed. Mater. Res. 1996, 33, 57–63. [Google Scholar] [CrossRef] [Scilit]
- Okabe, T.; Sakamoto, M.; Takeuchi, H.; Matsushima, K. Effects of pH on mineralization ability of human dental pulp cells. J. Endod. 2006, 32, 198–201. [Google Scholar] [CrossRef] [Scilit]
- Cross, K.J.; Huq, N.L.; Reynolds, E.C. Casein phosphopeptides in oral health—Chemistry and clinical applications. Curr. Pharm. Des. 2007, 13, 793–800. [Google Scholar] [CrossRef] [Scilit]







| Target Gene | Sequence | |
|---|---|---|
| GAPDH | forward: | GAGAAGGCTGGGGCTCATTT |
| reverse: | TAAGCAGTTGGTGGTGCAGG | |
| ALP | forward: | ATCTTCCTGGGCGATGGGAT |
| reverse: | CCACATATGGGAAGCGGTCC | |
| DMP1 | forward: | TTGTGAACTACGGAGGGTAGAGG |
| reverse: | CTGCTCTCCAAGGGTGGTG | |
| DSPP | forward: | CATGGGCCATTCCAGTTCCTC |
| reverse: | TCATGCACCAGGACACCACT | |
| BSP | forward: | CGATTTCCAGTTCAGGGCAGT |
| reverse: | TCCATAGCCCAGTGTTGTAGC | |
| TNF-α | forward: | CACTTTGGAGTGATCGGCCC |
| reverse: | CAGCTTGAGGGTTTGCTACAAC | |
| IL-1β | forward: | TTCGAGGCACAAGGCACAA |
| reverse: | TGGCTGCTTCAGACACTTGAG | |
| IL-6 | forward: | CATCCTCGACGGCATCTCAG |
| reverse: | TCACCAGGCAAGTCTCCTCA | |
| IL-8 | forward: | AGTTTTTGAAGAGGGCTGAGA |
| reverse: | TGCTTGAAGTTTCACTGGCATC | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, W.; Yang, F.; Liu, Z.; Wen, Q.; Gao, Y.; Niu, X.; Zhao, Y. Anti-Inflammatory and Mineralization Effects of an ASP/PLGA-ASP/ACP/PLLA-PLGA Composite Membrane as a Dental Pulp Capping Agent. J. Funct. Biomater. 2022, 13, 106. https://doi.org/10.3390/jfb13030106
Yan W, Yang F, Liu Z, Wen Q, Gao Y, Niu X, Zhao Y. Anti-Inflammatory and Mineralization Effects of an ASP/PLGA-ASP/ACP/PLLA-PLGA Composite Membrane as a Dental Pulp Capping Agent. Journal of Functional Biomaterials. 2022; 13(3):106. https://doi.org/10.3390/jfb13030106
Chicago/Turabian StyleYan, Wenjuan, Fenghe Yang, Zhongning Liu, Quan Wen, Yike Gao, Xufeng Niu, and Yuming Zhao. 2022. "Anti-Inflammatory and Mineralization Effects of an ASP/PLGA-ASP/ACP/PLLA-PLGA Composite Membrane as a Dental Pulp Capping Agent" Journal of Functional Biomaterials 13, no. 3: 106. https://doi.org/10.3390/jfb13030106
APA StyleYan, W., Yang, F., Liu, Z., Wen, Q., Gao, Y., Niu, X., & Zhao, Y. (2022). Anti-Inflammatory and Mineralization Effects of an ASP/PLGA-ASP/ACP/PLLA-PLGA Composite Membrane as a Dental Pulp Capping Agent. Journal of Functional Biomaterials, 13(3), 106. https://doi.org/10.3390/jfb13030106
