Next Article in Journal
Numerical Investigation of Uplift Failure Mode and Capacity Estimation for Deep Helical Anchors in Sand
Next Article in Special Issue
A First Study on Distribution Characteristics of Common Dolphin in Korean Waters: A Study Using Data Collected during the Past 20 Years
Previous Article in Journal
Effects of Slotted Blades on the Hydrodynamic Performance of Horizontal Axis Tidal Turbines
Previous Article in Special Issue
A New Insight into the Taxonomy of Pseudo-nitzschia Genus from the Adriatic Sea: Description of P. brasiliana, P. galaxiae, P. hasleana, and P. linea
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Psammophaga secriensia sp. nov., a New Monothalamid Foraminifera (Protista, Rhizaria) from the Romanian Black Sea Shelf †

1
National Institute of Marine Geology and Geo-Ecology—GeoEcoMar, 23-25 Dimitrie Onciul St., 024053 Bucharest, Romania
2
Department of Genetics and Evolution, University of Geneva, Quai Ernest Ansermet 30, 1211 Geneva, Switzerland
3
Apel Laser, Str. Vintila Mihailescu, 060394 Bucuresti, Romania
4
“Grigore Antipa” National Museum of Natural History, Sos. Kiseleff No. 1, 011341 Bucharest, Romania
5
Institute of Oceanology, Polish Academy of Science, Powstancow Warszawy 55, 81-712 Sopot, Poland
*
Author to whom correspondence should be addressed.
Publications: urn:lsid:zoobank.org:pub:4B4D99D8-E66B-43B8-96CA-5ADB44386627.
J. Mar. Sci. Eng. 2023, 11(8), 1546; https://doi.org/10.3390/jmse11081546
Submission received: 20 June 2023 / Revised: 28 July 2023 / Accepted: 29 July 2023 / Published: 4 August 2023
(This article belongs to the Special Issue Feature Papers in Marine Biology)

Abstract

Based on molecular and morphological characters, we describe a new species of monothalamous foraminifera, Psammophaga secriensia sp. nov., that was sampled from two coastal locations (48 m and 53 m depth) on the Romanian Black Sea continental shelf. Molecular data further confirm its presence in the northeastern part of the Black Sea (Balaklava Bay, 5–10 m depth). Specimens of Psammophaga secriensia sp. nov. are characterized by an elongate to broadly pyriform test and a simple rounded aperture. The wall is translucent and the cytoplasm contains mineral grains of different sizes. The genus Psammophaga, including Psammophaga simplora and several undetermined morphotypes, has been reported from different areas of the Black Sea. Previous research using an integrative taxonomic approach has identified two additional species (Psammophaga zirconia; Psammophaga sp., Gooday et al., 2011) occurring in the Black Sea. Monothalamids are an important part of the meiobenthos in the Black Sea and our results increase the knowledge of foraminiferal diversity in this marginal sea.

1. Introduction

Benthic foraminifera are a crucial part of marine ecosystems, inhabiting diverse habitats from intertidal areas to the deepest ocean trenches, from brackish to hyper-saline waters and from the tropics to the poles. Due to their unicellular organization and short life cycles, they have a quick response to environmental changes, making them effective environmental indicators [1].
Monothalamid foraminifera are a prominent and diverse component of the benthic fauna in both the coastal and deep regions of the Black Sea. The focus on benthic soft-walled foraminifera is evident in various studies conducted by Golemansky [2,3], Anikeeva, and Sergeeva [4], Anikeeva [5,6], Sergeeva [7], Revkov and Sergeeva [8], Sergeeva and Anikeeva [9], Sergeeva et al. [10,11], and Gooday et al. [12]. Initially, research focused on examining the distribution of monothalamids in coastal waters of the Crimean Peninsula, as highlighted in the publications by Anikeeva and Sergeeva [4], and Anikeeva [5]. Subsequently, Sergeeva and Anikeeva [9], and Sergeeva et al. [11,13] extended monothalamid investigations to explore their taxonomic composition and distribution in deeper regions of the Black Sea, including areas characterized by hypoxic conditions. In a related study, Sergeeva and Anikeeva [14] examined monothalamid foraminifera in shallow water environments affected by hypoxia.
Sergeeva and Anikeeva [9] and Anikeeva [15] were the first to publish a comprehensive list of monothalamid foraminifera found in the Black Sea that contains 40 taxa. Subsequent research by Gooday et al. [12,16], Sergeeva, and Anikeeva [17], Sergeeva and Anikeeva [18], and Anikeeva et al. [19] led to the description of new species within this group.
Psammophaga is an abundant component of meiofaunal communities in certain areas of the Black Sea. Psammophaga simplora, Arnold, 1982 has been documented as one of the dominant species in coastal bays in the southwestern part of the Crimea Peninsula. It has been observed in locations such as Omega Bay, Sevastopol Bay, and Sevastopol outer harbor. The species has also been found in other regions of the Black Sea, including Bulgaria, the Caucasus, Turkey, and various southern and southwestern regions of Crimea [14]. An agglutinated undescribed Psammophaga was reported to be abundant in Zernov’s Phyllophora Field [11]. Psammophaga zirconia, Sabbatini, Bartolini, and Morigi, was described from the central Adriatic Sea and is also present in the Crimean area in Kazachya Bay, near Sevastopol [20]. An integrative taxonomic study combining molecular and morphological data revealed an additional, yet undescribed Psammophaga species present in Kazachya Bay [16]. Furthermore, new representatives of two genera, Vellaria and Nellya that are closely related to Psammophaga, were also reported in the same study from Balaklava Bay, and a new species of Vellaria has recently been described from Sivash Bay in the Sea of Azov [18].
Pavel et al. [21] documented the presence of Psammophaga sp. from 29 sampling stations along the Romanian coast, ranging in depth from 20 to 79 m. The morphology of these specimens matches the characteristics of Psammophaga secriensia sp. nov., but most specimens of Pavel et al. [21] are considerably larger, and sequencing results are needed for their identification. Psammophaga secriensia sp. nov. described herein confirms the high diversity of the genus and reveals the adaptative potential of these monothalamids that thrive in brackish as well as fully marine areas.

2. Materials and Methods

2.1. The Black Sea

The Black Sea is a roughly elliptical basin connected to the Mediterranean Sea, situated between 27°27′ and 41°42′ east longitude and 40°55.5′ and 46°32.5′ north latitude. The entire basin covers 461,000 km2 including the Sea of Azov, which is linked to the Black Sea by the narrow Kerch Strait. It contains about 547,000 km3 of water with around 90% of it being anaerobic. The Black Sea has a coastline stretching approximately 4000 km. Its maximum length is 1050 km and its maximum width, near Odessa Bay, reaches 530 km, while the minimum width, near Crimea, is 263 km. The average depth of the basin is 1300 m, with the deepest point reaching 2212 m [22].
The Black Sea, characterized by its almost-complete isolation from other oceans and featuring a deep bathyal basin reaching a maximum depth of 2212 m alongside a vast continental shelf, particularly in the northwestern region, stands out as one of the most remarkable regional seas [23]. The Black Sea’s unique water composition is shaped by the influx of freshwater from major rivers, with the Danube exerting the greatest influence, and the inflow of Mediterranean water through the Bosphorus and Dardanelles straits. As a result, the waters of the Black Sea exhibit a permanent stratification [24,25]. Within this ecosystem, life thrives in the upper 100 m of the water column, which has lower salinity and reduced density. A distinct pycnocline separates this upper layer from the deeper, denser, anoxic, and sulfidic layers that occupy depths below 100–200 m. [26].

2.2. Site Locations

Samples were collected at two stations (100C and SU04) located on the Romanian continental shelf of the Black Sea, east of the Sulina estuary (Figure 1), during two RV Mare Nigrum expeditions. Site 100C was sampled at 48 m depth on the 14 of June 2021 during expedition MN219, while site SU04 was sampled at 53 m depth on the 17 of August 2021 during expedition MN222. The recorded temperatures of the bottom water at the two sites were 7.47 °C and 8.19 °C, while the salinity was 18.69 and 18.71 PSU, respectively. Both sampling stations, SU04 and 100C, have substrates composed of mixed sediments including mud, sand, and shells, in the offshore circalittoral marine habitat of Modiolula phaseolina (Philippi, 1844), classified according to the Commission Decision (EU) 2017/848, using the classification system of the European nature information system (EUNIS). One specimen of the newly described species was collected in 2006 as part of another study in the shallow northern part of the Balaklava Bay, Ukraine [16], at a depth of 5–10 m. In Table 1, environmental parameters are given for the bay as a whole, rather than for a particular station. The bay is characterized by a substrate consisting of sand and silt. For additional environmental parameters, see Table 1.

2.3. Sample Collection and Sample Processing

Meiobenthic samples were collected from the top 5 cm layer of sediment in one of the four tubes of a Multicorer Mark-400 with a cross-sectional area of 78.5 cm2 (Ø 10 cm), deployed from the Mare Nigrum research vessel. Samples were washed on the ship through a 90 μm mesh sieve. The supernatant was subsequently stored in laboratory jars with seawater and placed in a refrigerator at 4 °C for up to two days, with daily changes of seawater. Specimens were sorted on board, counted using an Olympus SZ61 Stereomicroscope mounted with an IDS uEye camera, and photographed with the uEye Cockpit v4.20 program. Specimens intended for genetic analyses were individually transferred to Eppendorf tubes containing 200 µL of RNAlater solution and stored at −20 °C. Specimens designated for morphological analyses were kept in a 4% formaldehyde solution at room temperature and subsequently stored in 95% ethanol. Water column parameters including depth, salinity, temperature, pH, dissolved oxygen, and conductivity in the water column were measured using a CTD Rosette (CTD SBE 25 and rosette model SBE 32 equipped with twelve 5 L Niskin bottles) launched prior to the Multicorer in order to avoid any resuspension of the sediment.
In the laboratory, foraminifera were sorted under a Carl Zeiss Stemi 508 stereomicroscope equipped with an Axiocam 208 color with Zeiss Image software (ZEN 3.2—blue edition) and a Carl Zeiss PrimoStar microscope and identified based on the classification of Loeblich and Tappan [27]. Individual foraminifera were measured from pictures using the ImageJ v2.3.0 [28] program against a known scale.
Samples from the Balaklava Bay followed a similar methodology [16]. A scuba diver collected the surface sediment layer and the samples were sieved on 63 μm mesh screens. The collected specimen was stored in guanidine lysis buffer for molecular analysis.

2.4. Scanning Electron Microscopy Procedure

For scanning electron microscopy (SEM), selected specimens stored in ethanol were rehydrated and fixed with 3% glutaraldehyde in sodium cacodylate buffer (0.1 M, pH 7.4). The specimens were then dehydrated using an ascending alcohol series (30%, 50%, 70%, 80%, 90%, and 100% ethanol) for 30 min each time. Foraminifera were afterwards transferred to a mixed solution of ethanol and hexamethyldisilazane (HMDS) in various ratios (3:1, 1:1, and 1:3), and finally into 100% HMDS, where they were left overnight to allow for chemical evaporation and complete drying. The dried specimens were mounted on aluminum stubs covered with conductive double-sided adhesive carbon tabs, and then sputter-coated with gold for 60 s using an SEM Coating Unit E5100. The Psammophaga individuals were then analyzed and photographed using a Phenom Pro scanning electron microscope (Phenom-World, Thermo Fisher Scientific, The Netherlands) at a 10 kV acceleration voltage [29].

2.5. DNA Extraction, Amplification, and Sequencing

Six Psammophaga specimens (Accession number: OQ845893, OQ845894, OQ845895, OQ845896, OQ845897, OQ845898) were extracted individually using guanidine lysis buffer [30]. Semi-nested PCR amplification was carried out for the 18S barcoding fragment of foraminifera [31] using primers s14F3 (ACGCAMGTGTGAAACTTG)-sB (TGATCCTTCTGCAGGTTCACCTAC) for the first and primers 14F1 (AAGGGCACCACAAGAACGC)-sB for the second amplification. Thirty-five and 25 cycles were performed for the first and the second PCR, with an annealing temperature of 50 °C and 52 °C, respectively. The amplified PCR products were purified using the High Pure PCR Cleanup Micro Kit (Roche Diagnostics). Sequencing reactions were performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and analyzed on a 3130XL Genetic Analyzer (Applied Biosystems). The resulting sequences were deposited in the NCBI/GenBank database. Isolate and accession numbers are specified in Table 2.

2.6. Phylogenetic Analysis

The obtained sequences were added to 20 sequences belonging to four different genera (Nellya, Niveus, Psammophaga, Vellaria,) that are part of the publicly available 18S database of monothalamid foraminifera (NCBI/Nucleotide; https://www.ncbi.nlm.nih.gov/nucleotide/ (accessed on 19 April 2023)). All sequences were aligned using the default parameters of the MUSCLE automatic alignment option, as implemented in SeaView vs. 4.3.3. [32]. The alignment contains 26 sequences with 1201 sites used for analysis.
The phylogenetic tree was constructed using maximum likelihood phylogeny (PhyML 3.0) as implemented in ATGC: PhyML [33,34]. An automatic model selection by SMS [35] based on Akaike Information Criterion (AIC) was used, resulting in a HKY85 + G substitution model being selected for the analysis. The initial tree is based on BioNJ. Bootstrap values (BV) are based on 100 replicates.

3. Results

Systematic description
Due to the ambiguous classification of the monothalamids, we opt to use the informal name Monothalamids Pawlowski et al. [36] instead of the formal term “Monothalamea” for this paraphyletic group, as suggested by Pawlowski et al. [36].
RHIZARIA Cavalier-Smith, 2002
RETARIA Cavalier-Smith, 1999
FORAMINIFERA d’Orbigny, 1826
Psammophaga, Arnold, 1982
Psammophaga secriensia Pavel, Kreuter and Holzmann sp. nov.
Zoobank Registration
urn: lsid: zoobank.org: act:4B4D99D8-E66B-43B8-96CA-5ADB44386627
Diagnosis:
The test is free and monothalamous, with an elongate to broadly pyriform shape, ranging from 569 µm to 750 µm in length, from 250 µm to 371 µm in width, and with a length/width ratio between 1.8 and 2.9. The aperture is simple and rounded, situated at the terminal end of a short neck that is directed distally. The organic test wall is transparent and delicate, with a smooth and shiny surface. In most specimens, few dispersed sediment particles adhere to it. No peduncle has been observed.
Type Material:
Holotype (accession number FORAM01) and paratype (accession number FORAM01_1) from station 100C, longitude 31°14′15″ E, latitude 44°40′30″ N, 48 m depth and paratypes (accession numbers FORAM01_2; FORAM01_3; FORAM01_4; and FORAM01_5) from station SU04, longitude 30°27′00″, latitude 44° 54′00″, 53 m depth are stored in 95% ethanol and deposited at the National Institute of Marine Geology and GeoEcology, Romania.
Other Material: Seven sequenced specimens (Accession numbers—OQ845891, OQ845892, from Balaklava Bay, OQ845893, OQ845894 from station 100C, OQ845895-OQ845898) from station SU04.
Etymology:
Named after the former director from NIRD GeoEcoMar Constanta Branch—Dan Secrieru, who supports genetic studies of foraminifera in the Black Sea.
Description:
The holotype FORAM01 has an elongate test measuring 582 µm in length and 250 µm in width (Figure 2 and Figure 3, Table 3) with a simple rounded terminal aperture located on a short neck that is directed distally. The aperture is flexible enough to allow the passage of sediment grains. The ingested mineral particles are distributed throughout the test interior. Inclusions consist of dark and light transparent particles identified as mica and quartz, respectively. The cell body does not fill entirely the test lumen. The organic test wall is thin and transparent, with a shiny surface, and sparsely dispersed sediment particles covering it. A peduncle could not be observed. The paratype FORAM01_1, which was also obtained from station 100C, measures 750 µm in length and 259 µm in width (Figure 4A, Table 3). Paratypes FORAM01_2, FORAM01_3, FORAM01_4, and FORAM01_5 were collected at station SU04 (Figure 4B,C, Table 3). They range from 569 µm to 637 µm in length and from 230 µm to 345 µm in width. All paratypes display a terminal rounded aperture placed on a short neck. The ingested mineral particles in the paratypes are concentrated at the adapertural region rather than being distributed throughout the entire test. The paratypes lack sediment particles adhering on their test wall. Sequenced specimens (Accession numbers OQ845893–OQ845898) range from 569 µm to 740 µm in length and 230 µm to 371 µm in width (Figure 5). Overall, specimens have a length between 569 µm and 750 µm (mean = 625 ± 67 µm, n = 12), a width between 250 µm and 371 µm (mean = 286 ± 47 µm, n = 12), and a length/width ratio between 1.8 and 2.9 (mean = 2.2 ± 0.5, n = 12) (Table 3).
Molecular characteristics
Psammophaga secriensia sp. nov. (91% BV) branches as sister to Psammophaga magnetica with moderate support (78% BV) (Figure 5). The partial SSU rRNA sequences contain 956–962 nucleotides, the GC content ranges from 45 to 46%.
Distribution:
Specimens were present in two sampling stations across the Romanian Black Sea continental shelf between the towns of Mangalia and Sulina and in the Balaklava Bay, Ukraine.
Habitat:
Specimens were sampled from the Modilula phaseolina habitat and in mixed sediments including mud, sand, and shells, in the offshore circalittoral marine environment at 48 m and 53 m depth. One specimen (Accession numbers—OQ845891, OQ845892) was collected from Balaklava Bay between 5 and 10 m depth in a previous sampling campaign (Gooday et al. [16], Figure 1). Bottom sediments in the Bay consist of sand, silt, pebbles and shell gravel [16].
Remarks:
Psammophaga secriensia sp. nov. differs from the type species, Psammophaga simplora in the general shape, which is elongate to broadly pyriform in the new species and pyriform to ovoidal in Psammophaga simplora. The latter species is also smaller, measuring less than 500 µm in length while Psammophaga secriensia sp. nov. measures from 569 µm to 750 µm in length. In Psammophaga simplora, mineral particles are concentrated around the apertural region while in Psammophaga secriensia sp. nov. inclusions are either distributed throughout the test interior or assembled around the adapertural part. Psammophaga simplora is finely agglutinated while Psammophaga secriensia sp. nov. has only a sparsely agglutinated test wall. A peduncle is absent in both species.
The new species can be distinguished morphologically from Psammophaga zirconia by the absence of a peduncle. Psammophaga zirconia has a pyriform, elongate or spherical shape and typically ranges in length from 200 µm to 700 µm [20], while Psammophaga secriensia sp. nov. is slightly larger, ranging in length from 569 µm to 750 µm.
Sergeeva et al. [13] identified Psammophaga sp. specimens from the northwestern Black Sea with a thicker agglutinated test and a cap-like form of the aperture, which are considerably smaller than Psammophaga secriensia sp. nov., ranging in length from 300 µm to 330 µm and in width from 115 µm to 145 µm.
Gooday et al. [16] described Psammophaga sp. from Kazachya Bay, which has a droplet-like shape compared to the elongate-pyriform shape of Psammophaga secriensia sp. nov. Psammophaga sp. is also smaller, measuring 270 µm to 470 µm in length, and sequenced specimens (FN995301, FN995303) show that it is a distinct species that does not branch with Psammophaga secriensia sp. nov. (Figure 6).
The morphology of Psammophaga sp. described by Pavel et al. [21] from the Romanian Continental Shelf closely resembles Psammophaga secriensia sp. nov. However, Psammophaga sp. of Pavel et al. [21] exhibits different dimensions in terms of length (719–1440 µm; mean = 894 ± 199 µm, n = 23), and width (462 µm to 765 µm; mean = 532 ± 93 µm, n = 23) compared to Psammophaga secriensia sp. nov. (length: 569 µm to 750 µm; width: 230–371 µm) (Table 3). A molecular analysis of Psammophaga sp. sensu Pavel et al. [21] will be needed to clarify whether this is a different species.
Phylogeny
The phylogenetic tree (Figure 6) contains 26 sequences of monothalamid foraminifera belonging to clade E as specified by Pawlowski et al. [36]. The new species also contains two sequences obtained from a specimen (Accession number OQ845891, OQ845892) sampled from Balaklava Bay on the Ukrainian side of the Black Sea. Psammophaga secriensia sp. nov. is well supported (86% BV) and branches as sister to Psammophaga magnetica with moderate support (78% BV). Four other Psammophaga species and Niveus flexilis branch at the base of the sister clade. Each species is strongly supported (100% BV), but relationships between these different taxa are not backed up by bootstrap values. Psammophaga zirconia (99% BV), Vellaria pellucida (70% BV) and Nellya rugosa (100% BV) branch at the base.

4. Discussion

In the Black Sea, monothalamous foraminifera thrive in coastal habitats, forming abundant populations with densities reaching hundreds of individuals per 0.001 m2 [9]. A recent study has shown that monothalamids in the Black Sea display population densities reaching up to 12.103 individuals/m2 at depths ranging from 41 to 60 m [21]. On the Crimean Peninsula, Psammophaga exhibits higher densities, with an average of 86,000 to 116,000 individuals/m2 [9,40]. Furthermore, the Crimean Peninsula has a particularly high diversity of monothalamid foraminifera, with over 20 species identified [8]. Psammophaga especially inhabits meiobenthic habitats in the southwestern region of Crimea, at a depth range of 142 to 260 m [15]. Additionally, specimens of this genus have been found in areas with methane seeps, at depths ranging from 77 to 172 m [40]. According to Sergeeva and Mazlumyan [40], it indicates that certain organisms such as gromiids, allogromiids, hydrozoa, nematodes, and polychaetes successfully adapted to survive in hypoxic/anoxic and sulfidic conditions within the Black Sea. This fauna is native to the region and not transported from nearby oxygenated areas.
The abundance of monothalamous foraminifera correlates with the availability of organic matter on the seafloor [15]. These foraminifera display opportunistic behavior, responding to pulses of high-quality organic carbon. This suggests a potential role for monothalamids as indicators of shallow-water benthic eutrophication [15].
The three Psammophaga species from the Black Sea for which sequences are available, Psammophaga secriensia sp. nov., Psammophaga zirconia, Psammophaga sp. of Gooday et al. [16], are not closely related (Figure 6). Psammophaga secriensia sp. nov. branches with Psammophaga magnetica [37] that was described from Admiralty Bay in West Antarctica and Psammophaga fuegia sampled from the Beagle Channel in South Chile [38,39], but the branching is not supported by bootstrap values. Psammophaga sp. [16] from Kazachya Bay and Psammophaga zirconia branch separately (Figure 6).
Psammophaga zirconia also occurs in the Mediterranean Sea and sequence data for Psammophaga sp., Sabbatini, Bartolini, and Morigi, 2016, show that this type is present in Southampton [16,20]. Psammophaga secriensia sp. nov. has so far only been sampled from the Black Sea continental shelf but our knowledge about its biogeographic distribution is restricted and additional investigations will be necessary to determine whether the new species is endemic.
To conclude, our results confirm the high diversity of Psammophaga and show that the Black Sea is a promising area for further research on monothalamid foraminifera.

Author Contributions

Conceptualization, A.B.P. and S.K.; methodology, A.B.P., S.K., M.H., J.P. and R.M.; software, A.B.P. and S.K.; validation, A.B.P., S.K., J.P. and M.H.; formal analysis, S.K. and M.H.; investigation, S.K., M.H. and J.P.; resources, A.B.P., M.H. and A.E.; data curation, A.B.P., S.K. and M.H.; writing—original draft preparation, A.B.P., S.K. and A.E.; writing—review and editing, A.B.P., S.K., M.H. and A.E.; visualization, A.B.P., S.K., R.M., M.H. and A.E.; supervision, A.B.P., S.K., M.H. and A.E.; project administration, A.B.P., S.K. and A.E.; funding acquisition, A.B.P., M.H. and A.E. All authors have read and agreed to the published version of the manuscript. Please view the CRediT taxonomy for the term explanation.

Funding

The research has received funding from the Romanian Ministry of Research in the framework of the CORE Program NUCLEU—PN 19.20.01.02 and PN 19.20.01.01 carried out by NIRD GeoEcoMar. Program Development of the National R&D system—AMBI AQUA—No. 23PFE. T., European Union’s Horizon 2020 BRIDGE-BS project under grant agreement no. 101000240 and DOORS project under grant agreement no. 101000518. The molecular work was supported by Schmidheiny Foundation grant (MH).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors would like to acknowledge the help provided by Mihaela Muresan for the collection and the demonstration regarding the handling of samples and data during the field trips. In addition, comments and suggestions given by anonymous reviewers are much appreciated for the improvement of this manuscript and author’s competencies.

Conflicts of Interest

The authors declare that there is no conflict of interest.

References

  1. Sabbatini, A.; Nardelli, M.P.; Morigi, C.; Negri, A. Contribution of soft-shelled monothalamous taxa to foraminiferal assemblages in the Adriatic Sea. Acta Protozool. 2013, 52, 181–192. [Google Scholar]
  2. Golemansky, V.G. Lagynis pontica n. sp., a new monothalamous rhizopod (Granuloreticulosea: Lagynidae) from the Black Sea littoral. Acta Zool. Bulg. 1999, 51, 3–13. [Google Scholar]
  3. Golemansky, V.G. Second observation of Paramphitrema pontica Valk.1970 (Rhizopoda: Gromiida) and supplement to their morphomentry. Acta Zool. Bulg. 1999, 51, 3–13. [Google Scholar]
  4. Anikeeva, O.V.; Sergeeva, N.G. Distribution of the foraminifera on the Crimean shelf (Black Sea). In Book of Abstracts, Conference on Ecology Problems of the Azov-Black Sea Basin: Modern State and Prediction, Sevastopol; 2001; pp. 42–44. (In Russian) [Google Scholar]
  5. Anikeeva, O.V. Monothalamous soft-shelled foraminifera in Sevastopol Bay (Crimea, the Black Sea). In Proceedings of the Biodiversity of Coastal Marine Ecosystems. Functional Aspects, High-Level Scientific Conference, Renesse, The Netherlands, 11–15 May 2003; pp. 69–70. [Google Scholar]
  6. Anikeeva, O.V. Modern state of the soft-shelled foraminiferal fauna in the Sevastopol area (Black Sea). In Proceedings of the IGCP 521 Second Plenary Meeting and Field Trip, Odessa, Ukraine, 20–28 August 2006; Astroprint: Odessa, Ukraine, 2006; pp. 15–16. [Google Scholar]
  7. Sergeeva, N.G. Meiobenthos of deep-water anoxic hydrogen sulphide zone of the Black Sea. In Oceanography of the Eastern Mediterranean and Black Sea: Similarities and Differences of Two Interconnected Basins; Yilmaz, A., Ed.; Tϋbitak Publ.: Ankara, Turkey, 2003; pp. 880–887. [Google Scholar]
  8. Revkov, N.K.; Sergeeva, N.G. Current state of the zoobenthos of the Crimean shores of the Black Sea. In International Workshop of the Black Sea Benthos; Öztürk, B., Mokievsky, V.O., Topaloğlu, B., Eds.; Turkish Marine Research Foundation: Istanbul, Turkey, 2004; pp. 189–217. [Google Scholar] [CrossRef] [Scilit]
  9. Sergeeva, N.G.; Anikeeva, O.V. New Black Sea foraminifera from the Allogromiidae family. In Fourth International Congress on Environmental Micropaleontology; Microbiology and Meiobenthology: Isparta, Turkey, 2004; pp. 179–180. [Google Scholar]
  10. Sergeeva, N.G.; Anikeeva, O.V.; Gooday, A.J. The monothalamous foraminiferan Tinogullmia in the Black Sea. J. Micropalaeontol. 2005, 24, 191–192. [Google Scholar] [CrossRef] [Scilit]
  11. Sergeeva, N.G.; Anikeeva, O.V.; Gooday, A.J. Soft-shelled monothalamous foraminifera from the oxic/anoxic interface (NW Black Sea). Micropaleontology 2010, 56, 393–407. [Google Scholar] [CrossRef] [Scilit]
  12. Gooday, A.J.; Anikeeva, O.V.; Sergeeva, N.G. Tinogullmia lukyanovae sp. nov. a monothalamous, organic-walled foraminiferan from the coastal Black Sea. J. Mar. Biol. Assoc. U. K. 2006, 86, 43–49. [Google Scholar] [CrossRef] [Scilit]
  13. Sergeeva, N.G.; Gooday, A.J.; Mazlumyan, S.A.; Kolesnikova, E.A.; Lichtschlag, A.; Kosheleva, T.N.; Anikeeva, O.V. Meiobenthos of the oxic/anoxic interface in the southwestern region of the Black Sea: Abundance and taxonomic composition. In Anoxia: Evidence for Eukaryote Survival and Paleontological Strategies; Cellular Origin, Life in Extreme Habitats and Astrobiology 21; Altenbach, A.V., Bernhard, J.M., Seckbach, J., Eds.; Springer: Hamburg, Germany, 2012; pp. 369–401. [Google Scholar]
  14. Sergeeva, N.G.; Anikeeva, O.V. Foraminifera. In Aspects of Classification, Stratigraphy, Ecology and Evolution, Chapter IX: Soft-Walled Foraminifera under Normoxia/Hypoxia Conditions in the Shallow Areas of the Black Sea; Georgescu, M.D., Ed.; Nova Science Publ. Inc.: Hauppauge, NY, USA, 2014; pp. 227–247. [Google Scholar]
  15. Anikeeva, O.V. Psammophaga simplora a foraminiferal species from the family Saccammidae new for the Black Sea. Vestn. Zool. 2005, 39, 67–69. (In Russian) [Google Scholar]
  16. Gooday, A.J.; Anikeeva, O.V.; Pawlowski, J. New genera and species of monothalamous foraminifera from Balaclava and Kazach’ya Bays (Crimean Peninsula, Black Sea). Mar. Biodivers. 2011, 41, 481–494. [Google Scholar] [CrossRef] [Scilit]
  17. Sergeeva, N.G.; Anikeeva, O.V. Goodayia rostellatum gen. nov. sp.n. (PROTOZOA)—A Monothalamous Foraminiferan Black Sea. Zoodiversity 2008, 42, e85–e89. [Google Scholar] [CrossRef] [Scilit]
  18. Sergeeva, N.G.; Anikeeva, O.V. Vellaria solenta (Monothalamea: Allogromiidae)—New species of soft-walled foraminifera from Sivash Bay (the Sea of Azov). Invertebr. Zool. 2021, 18, 152–158. [Google Scholar] [CrossRef] [Scilit]
  19. Anikeeva, O.V.; Sergeeva, N.G.; Gooday, A.J. Two new genera and species of the monothalamous foraminifera from coastal waters of the Black Sea. Mar. Biodivers. 2013, 43, 473–479. [Google Scholar] [CrossRef] [Scilit]
  20. Sabbatini, A.; Negri, A.; Bartolini, A.; Morigi, C.; Boudouma, O.; Dinelli, E.; Florindo, F.; Galeazzi, R.; Holzmann, M.; Lurcock, P.C.; et al. Selective zircon accumulation in a new benthic foraminifer, Psammophaga zirconia, sp. Nov. Geobiology 2016, 14, 404–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Pavel, A.B.; Menabit, S.; Pop, I.C. New records of soft-shelled monothalamous Foraminifera and gromiids on the Romanian Black Sea shelf. Biologia 2021, 76, 2241–2251. [Google Scholar] [CrossRef] [Scilit]
  22. Ross, D.A.; Uchupi, E.; Prada, K.E.; MacIlvaine, J.C. Bathymetry and microtopography of Black Sea. In The Black Sea—Geology, Chemistry and Biology; Degens, E.T., Ross, D.A., Eds.; AAPG Memoir 20: Tulsa, OR, USA, 1974; pp. 1–10. [Google Scholar]
  23. Vespremeanu, E. Geografia Mării Negre; University of Bucharest Publishing: Bucharest, Romania, 2004; pp. 1–234. (In Romanian) [Google Scholar]
  24. Bakan, G.; Büyükgüngör, H. The Black Sea. Mar. Pollut. Bull. 2000, 41, 24–43. [Google Scholar] [CrossRef] [Scilit]
  25. Kideys, A.E. Fall and Rise of the Black Sea Ecosystem. Science 2002, 297, 1482–1484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Friedrich, J.; Dinkel, C.; Friedl, G.; Pimenov, N.; Wijsman, J.; Gomoiu, M.T.; Cocias, A.; Popa, L.; Wehrli, B. Benthic Nutrient Cycling and Diagenetic Pathways in the North-Western Black Sea. Estuar. Coast. Shelf Sci. 2002, 54, 369–383. [Google Scholar] [CrossRef] [Scilit]
  27. Loeblich, A.J.R.; Tappan, H. Foraminiferal Genera and Their Classification; Van Nostrand Reinhold: New York, NY, USA, 1987; Volume 1–2. [Google Scholar] [CrossRef] [Scilit]
  28. Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Scilit]
  29. Sabbatini, A.; Pawlowski, J.; Gooday, J.; Andrew, P.S.; Bowser, S.S.; Morigi, C.; Negri, A. Vellaria zucchellii sp. nov. a new monothalamous foraminifer from Terra Nova Bay, Antarctica. Antarct. Sci. 2004, 16, 307–312. [Google Scholar] [CrossRef] [Scilit]
  30. Pawlowski, J. Introduction to the molecular systematics of Foraminifera. Micropaleontology 2000, 46, 1–12. [Google Scholar]
  31. Pawlowski, J.; Fahrni, J.F.; Brykczynska, U.; Habura, A.; Bowser, S.S. Molecular data reveal high taxonomic diversity of allogromiid foraminifera in Explorers Cove (McMurdo Sound, Antarctica). Polar Biol. 2002, 25, 96–105. [Google Scholar] [CrossRef] [Scilit]
  32. Pawlowski, J.; Holzmann, M. A Plea for DNA Barcoding of Foraminifera. J. Foraminifer. Res. 2014, 44, 62–67. [Google Scholar] [CrossRef] [Scilit]
  33. Gouy, M.; Guindon, S.; Gascuel, O. SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol. Biol. Evol. 2010, 27, 221–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Guindon, S.; Dufayard, J.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Lefort, V.; Longueville, J.E.; Gascuel, O. SMS: Smart Model Selection in PhyML. Mol. Biol. Evol. 2017, 34, 2422–2424. [Google Scholar] [CrossRef] [Scilit]
  36. Pawlowski, J.; Holzmann, M.; Tyszka, J. New supraordinal classification of Foraminifera: Molecules meet morphology. Mar. Micropaleontol. 2013, 100, 1–10. [Google Scholar] [CrossRef] [Scilit]
  37. Pawlowski, J.; Majewski, W. Magnetite-bearing foraminifera from Admiralty Bay, west Antarctica, with description of Psammophaga magnetica, sp. nov. J. Foramin Res. 2011, 41, 3–13. [Google Scholar] [CrossRef] [Scilit]
  38. Gschwend, F.; Majda, A.; Majewski, W.; Pawlowski, J. Psammophaga fuegia sp. nov., a New Monothalamid Foraminifera from the Beagle Channel, South America. Acta Protozool. 2016, 55, 101–110. [Google Scholar] [CrossRef]
  39. Pawlowski, J.; Holzmann, M.; Berney, C.; Fahrni, J.; Gooday, A.J.; Cedhagen, T.; Habra, A.; Bowser, S.S. The evolution of early Foraminifera. Proc. Natl. Acad. Sci. USA. 2003, 100, 11494–11498. [Google Scholar] [CrossRef] [Scilit]
  40. Sergeeva, N.G.; Mazlumyan, S.A. Deep-water hypoxic meiobenthic protozoa and metazoan taxa of the Istanbul Strait’s (Bosporus) outlet area of the Black Sea. Ecol. Montenegrina 2015, 2, 255–270. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Map of sampling locations on the Romanian continental shelf of the Black Sea.
Figure 1. Map of sampling locations on the Romanian continental shelf of the Black Sea.
Jmse 11 01546 g001
Figure 2. Psammophaga secriensia sp. nov. SEM images: (A) Holotype FORAM01, view of the whole specimen with sparse mineral grains adhering to the test surface. (B) Detail of aperture and test wall partly ripped open; the test is filled with organic matter and mineral grains, the latter whitish to greyish colored. Scale bars 200 µm.
Figure 2. Psammophaga secriensia sp. nov. SEM images: (A) Holotype FORAM01, view of the whole specimen with sparse mineral grains adhering to the test surface. (B) Detail of aperture and test wall partly ripped open; the test is filled with organic matter and mineral grains, the latter whitish to greyish colored. Scale bars 200 µm.
Jmse 11 01546 g002
Figure 3. Psammophaga secriensia sp. nov.: light microscopic images: (A) Holotype FORAM01 colored with Rose Bengal. (B) Specimen OQ845897. Ingested mineral grains are distributed throughout the test. Scale bars 200 µm.
Figure 3. Psammophaga secriensia sp. nov.: light microscopic images: (A) Holotype FORAM01 colored with Rose Bengal. (B) Specimen OQ845897. Ingested mineral grains are distributed throughout the test. Scale bars 200 µm.
Jmse 11 01546 g003
Figure 4. Psammophaga secriensia sp. nov. Light microscopic images: (A) Paratype specimen FORAM01_1. (B) Paratype specimens FORAM 01_2 and FORAM01_3. (C) Paratype specimen FORAM01_4 and FORAM01_5. Ingested mineral grains are accumulated more at the adapertural region and the end of the test. Scale bars 200 µm.
Figure 4. Psammophaga secriensia sp. nov. Light microscopic images: (A) Paratype specimen FORAM01_1. (B) Paratype specimens FORAM 01_2 and FORAM01_3. (C) Paratype specimen FORAM01_4 and FORAM01_5. Ingested mineral grains are accumulated more at the adapertural region and the end of the test. Scale bars 200 µm.
Jmse 11 01546 g004
Figure 5. Psammophaga secriensia sp. nov. Light microscopic images of sequenced specimens: (A) Specimen OQ845894. (B) Specimen OQ845896. (C) Specimen OQ845898. (D) Specimen OQ845895. Scale bars 200 µm.
Figure 5. Psammophaga secriensia sp. nov. Light microscopic images of sequenced specimens: (A) Specimen OQ845894. (B) Specimen OQ845896. (C) Specimen OQ845898. (D) Specimen OQ845895. Scale bars 200 µm.
Jmse 11 01546 g005
Figure 6. PhyML phylogenetic tree based on the 3′end fragment of the SSU rRNA gene, showing the evolutionary relationships of 26 foraminiferal sequences belonging to Clade E [16,20,37,38,39]. Specimens marked in bold indicate those for which sequences were acquired for the present study. The tree is unrooted. Specimens are identified by their accession numbers. Numbers at nodes indicate bootstrap values (BV). Only BV > 70% are shown.
Figure 6. PhyML phylogenetic tree based on the 3′end fragment of the SSU rRNA gene, showing the evolutionary relationships of 26 foraminiferal sequences belonging to Clade E [16,20,37,38,39]. Specimens marked in bold indicate those for which sequences were acquired for the present study. The tree is unrooted. Specimens are identified by their accession numbers. Numbers at nodes indicate bootstrap values (BV). Only BV > 70% are shown.
Jmse 11 01546 g006
Table 1. Summary of sampling parameters for stations where Psammophaga secriensia sp. nov. occurred. * Parameters for Balaklava Bay are from Gooday et al. [16] and given as ranges.
Table 1. Summary of sampling parameters for stations where Psammophaga secriensia sp. nov. occurred. * Parameters for Balaklava Bay are from Gooday et al. [16] and given as ranges.
StationDate Lat. °NLong. °EDepth
[m]
pHSalinity
[PSU]
Conductivity
[mS m−1]
Temperature °C
100C06/2144°40′30″31°14′15″488.518.6920.217.47
SU0408/2144°54′00″30°27′00″538.6618.7120.628.19
Balaklava Bay *06/0944°29′42″33°35′39″4−347.43−8.814.4−18.3N/A6.8−26.8
Table 2. Information on isolate and accession numbers and sampling locations of sequenced specimens. Psammophaga secriensia sp. nov. specimens (marked in bold) were investigated for the current study.
Table 2. Information on isolate and accession numbers and sampling locations of sequenced specimens. Psammophaga secriensia sp. nov. specimens (marked in bold) were investigated for the current study.
SpeciesIsolate NumberAccession NumberSampling Location
Psammophaga secriensia sp. nov.9486OQ845891, OQ845892Ukraine, Black Sea, Balaklava Bay
Psammophaga secriensia sp. nov.21476OQ845893Romania, Black Sea, MN219_100C
Psammophaga secriensia sp. nov.21480OQ845894Romania, Black Sea, MN219_100C
Psammophaga secriensia sp. nov.21482OQ845895Romania, Black Sea, MN222_SU04
Psammophaga secriensia sp. nov.21483OQ845896Romania, Black Sea, MN222_SU04
Psammophaga secriensia sp. nov.21484OQ845897Romania, Black Sea, MN222_SU04
Psammophaga secriensia sp. nov.21485OQ845898Romania, Black Sea, MN222_SU04
Psammophaga magnetica, Pawlowski and Majewski, 20112976FN995274Antarctica, Admiralty Bay
Psammophaga magnetica, Pawlowski and Majewski, 20113184FN995272Antarctica, Admiralty Bay
Psammophaga fuegia, Gschwend, Majda, Majewski, and Pawlowski, 201617392KU313692Chile, Patagonia
Psammophaga fuegia, Gschwend, Majda, Majewski, and Pawlowski, 201617510KU313694Chile, Patagonia
Psammophaga sp., Gooday et al., 201110102FN995301Ukraine, Black Sea, Kazachya Bay
Psammophaga sp., Gooday et al., 201110112FN995303Ukraine, Black Sea, Kazachya Bay
Psammophaga sapela, Altin-Ballero, Habura, and Goldstein, 2013231AJ317985USA, Sapelo Island
Psammophaga sapela, Altin-Ballero, Habura, and Goldstein, 2013not applicableHM584698USA, Sapelo Island
Psammophaga crystallifera, Dahlgren, 19622361FN995293Sweden, Tjaerno
Psammophaga crystallifera, Dahlgren, 19628145FN995300Antarctic Peninsula, King George Island
Niveus flexilis, Altin, Habura, and Goldstein, 2009RnGwhitealloEU213257USA, coastal Georgia
Niveus flexilis, Altin, Habura, and Goldstein, 20096RKF841626USA, coastal Georgia
Psammophaga zirconia, Sabbatini, Bartolini, and Morigi, 201618412LN886768, LN886769Italy, Adriatic Sea
Vellaria pellucida, Gooday and Fernando, 199210165FN995322Ukraine, Black Sea, Balaklava Bay
Vellaria pellucida, Gooday and Fernando, 199210168FN995327Ukraine, Black Sea, Balaklava Bay
Nellya rugosa, Gooday, Anikeeva, and Pawlowski, 201010153FN995337Ukraine, Black Sea, Balaklava Bay
Nellya rugosa, Gooday, Anikeeva, and Pawlowski, 201010154FN995331Ukraine, Black Sea, Balaklava Bay
Table 3. Morphological measurements for Psammophaga secriensia sp. nov.
Table 3. Morphological measurements for Psammophaga secriensia sp. nov.
SpeciesAccession NumberLength (µm)Width (µm)Sampling StationDepth (m)
Psammophaga secriensia sp. nov.Holotype FORAM01582250100C48
Paratype FORAM 01_1750259100C48
Paratype FORAM 01_2637345SUO453
Paratype FORAM 01_3587320SUO453
Paratype FORAM 01_4577275SUO453
Paratype FORAM 01_5569230SUO453
OQ845893666315100C48
OQ845894740259100C48
OQ845895573230SUO453
OQ845896569371SUO453
OQ845897637318SUO453
OQ845898597256SUO453
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pavel, A.B.; Kreuter, S.; Holzmann, M.; Enache, A.; Motoc, R.; Pawlowski, J. Psammophaga secriensia sp. nov., a New Monothalamid Foraminifera (Protista, Rhizaria) from the Romanian Black Sea Shelf. J. Mar. Sci. Eng. 2023, 11, 1546. https://doi.org/10.3390/jmse11081546

AMA Style

Pavel AB, Kreuter S, Holzmann M, Enache A, Motoc R, Pawlowski J. Psammophaga secriensia sp. nov., a New Monothalamid Foraminifera (Protista, Rhizaria) from the Romanian Black Sea Shelf. Journal of Marine Science and Engineering. 2023; 11(8):1546. https://doi.org/10.3390/jmse11081546

Chicago/Turabian Style

Pavel, Ana Bianca, Sylvain Kreuter, Maria Holzmann, Alin Enache, Rozalia Motoc, and Jan Pawlowski. 2023. "Psammophaga secriensia sp. nov., a New Monothalamid Foraminifera (Protista, Rhizaria) from the Romanian Black Sea Shelf" Journal of Marine Science and Engineering 11, no. 8: 1546. https://doi.org/10.3390/jmse11081546

APA Style

Pavel, A. B., Kreuter, S., Holzmann, M., Enache, A., Motoc, R., & Pawlowski, J. (2023). Psammophaga secriensia sp. nov., a New Monothalamid Foraminifera (Protista, Rhizaria) from the Romanian Black Sea Shelf. Journal of Marine Science and Engineering, 11(8), 1546. https://doi.org/10.3390/jmse11081546

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop