Identification of a Ficolin-like Serum Lectin of the Common Carp as a Novel Homologue of Mammalian Microfibrillar-Associated Protein 4

Abstract

Serum lectins in vertebrates play crucial roles in innate immunity as recognition molecules for pathogen-associated molecular patterns (PAMPs). In mammals, two major lectins, mannose-binding lectin (MBL) and ficolin, both containing N-terminal collagen-like domains, activate the lectin pathway of complement. While MBL and ficolin recognize distinct PAMPs, their counterparts in teleosts are less understood. To date, MBL and galactose-binding lectin (GalBL) have been identified in teleosts, but the presence of ficolin remains unclear. In this study, we purified a 31-kDa serum lectin from common carp that displayed carbohydrate-binding specificity similar to that of mammalian ficolin. Unexpectedly, this lectin lacked an N-terminal collagenous domain and showed the highest similarity to mammalian microfibril-associated glycoprotein 4 (MFAP4), suggesting that the lectin is distinct from fibulin. Biochemical analyses revealed that carp MFAP4-like lectin (MFAP4Lec) protein forms a hexamer in serum, specifically binds GlcNAc and GalNAc, and recognizes the fish pathogen Vibrio anguillarum. The binding was competitively inhibited by GlcNAc but not by EDTA, indicating Ca²⁺-independent recognition. These findings suggest that MFAP4Lec functions as a novel serum lectin in teleost fish, serving as a recognition molecule for bacterial pathogens in innate immunity.

1. Introduction

Lectins play crucial roles in innate immunity as pattern-recognition molecules that detect pathogen-associated molecular patterns (PAMPs) as well as endogenous danger-associated molecular patterns [1]. Mammals possess mannose-binding lectin (MBL) and ficolins, oligomeric serum lectins with N-terminal collagenous stalks that function as pathogen sensors to trigger the lectin pathway of the complement system, a major humoral effector of innate immunity [2]. The lectin pathway is particularly important for antibacterial defense in newborns and young children prior to the establishment of adaptive immunity [3].

MBL and ficolin recognize target carbohydrates via a C-type lectin domain and a fibrinogen-like domain, respectively [2]. MBL binds mannose, N-acetyl-D-glucosamine (GlcNAc), glucose, and fucose, whereas ficolin recognizes GlcNAc and N-acetyl-D-galactosamine (GalNAc) through acetyl-group interactions [4]. Despite their overlapping monosaccharide specificities, the two lectins exhibit distinct recognition spectra toward natural microbial ligands: MBL preferentially binds bacterial peptidoglycan, whereas ficolin binds more strongly to fungal β-1,3-glucans, suggesting complementary functions in broad microbial surveillance [5].

Both MBL and ficolin associate with a set of serine proteases—MBL-associated serine proteases (MASP)-1, -2, and -3—and their truncated non-catalytic isoforms such as Map19 and Map44, via the collagenous region. These MASPs connect pathogen recognition by MBL and ficolin to proteolytic activation of complement components C4, C2, and C3 [6,7].

From a phylogenetic perspective, MBL, ficolin, and MASP-1/3 have been identified in some invertebrates together with complement C3, indicating that the lectin pathway represents an ancient and fundamental mechanism of complement activation that predates the antibody-dependent classical pathway [8,9].

Bony fish, one of the most ancient vertebrate groups, possess a well-developed complement system that includes the lectin, classical, alternative, and cytolytic pathways [10,11]. Components of the lectin pathway identified in teleosts include two MBL homologues (MBL and galactose-binding lectin, GalBL), MASP2, MASP3, and MRP (later renamed Map44 in mammals) [12,13,14].

Notably, despite extensive searches of the whole-genome sequences of pufferfish, zebrafish, medaka, carp, and other species, no orthologue of ficolin has been identified in bony fish. Because ficolin is present in ascidians—the closest invertebrate relatives of vertebrates—and in amphibians [9,15], ficolin appears to have been lost specifically in the bony fish lineage [16].

In the present study, we attempted to isolate a putative ficolin-like lectin from the serum of the common carp (Cyprinus carpio), a teleost species, and identified it as a homologue of mammalian microfibrillar-associated protein 4 (MFAP4). We also discuss potential innate immune functions of teleost MFAP4 as an innate immune factor.

2. Materials and Methods

2.1. Carp Serum

Carp (approximately 1 kg) was purchased from a local fish farm. Serum was collected as previously described [17]. Briefly, blood from the caudal vessels was allowed to clot for 30 min at room temperature and 30 min on ice, followed by centrifugation at 2500 rpm for 10 min at 4 °C. The resulting serum was frozen in liquid nitrogen and stored at −80 °C until use.

2.2. Purification of a Ficolin-like Lectin from Carp Serum

A purification protocol for carp MBL [14] was followed with minor modifications based on a reported procedure for human ficolin [6]. Thawed serum was cleared by centrifugation (9000 rpm, 15 min, 4 °C) and adjusted to 7% polyethylene glycol (PEG) 4000. The 7% PEG precipitate was collected, dissolved in SB (50 mM Tris-HCl, pH 7.8, containing 200 mM NaCl and 10 mM CaCl₂), and applied to a GlcNAc-agarose (Sigma, Tokyo, Japan) column (1.2 × 5 cm) equilibrated with SB. After washing, bound proteins were sequentially eluted with SB containing 40 mM mannose, 400 mM mannose, and finally 150 mM GlcNAc.

2.3. SDS-PAGE and Western Blotting

SDS-PAGE was performed on 10% gels as described [18]. Proteins were stained with Coomassie Brilliant Blue R-250. For western blotting, proteins were transferred to PVDF membranes and blocked with 5% skim milk in PBS. Membranes were incubated with anti-carp MFAP4 (1:500; see below) followed by HRP-conjugated anti-rabbit IgG (Kappel Laboratories, Malvern, PA, USA, 1:2000). After washing, antigen bands were visualized using 4-chloro-1-naphthol and hydrogen peroxide.

2.4. Preparation of Anti-Carp MFAP4 Polyclonal Antibodies

Purified MFAP4 was separated by SDS-PAGE and visualized by imidazole/zinc negative staining [19]. The 33-kDa bands were excised, washed with PBS, homogenized, emulsified in FCA, and injected subcutaneously into rabbits seven times at weekly intervals. Antiserum was collected one week after the final immunization. The specificity of anti-carp MFAP4Lec was confirmed by western blotting using a 7% PEG precipitate fraction of carp serum as an antigen. (Supplementary Figure S1).

2.5. N-Terminal Amino Acid Sequence Analysis

MFAP4 separated by SDS-PAGE was transferred to PVDF, stained with CBB, and subjected to automated Edman degradation on a PPSQ-21 protein sequencer (Shimadzu, Kyoto, Japan).

2.6. Molecular Mass Estimation by Gel-Filtration

Purified MFAP4 was analyzed on a Superdex 200 column equilibrated with 10 mM Tris-HCl (pH 7.5) containing 150 mM NaCl and eluted at 0.5 mL/min. Fractions were analyzed by SDS-PAGE. Apoferritin (443 kDa), β-amylase (200 kDa), and ovalbumin (45 kDa) were used as molecular mass markers.

2.7. Determination of Specific Inhibitory Monosaccharides for Carp MFAP4

Purified MFAP4 (2 μg) was incubated with GlcNAc-agarose beads in SB containing monosaccharides (50–200 mM) at room temperature for 30 min, following the published method [20]. Supernatants were analyzed by SDS-PAGE to detect unbound MFAP4.

2.8. Preparation of Microbial Suspensions

The following bacteria were used for the assay: Gram-positive bacteria (Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus iniae, Streptococcus parauberis type I, Streptococcus parauberis type II, Streptococcus pyogenes, and Enterococcus faecalis), Gram-negative bacteria (Vibrio anguillarum, Aeromonas hydrophila, Aeromonas salmonicida, Edwarsiella tarda, Escherichia coli, and Klebsiella pneumoniae), and zymosan A.

Vibrio anguillarum was cultured in 1.5% NaCl-HI broth, the genus Streptococcus was cultured in Tryptic soy broth, and all the other bacteria were cultured in HI broth. The bacterial suspension was killed by UV irradiation (70 J/cm², 3 min, 20 times) in a petri dish and washed three times with sterile PBS. All the bacteria were suspended at 1 × 10⁹ cells/mL, yeasts at 4.3 × 10⁸ cells/mL, and zymosan A (Sigma) in SB at 10 mg/mL.

2.9. Binding Assay of MFAP4 to Microbial Targets

Purified MFAP4 was freed of inhibiting sugar (GlcNAc) by diafiltration through Amicon-Ultra 0.5 repeated five times using TBS and concentrated to 50 µg/mL. The MFAP4 solution (100 µL) was incubated with the same volume of microbe suspension (1 × 10⁹ cells/mL) and zymosan (10 mg/mL) in SB at 25 °C for 1 h, followed by centrifugation at 10,000 rpm for 5 min. The target particles were washed three times with the same buffer, and bound proteins were eluted with 15 µL of SDS-sample buffer containing 50 mM dithiothreitol at 25 °C for 10 min. After centrifugation, the supernatant was collected, heated at 100 °C for 3 min, and applied to SDS-PAGE gels, followed by western blotting.

2.10. Cloning and Sequence Analysis

A BLASTP homology search was performed using the NCBI blast server (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 21 October 2025). Multiple sequence alignment was generated using ClustalW software at the GenomeNet server (http://www.genome.jp/tools/clustalw/, accessed on 10 November 2025).

Reverse-transcription PCR (RT-PCR) was conducted using ExTaq polymerase (Takara, Kusatsu, Japan) and primers shown in

Table 1. Oligonucleotide Primers used in this study.

Name	Sequence
MFAP4-Fw	TCGTCTACAGCTGGAGAACACC
MFAP4-Rv	TCTAGGAGTTTACTGAAAGTTTATTTAGTGAAG

Amplification efficiency of the primer set was determined to be 97%.

. The amplified product was gel-purified and sequenced with MFAP4-Fw and MFAP4-Rv primers (Table 1).

3. Results

3.1. Purification of a Ficolin-like GlcNAc-Binding Lectin from Carp Serum

A GlcNAc-binding lectin was purified from carp serum, following the published protocol developed for mammalian MBL and L-ficolins/ficolin-2. After elution of MBL (29 kDa) from the GlcNAc-agarose column with mannose-containing buffer, a ficolin-like protein was eluted with 150 mM GlcNAc. The final preparation showed doublet major bands of molecular masses of 33 kDa and 31 kDa on SDS-PAGE under reducing conditions (Figure 1a). Relative intensities of the 33- and 31-kDa bands showed variation among carp individuals. IgM, likely a natural anti-GlcNAc antibody, was a major contaminant. The IgM content also varied among individuals. Edman degradation of the 33- and 31-kDa polypeptides yielded identical N-terminal sequences, ITDGHDVDKPVDTSXVYKSG (X = undetermined). No collagen-like sequence motif (Gly-X-Y) was detected in the N-terminal region. In addition, digestion with collagenase type III (Worthington Biochemical) did not leave the protein (Figure 1b).

3.2. Identification of Carp Ficolin-like Serum Lectin as a Novel MFAP4 Homologue

A BLASTP search of non-redundant protein databases (nr) using the N-terminal amino acid sequence of purified carp ficolin-like lectin, limiting target sequences from teleost species, yielded top hits of MFAP4-like sequences of carp (XP_018962721.1). Based on the nucleotide sequence encoding this amino acid sequence, PCR primers were designed in the 5‘- and 3‘-untranslated regions as listed in Table 1. RT-PCR with the primer set from carp hepatopancreas RNA yielded a single amplicon of 948 bp with a nucleotide sequence including a 735-bp open reading frame (deposited in the DDBJ database under the accession number LC903834). Its deduced amino acid sequence contains a sequence stretch, CDCGHDVDKPVDCSDVYKSG, which is very close to the N-terminal sequence of the purified ficolin-like serum lectin (Figure 2). A BLASTP search against a teleost subset of the ‘nr-cluster-seq’ protein database, using the NCBI Blast server, yielded several MFAP4-like sequences of carp and other cyprinid species as top hits. As shown in their multiple alignment (Figure 2), the carp ficolin-like sequence showed higher similarity with the KTF77344.1 sequence than with other sequences. In addition, only the KTF77344.1 sequence shares the sequence corresponding to the protein N-terminal sequence with the carp ficolin-like sequence. Therefore, the ficolin-like lectin sequence isolated here is identified as a novel carp homologue of MFAP4, designated as carp MFAP4-lectin (MFAP4Lec).

3.3. Oligomeric Structure of Carp MFAP4Lec

Purified carp MFAP4Lec protein gave doublet bands of 33 and 31 kDa under reducing conditions and triplet bands of apparent molecular masses of 40, 42, and 46 kDa. This suggests a disulfide-linked dimeric structure of carp MFAP4. Upon gel filtration through a Superdex 200 column, carp MFAP4Lec was eluted at the volume corresponding to a molecular mass of about 120 kDa (Figure 3). Taking those results together, it is suggested that native MFAP4Lec in the serum is composed of two disulfide-linked dimers that are noncovalently associated.

3.4. Monosaccharide Binding Specificity of Carp MFAP4Lec

Binding of carp MFAP4Lec to GlcNAc-agarose was inhibited by GlcNAc and GalNAc in a dose-dependent manner but not by mannose, glucose, or galactose (Figure 4). These results indicate that carp MFAP4Lec is a GlcNAc/GalNAc-specific lectin, as is ficolin. Unlike mammalian ficolin, MFAP4Lec binding was not inhibited by EDTA, indicating its Ca²⁺-independent sugar recognition.

3.5. Microbial-Binding Specificity

Binding of carp MFAP4Lec was tested against a panel of microbes. Western blotting of bound fractions showed specific binding to Vibrio anguillarum, a Gram-negative fish pathogen, whereas no detectable binding was observed for other bacteria or zymosan (Figure 5a). Binding to Vibrio was inhibited by GlcNAc but not by EDTA, consistent with carbohydrate-binding results (Figure 5b).

4. Discussion

In this study, we purified a lectin from carp serum using a protocol analogous to that employed for mammalian L-ficolin. Contrary to ficolin, however, the purified protein lacked a collagen-like domain and consisted solely of a fibrinogen-like domain, identifying it as a novel homologue of MFAP4. This result indicates that teleost fish possess an MFAP4 homologue, rather than ficolin, as a GlcNAc-specific serum lectin. This conclusion is further supported by teleost whole-genome database analyses, which have revealed no bona fide ficolin genes comprising an N-terminal collagen-like domain followed by a C-terminal fibrinogen-like domain [16].

The alignment (Figure 2) of carp MFAP4-like sequences indicates the presence of multiple isoforms of MFAP4 homologues in the carp genome, in agreement with the findings in catfish [21]. In addition, the carp MFAP4Lec sequence showed 44% amino acid sequence identity with the fibrinogen domain of human ficolin, while it showed higher identity (58%) with tilapia MFAP4. It is intriguing to note that MFAP4Lec cloned in this study showed the closest similarity with the ‘hypothetical protein (KTF77344.1) of carp, sharing the sequence stretch corresponding to the N-terminal protein sequence over 20 residues. The only marked difference between MFAP4Lec and the ‘hypothetical protein’ is a 24-residue indel, predicting a molecular mass difference of 3137 Da. The long and short isoforms might encode 33 kDa and 31 kDa polypeptides of purified carp MFAP4Lec. It is unknown if the long and short forms are products of alternative splicing or from distinct alleles.

In mammals, MFAP4 is an extracellular matrix protein that plays essential roles in elastic fiber homeostasis, integrin-mediated signaling, and cancer. It is highly expressed in elastic fiber–rich tissues such as skin, arteries, lungs, and heart, where it stabilizes elastic fibers by promoting elastin self-assembly. MFAP4 also modulates cellular behavior through RGD-dependent integrins, including the promotion of vascular smooth muscle cell proliferation and migration, as reviewed in [16]. No lectin activity of MFAP4 has been reported in mammals and other vertebrates [22,23].

In contrast, the physiological functions of MFAP4 in teleosts remain insufficiently characterized. Previous studies have suggested an immunological role, in addition to homeostatic functions [21,22]. For example, MFAP4 expression is upregulated in the liver, kidney, and spleen of catfish and tilapia following bacterial infection [21,24]. Moreover, recombinant tilapia MFAP4 expressed in E. coli has been shown to recognize and agglutinate the fish pathogens Streptococcus agalactiae and Aeromonas hydrophila [24], as well as opsonic activity as in human ficolin [25].

Here, we demonstrated that carp MFAP4Lec is present in serum as a lectin and can recognize the Gram-negative fish pathogen V. anguillarum in a Ca²⁺-independent manner. Together with previous findings in catfish and tilapia [21,24], these results strongly suggest that some MFAP4 homologues can serve as a serum pattern-recognition molecule in the innate immune system of teleosts. However, in contrast to the reported agglutinating activity of recombinant tilapia MFAP4 [24], purified native carp MFAP4Lec showed no agglutination toward the bacterial species tested in this study. Whether this discrepancy reflects differences between recombinant and native proteins or structural divergence among MFAP4 orthologs from different fish species remains unresolved.

The functional significance of possessing MFAP4Lec—rather than ficolin—in carp innate immunity requires careful consideration. Both ficolins and MFAP4 recognize GlcNAc and GalNAc (Figure 4 and reference [4]). Regarding PAMP specificity, human L-ficolin binds β-1,3-glucan and functions as a fungal recognition molecule, complementing MBL, which recognizes bacteria via peptidoglycan [5]. In contrast, carp MFAP4Lec did not bind zymosan, suggesting that its PAMP specificity differs substantially from that of human ficolin. In addition, the downstream effector mechanisms following ligand recognition are expected to diverge between the two proteins. Ficolin associates with MASPs through their collagen-like domains and activates the lectin complement pathway, particularly via MASP-2 [6]. Because MFAP4Lec lacks a collagen-like domain, it is highly unlikely to activate complement, and the mechanisms by which MFAP4Lec mediates the elimination of its target ligands remain to be elucidated. Determining whether native MFAP4Lec exhibits the opsonic activities reported for recombinant tilapia MFAP4 will be crucial for clarifying its immunological roles, in addition to the identification of receptors for MFAP4Lec.

In conclusion, this study provides evidence—for the first time using natural purified protein—that MFAP4Lec may play the role of a lectin and partly replace ficolin as a serum lectin in teleosts, possibly functioning as a microorganism-recognition molecule in their innate immune defense.