Adsorption of Proteins on m-CPPD and Urate Crystals Inhibits Crystal-Induced Cell Responses: Study on Albumin-Crystal Interaction
Abstract
1. Introduction
2. Results
2.1. Adsorption of Serum Proteins Inhibits Crystal-Induced Inflammation
2.2. Proteomic Analysis of Proteins Adsorbed on m-CPPD Crystals
2.3. Albumin Coating Inhibits m-CPPD Induced Inflammation
2.4. Protein Adsorption Inhibits Crystal-Induced Inflammation through Inhibition of Membrane-Crystal Interaction
2.5. Physico-Chemical Study of the Adsorption of BSA on m-CPPD Crystals and Its Model of Adsorption
3. Discussion
4. Materials and Methods
4.1. MSU and m-CPPD Crystals Synthesis and Characterization
4.2. Mice
4.3. Cells Culture
4.4. Cytokines and ATP Quantification
4.5. mRNA Quantification
4.6. Flow Cytometry
4.7. Proteomic Analysis
4.8. Statistical Analysis
4.9. BSA Adsorption on m-CPPD Crystals
4.11. Preliminary Study of m-CPPD-BSA Interaction Force by Atomic Force Microscopy
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A



References
- Ryu, K.; Iriuchishima, T.; Oshida, M.; Kato, Y.; Saito, A.; Imada, M.; Aizawa, S.; Tokuhashi, Y.; Ryu, J. The prevalence of and factors related to calcium pyrophosphate dihydrate crystal deposition in the knee joint. Osteoarthr. Cartil. 2014, 22, 975–979. [Google Scholar] [CrossRef] [Scilit]
- Richette, P.; Bardin, T.; Doherty, M. An update on the epidemiology of calcium pyrophosphate dihydrate crystal deposition disease. Rheumatology 2009, 48, 711–715. [Google Scholar] [CrossRef] [Scilit]
- Kuo, C.F.; Grainge, M.J.; Zhang, W.; Doherty, M. Global epidemiology of gout: Prevalence, incidence and risk factors. Nat. Rev. Rheumatol. 2015, 11, 649–662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Slater, C.; Laurencin, D.; Burnell, V.; Smith, M.E.; Grover, L.M.; Hriljac, J.A.; Wright, A.J. Enhanced stability and local structure in biologically relevant amorphous materials containing pyrophosphate. J. Mater. Chem. 2011, 21, 18783. [Google Scholar] [CrossRef] [Scilit]
- Zunić, B.-; Christoffersen, M.R.; Christoffersen, J. Structure of the beta form of calcium pyrophosphate tetrahydrate. Acta Crystallogr. Sect. B Struct. Sci. 2000, 56, 953–958. [Google Scholar] [CrossRef] [Scilit]
- Gras, P. Etude physico-chimique et structurale de pyrophosphates de calcium hydratés: Application aux micro-calcifications associées à l’arthrose. Ph.D. Thesis, INP Toulouse, Toulouse, France, 2014. (In French) [Google Scholar]
- Narayan, S.; Kolly, L.; Bagnoud, N.; Chobaz, V.; Roger, T.; So, A.; Busso, N.; Pazár, B.; Ea, H.-K.; Lioté, F. Basic Calcium Phosphate Crystals Induce Monocyte/Macrophage IL-1β Secretion through the NLRP3 Inflammasome In Vitro. J. Immunol. 2011, 186, 2495–2502. [Google Scholar]
- Martinon, F.; Pétrilli, V.; Mayor, A.; Tardivel, A.; Tschopp, J.; P, V. Gout-associated uric acid crystals activate the NALP3 inflammasome. Nat. Cell Boil. 2006, 440, 237–241. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Doherty, M.; Bardin, T.; Barskova, V.; Guerne, P.-A.; Jansen, T.L.; Leeb, B.F.; Perez-Ruiz, F.; Pimentao, J.; Punzi, L.; et al. European League Against Rheumatism recommendations for calcium pyrophosphate deposition. Part I: Terminology and diagnosis. Ann. Rheum. Dis. 2011, 70, 563–570. [Google Scholar] [CrossRef] [Scilit]
- Lebre, F.; Sridharan, R.; Sawkins, M.J.; Kelly, D.J.; O’Brien, F.J.; Lavelle, E.C. The shape and size of hydroxyapatite particles dictate inflammatory responses following implantation. Sci. Rep. 2017, 7, 2922. [Google Scholar] [CrossRef] [Scilit]
- Cheung, H.S.; Devine, T.R.; Hubbard, W. Calcium phosphate particle induction of metalloproteinase and mitogenesis: Effect of particle sizes. Osteoarthr. Cartil. 1997, 5, 145–151. [Google Scholar] [CrossRef] [Scilit]
- Nadra, I.; Boccaccini, A.R.; Philippidis, P.; Whelan, L.C.; McCarthy, G.M.; Haskard, D.O.; Landis, R.C. Effect of particle size on hydroxyapatite crystal-induced tumor necrosis factor alpha secretion by macrophages. Atherosclerosis 2008, 196, 98–105. [Google Scholar] [CrossRef] [Scilit]
- Burt, H.M.; Jackson, J.K.; Rowell, J. Calcium pyrophosphate and monosodium urate crystal interactions with neutrophils: Effect of crystal size and lipoprotein binding to crystals. J. Rheumatol. 1989, 16, 809–817. [Google Scholar]
- Watanabe, W.; Baker, D.G.; Schumacher, H.R. Comparison of the acute inflammation induced by calcium pyrophosphate dihydrate, apatite and mixed crystals in the rat air pouch model of a synovial space. J. Rheumatol. 1992, 19, 1453–1457. [Google Scholar]
- Liu-Bryan, R.; Pritzker, K.; Firestein, G.S.; Terkeltaub, R. TLR2 Signaling in Chondrocytes Drives Calcium Pyrophosphate Dihydrate and Monosodium Urate Crystal-Induced Nitric Oxide Generation. J. Immunol. 2005, 174, 5016–5023. [Google Scholar] [CrossRef] [Scilit]
- Cheung, H.S.; Halverson, P.B.; Mccarty, D.J. Release of Collagenase, Neutral Protease, and Prostaglandins from Cultured Mammalian Synovial Cells by Hydroxyapatite and Calcium Pyrophosphate Dihydrate Crystals. Arthritis Rheum. 1981, 24, 1338–1344. [Google Scholar] [CrossRef] [Scilit]
- Campillo-Gimenez, L.; Renaudin, F.; Jalabert, M.; Gras, P.; Gosset, M.; Rey, C.; Sarda, S.; Collet, C.; Cohen-Solal, M.; Combes, C.; et al. Inflammatory Potential of Four Different Phases of Calcium Pyrophosphate Relies on NF-κB Activation and MAPK Pathways. Front. Immunol. 2018, 9. [Google Scholar] [CrossRef] [Scilit]
- Lioté, F.; Prudhommeaux, F.; Schiltz, C.; Champy, R.; Herbelin, A.; Bardin, T.; Ortiz-Bravo, E. Inhibition and prevention of monosodium urate monohydrate crystal–induced acute inflammation in vivo by transforming growth factor β1. Arthritis Rheum. 1996, 39, 1192–1198. [Google Scholar] [CrossRef] [Scilit]
- Roch-Arveiller, M.; Legros, R.; Chanaud, B.; Muntaner, O.; Strzalko, S.; Thuret, A.; Willoughby, D.; Giroud, J. Inflammatory reactions induced by various calcium pyrophosphate crystals. Biomed. Pharmacother. 1990, 44, 467–474. [Google Scholar] [CrossRef] [Scilit]
- Swan, A.; Heywood, B.; Chapman, B.; Seward, H.; Dieppe, P. Evidence for a causal relationship between the structure, size, and load of calcium pyrophosphate dihydrate crystals, and attacks of pseudogout. Ann. Rheum. Dis. 1995, 54, 825–830. [Google Scholar] [CrossRef] [Scilit]
- Kozin, F.; Mccarty, D.J. Protein adsorption to monosodium urate, calcium pyrophosphate dihydrate, and silica crystals. Relationship to the pathogenesis of crystal-induced inflammation. Arthritis Rheum. 1976, 19, 433–438. [Google Scholar] [CrossRef] [Scilit]
- Kozin, F.; McCarty, D.J. Protein binding to monosodium urate monohydrate, calcium pyrophosphate dihydrate, and silicon dioxide crystals. I. Physical characteristics. J. Lab. Clin. Med. 1977, 89, 1314–1325. [Google Scholar]
- Terkeltaub, R.; Martin, J.; Curtiss, L.K.; Ginsberg, M.H. Apolipoprotein B mediates the capacity of low density lipoprotein to suppress neutrophil stimulation by particulates. J. Boil. Chem. 1986, 261, 15662–15667. [Google Scholar]
- Abramson, S.; Hoffstein, S.T.; Weissmann, G. Superoxide anion generation by human neutrophils exposed to monosodium urate. effect of protein adsorption and complement activation. Arthritis Rheum. 1982, 25, 174–180. [Google Scholar] [CrossRef] [Scilit]
- Scanu, A.; Luisetto, R.; Oliviero, F.; Gruaz, L.; Sfriso, P.; Burger, D.; Punzi, L. High-density lipoproteins inhibit urate crystal-induced inflammation in mice. Ann. Rheum. Dis. 2015, 74, 587–594. [Google Scholar] [CrossRef] [Scilit]
- Rosen, M.S.; Baker, D.G.; Schumacher, H.R.; Cherian, P.V. Products of polymorphonuclear cell injury inhibit IgG enhancement of monosodium urate-induced superoxide production. Arthritis Rheum. 1986, 29, 1473–1479. [Google Scholar] [CrossRef] [Scilit]
- Sieck, M.S.; Schumacher, H.R.; Ortiz-Bravo, E. Changes in the proteins coating monosodium urate crystals during active and subsiding inflammation. immunogold studies of synovial fluid from patients with gout and of fluid obtained using the rat subcutaneous air pouch model. Arthritis Rheum. 1993, 36, 1274–1285. [Google Scholar]
- Ortiz-Bravo, E.; Schumacher, H.R. Components generated locally as well as serum alter the phlogistic effect of monosodium urate crystals in vivo. J. Rheumatol. 1993, 20, 1162–1166. [Google Scholar]
- Terkeltaub, R.; Curtiss, L.K.; Tenner, A.J.; Ginsberg, M.H. Lipoproteins containing apoprotein B are a major regulator of neutrophil responses to monosodium urate crystals. J. Clin. Investig. 1984, 73, 1719–1730. [Google Scholar] [CrossRef] [Scilit]
- Barbero, F.; Russo, L.; Vitali, M.; Piella, J.; Salvo, I.; Borrajo, M.L.; Busquets-Fité, M.; Grandori, R.; Bastús, N.G.; Casals, E.; et al. Formation of the Protein Corona: The Interface between Nanoparticles and the Immune System. Semin. Immunol. 2017, 34, 52–60. [Google Scholar] [CrossRef] [Scilit]
- Xiao, W.; Gao, H. The impact of protein corona on the behavior and targeting capability of nanoparticle-based delivery system. Int. J. Pharm. 2018, 552, 328–339. [Google Scholar] [CrossRef] [Scilit]
- Burt, H.M.; Jackson, J.K. Enhancement of crystal induced neutrophil responses by opsonisation of calcium pyrophosphate dihydrate crystals. Ann. Rheum. Dis. 1993, 52, 599–607. [Google Scholar] [CrossRef] [Scilit]
- Winternitz, C.I.; Jackson, J.K.; Burt, H.M. The interaction of monoclinic calcium pyrophosphate dihydrate crystals with neutrophils. Rheumatol. Int. 1996, 16, 101–107. [Google Scholar] [CrossRef] [Scilit]
- Benaziz, L.; Barroug, A.; Legrouri, A.; Rey, C.; Lebugle, A. Adsorption of O-Phospho-L-Serine and L-Serine onto Poorly Crystalline Apatite. J. Colloid Interface Sci. 2001, 238, 48–53. [Google Scholar] [CrossRef] [Scilit]
- Rey, C.; Combes, C.; Drouet, C.; Cazalbou, S.; Grossin, D.; Brouillet, F.; Sarda, S. Surface properties of biomimetic nanocrystalline apatites; applications in biomaterials. Prog. Cryst. Growth Charact. Mater. 2014, 60, 63–73. [Google Scholar] [CrossRef] [Scilit]
- Sarda, S.; Errassifi, F.; Marsan, O.; Geffre, A.; Trumel, C.; Drouet, C. Adsorption of tranexamic acid on hydroxyapatite: Toward the development of biomaterials with local hemostatic activity. Mater. Sci. Eng. C 2016, 66, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Piccini, A.; Carta, S.; Tassi, S.; Lasiglié, D.; Fossati, G.; Rubartelli, A. ATP is released by monocytes stimulated with pathogen-sensing receptor ligands and induces IL-1β and IL-18 secretion in an autocrine way. Proc. Natl. Acad. Sci. USA 2008, 105, 8067–8072. [Google Scholar] [CrossRef] [Scilit]
- Zhou, R.; Yazdi, A.S.; Menu, P.; Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation. Nat. Cell Boil. 2011, 475, 122. [Google Scholar] [CrossRef] [Scilit]
- Smiley, S.T.; Reers, M.; Mottola-Hartshorn, C.; Lin, M.; Chen, A.; Smith, T.W.; Steele, G.D.; Chen, L.B. Intracellular heterogeneity in mitochondrial membrane potentials revealed by a J-aggregate-forming lipophilic cation JC-1. Proc. Natl. Acad. Sci. USA 1991, 88, 3671–3675. [Google Scholar] [CrossRef] [Scilit]
- Hari, A.; Zhang, Y.; Tu, Z.; Detampel, P.; Stenner, M.; Ganguly, A.; Shi, Y. Activation of NLRP3 inflammasome by crystalline structures via cell surface contact. Sci. Rep. 2014, 4, 7281. [Google Scholar] [CrossRef] [Scilit]
- Ng, G.; Sharma, K.; Ward, S.M.; Desrosiers, M.D.; Stephens, L.A.; Schoel, W.M.; Li, T.; Lowell, C.A.; Ling, C.-C.; Amrein, M.W.; et al. Receptor-independent, direct membrane binding leads to cell surface lipid sorting and Syk kinase activation in dendritic cells. Immunity 2008, 29, 807–818. [Google Scholar] [CrossRef] [Scilit]
- Burt, H.M.; Jackson, J.K.; Wu, W. Crystal-induced inflammation: Studies of the mechanism of crystal-membrane interactions. Scanning Microsc. 1991, 5, 273. [Google Scholar]
- Foo, K.Y.; Hameed, B. Insights into the modeling of adsorption isotherm systems. Chem. Eng. J. 2010, 156, 2–10. [Google Scholar] [CrossRef] [Scilit]
- Pascaud, P.; Montesi, M.; Drouet, C.; Sarda, S.; Iafisco, M.; Adamiano, A.; Panseri, S.; Tampieri, A. Superparamagnetic iron-doped nanocrystalline apatite as a delivery system for doxorubicin. J. Mater. Chem. B 2016, 4, 57–70. [Google Scholar]
- Pascaud, P.; Errassifi, F.; Brouillet, F.; Sarda, S.; Barroug, A.; Legrouri, A.; Rey, C. Adsorption on apatitic calcium phosphates for drug delivery: Interaction with bisphosphonate molecules. J. Mater. Sci. Mater. Med. 2014, 25, 2373–2381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, W.J.; Walton, M.; Harper, J. Resident macrophages initiating and driving inflammation in a monosodium urate monohydrate crystal-induced murine peritoneal model of acute gout. Arthritis Rheum. 2009, 60, 281–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Latz, E.; Duewell, P. NLRP3 inflammasome activation in inflammaging. Semin. Immunol. 2018, 40, 61–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Terkeltaub, R.; Tenner, A.J.; Kozin, F.; Ginsberg, M.H. Plasma Protein Binding by Monosodium Urate Crystals. Arthritis Rheum. 1983, 26, 775–783. [Google Scholar] [CrossRef] [Scilit]
- Terkeltaub, R.A.; Dyer, C.A.; Martin, J.; Curtiss, L.K. Apolipoprotein (apo) E inhibits the capacity of monosodium urate crystals to stimulate neutrophils. Characterization of intraarticularapo E and demonstration of apo E binding to urate crystals in vivo. J. Clin. Investig. 1991, 87, 20–26. [Google Scholar] [CrossRef] [Scilit]
- Jackson, J.K.; Tudan, C.; Sahl, B.; Pelech, S.L.; Burt, H.M. Calcium pyrophosphate dihydrate crystals activate MAP kinase in human neutrophils: Inhibition of MAP kinase, oxidase activation and degranulation responses of neutrophils by taxol. Immunology 1997, 90, 502–510. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, C.; Lieberherr, M.; Bordat, C.; Velard, F.; Côme, D.; Liote, F.; Ea, H.-K. Intracellular calcium oscillations in articular chondrocytes induced by basic calcium phosphate crystals lead to cartilage degradation. Osteoarthr. Cartil. 2012, 20, 1399–1408. [Google Scholar] [CrossRef] [Scilit]
- Burt, H.M.; Jackson, J.K. Characterization and membranolytic effects of triclinic calcium pyrophosphate dihydrate crystals. J. Rheumatol. 1987, 14, 968–973. [Google Scholar]
- Burt, H.M.; Jackson, J.K. Cytosolic Ca2+ concentration determinations in neutrophils stimulated by monosodium urate and calcium pyrophosphate crystals: Effect of protein adsorption. J. Rheumatol. 1994, 21, 138–144. [Google Scholar]
- Wallingford, W.R.; Mccarty, D.J. Differential Membranolytic Effects of Microcrystalline Sodium Urate and Calcium Pyrophosphate Dihydrate. J. Exp. Med. 1971, 133, 100–112. [Google Scholar] [CrossRef] [Scilit]
- Charbgoo, F.; Nejabat, M.; Abnous, K.; Soltani, F.; Taghdisi, S.M.; Alibolandi, M.; Shier, W.T.; Steele, T.W.; Ramezani, M. Gold nanoparticle should understand protein corona for being a clinical nanomaterial. J. Control. Release 2018, 272, 39–53. [Google Scholar] [CrossRef] [Scilit]
- Winternitz, C.I. Calcium pyrophosphate dihydrate crystal deposition disease: Characterization and IgG binding properties of monoclinic calcium pyrophosphate dihydrate crystals. Ph.D. Thesis, University of British Columbia, Vancouver, BC, Canada, 1994. [Google Scholar]
- Gras, P.; Rey, C.; Marsan, O.; Sarda, S.; Combes, C. Synthesis and Characterisation of Hydrated Calcium Pyrophosphate Phases of Biological Interest. Eur. J. Inorg. Chem. 2013, 2013, 5886–5895. [Google Scholar] [CrossRef] [Scilit]
- Jauvert, E.; Dague, E.; Séverac, M.; Ressier, L.; Caminade, A.-M.; Majoral, J.-P.; Trevisiol, E. Probing single molecule interactions by AFM using bio-functionalized dendritips. Sens. Actuators B Chem. 2012, 168, 436–441. [Google Scholar] [CrossRef] [Scilit]
- Hutter, J.L.; Bechhoefer, J. Calibration of atomic-force microscope tips. Sci. Instrum. 1993, 64, 1868–1873. [Google Scholar] [CrossRef] [Scilit]







| Accession | Description | Σ Coverage | Mascot Score |
|---|---|---|---|
| 62460494 | hemoglobin fetal subunit beta [Bos taurus] | 64.83 | 424.4 |
| 148745450 | Fibrinogen alpha chain [Bos taurus] | 32.85 | 312.2 |
| 116812902 | hemoglobin subunit alpha [Bos taurus] | 99.30 | 308.2 |
| 296474801 | TPA: inter-alpha-trypsin inhibitor heavy chain H4 precursor [Bos taurus] | 8.19 | 270.7 |
| 27806751 | alpha-2-HS-glycoprotein precursor [Bos taurus] | 21.73 | 225.2 |
| 74267962 | ALB protein [Bos taurus] | 16.14 | 185.5 |
| 1351907 | Serum albumin Precursor | 16.14 | 178.2 |
| 114052298 | apolipoprotein A-II precursor [Bos taurus] | 49.00 | 140.0 |
| 262050656 | complement C4 precursor [Bos taurus] | 3.96 | 138.4 |
| 75832056 | apolipoprotein A-I preproprotein [Bos taurus] | 58.11 | 137.5 |
| 268607679 | coagulation factor XIII A chain [Bos taurus] | 10.52 | 97.8 |
| 27819608 | hemoglobin subunit beta [Bos taurus] | 41.38 | 92.0 |
| 2501351 | Serotransferrin Precursor | 6.11 | 88.8 |
| 27806789 | transthyretin precursor [Bos taurus] | 40.82 | 82.8 |
| 47564119 | apolipoprotein C-III precursor [Bos taurus] | 44.79 | 82.0 |
| 51592135 | cofilin-1 [Sus scrofa] | 12.05 | 81.4 |
| 77735583 | adenosylhomocysteinase [Bos taurus] | 4.17 | 62.7 |
| 156139070 | apolipoprotein C-II precursor [Bos taurus] | 39.60 | 57.8 |
| 27806487 | pigment epithelium-derived factor precursor [Bos taurus] | 13.46 | 57.3 |
| 27807209 | alpha-2-antiplasmin precursor [Bos taurus] | 6.10 | 54.9 |
| 297488254 | PREDICTED: serpin A3-3 [Bos taurus] | 8.47 | 54.1 |
| 296487363 | TPA: myosin, heavy chain 9, non-muscle [Bos taurus] | 3.10 | 52.8 |
| 27807167 | peroxiredoxin-6 [Bos taurus] | 10.27 | 52.4 |
| 27807125 | thymosin beta-10 [Bos taurus] | 42.86 | 49.1 |
| 297466391 | PREDICTED: alpha-2-macroglobulin, partial [Bos taurus] | 1.90 | 47.2 |
| 296479148 | TPA: alpha-enolase [Bos taurus] | 13.82 | 43.5 |
| 114053019 | alpha-1B-glycoprotein precursor [Bos taurus] | 5.17 | 41.2 |
| 123959760 | ubiquitin-like protein 4B [Bos taurus] | 5.45 | 41.2 |
| 135806 | Prothrombin Precursor | 11.20 | 41.0 |
| Forward | Reverse | |
|---|---|---|
| IL-1β | TTCGAGGCACAAGGCACAA | TGGCTGCTTCAGACACTTGAG |
| IL-8 | GAGCCAGGAAGAAACCACCG | TGGCAAAACTGCACCTTCACA |
| TNF-α | CCCATGTTGTAGCAAACCCTC | TATCTCTCAGCTCCACGCCA |
| Cox-2 | GCTGTTCCCACCCATGTCAA | AAATTCCGGTGTTGAGCAGT |
| GAPDH | AGCCACATCGCCAGACAC | GCCCAATACGACCAAATCC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Renaudin, F.; Sarda, S.; Campillo-Gimenez, L.; Séverac, C.; Léger, T.; Charvillat, C.; Rey, C.; Lioté, F.; Camadro, J.-M.; Ea, H.-K.; et al. Adsorption of Proteins on m-CPPD and Urate Crystals Inhibits Crystal-Induced Cell Responses: Study on Albumin-Crystal Interaction. J. Funct. Biomater. 2019, 10, 18. https://doi.org/10.3390/jfb10020018
Renaudin F, Sarda S, Campillo-Gimenez L, Séverac C, Léger T, Charvillat C, Rey C, Lioté F, Camadro J-M, Ea H-K, et al. Adsorption of Proteins on m-CPPD and Urate Crystals Inhibits Crystal-Induced Cell Responses: Study on Albumin-Crystal Interaction. Journal of Functional Biomaterials. 2019; 10(2):18. https://doi.org/10.3390/jfb10020018
Chicago/Turabian StyleRenaudin, Felix, Stéphanie Sarda, Laure Campillo-Gimenez, Childérick Séverac, Thibaut Léger, Cédric Charvillat, Christian Rey, Frédéric Lioté, Jean-Michel Camadro, Hang-Korng Ea, and et al. 2019. "Adsorption of Proteins on m-CPPD and Urate Crystals Inhibits Crystal-Induced Cell Responses: Study on Albumin-Crystal Interaction" Journal of Functional Biomaterials 10, no. 2: 18. https://doi.org/10.3390/jfb10020018
APA StyleRenaudin, F., Sarda, S., Campillo-Gimenez, L., Séverac, C., Léger, T., Charvillat, C., Rey, C., Lioté, F., Camadro, J.-M., Ea, H.-K., & Combes, C. (2019). Adsorption of Proteins on m-CPPD and Urate Crystals Inhibits Crystal-Induced Cell Responses: Study on Albumin-Crystal Interaction. Journal of Functional Biomaterials, 10(2), 18. https://doi.org/10.3390/jfb10020018

