Next Article in Journal
Carbon Flux Dynamics and Response to Extreme High Temperature in Rice Ecosystems Across the Lower Reaches of the Yangtze River, China
Previous Article in Journal
Effect of Reduced Water Potential on Imbibition Curve and the Triphasic Pattern of Seeds in Solanaceae Species
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 16
Issue 5
10.3390/agriculture16050572
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Addition of Artificial Humic Substances to Artificial Seedling Substrate Can Improve Soil Properties and Rice Quality

by
Hui Qiao
1,2,
Fanyu Meng
1,2,
Husheng Xian
1,2,
Changyuan Wang
1,2,
Cheng Chang
1,2,
Sikai Huang
1,2,
Yongping Leng
1,2,
Yibo Lan
1,2 and
Fan Yang
1,2,*
1
School of Water Conservancy and Civil Engineering, Northeast Agricultural University, Harbin 150030, China
2
International Cooperation Joint Laboratory of Health in Cold Region Black Soil Habitat of the Ministry of Education, Harbin 150030, China
*
Author to whom correspondence should be addressed.
Agriculture 2026, 16(5), 572; https://doi.org/10.3390/agriculture16050572
Submission received: 3 February 2026 / Revised: 26 February 2026 / Accepted: 2 March 2026 / Published: 3 March 2026
(This article belongs to the Section Agricultural Soils)
Browse Figures
Review Reports Versions Notes

Abstract

The poor quality and scarcity of soil used for raising seedlings are key issues holding back the further development of the rice industry. Artificial humic substances (A-HS) and artificial soils are attracting increasing attention due to their cost-effectiveness and significant potential to improve rice cultivation. This study used native soil (NS), engineered soil (ES) and rice straw to create artificial substrates (AES and ANS) using humification–hydrothermal carbonization technology (24 h treatment of NS and ES with rice straw at 200 °C and 2 MPa). Experiments on cultivation of the rice seedlings were conducted using initial soils (ES and NS) and artificial soils with addition of A-HS (AES+A-HS and ANS+A-HS). This study examined the nutrient content and microbial environment of the seedling substrates as well as the changes in growth and development of the rice seedlings. The combination of rice straw biochar in artificial soils (AES and ANS) with A-HS significantly increased the content of soil organic carbon (SOC) and enhanced the nutrient levels, such as total nitrogen and available phosphorus. Furthermore, it enhanced the microbial diversity, and it increased the abundance of microorganisms such as Actinomycetota, Chloroflexota, and Basidiomycota, thereby improved the soil microbial environment. An enhanced soil nutrient content and improved microbial environment effectively promoted the rice seedling growth. Compared to the original soils (ES and NS), before transplanting to paddy fields, the stem width of the seedlings increased by 5.1% (AES+A-HS) and 10.2% (ANS+A-HS), and their height increased by 18.7% (AES+A-HS) and 4.5% (ANS+A-HS). The rice seedling emergence increased by 6.1% (AES+A-HS) and 3.9% (ANS+A-HS), and the transplant survival rate also increased by 4.1% (AES+A-HS) and 2.9% (ANS+A-HS). This study provides an effective approach to alleviating the scarcity of rice seedling substrates and improving the quality of rice seedlings, and it provides an effective foundation for increasing the yield of rice.

1. Introduction

Rice is one of the world’s most important staple crops, and rice production is important for ensuring food security [1,2]. Seedling substrates are the most critical element in modern rice production. They play an indispensable role in seedling cultivation by providing physical support for growth and delivering essential nutrients and moisture. High-quality substrates create an optimal environment for root development during the early growth stages, thereby promoting robust seedling growth and development [3]. In recent years, the continuous development of mechanized rice production has led to the adoption of rice machine transplanting technology; this refers to the technique of using rice transplanters to transfer standardized seedlings, which have been cultivated in seedling trays, into farmland according to specific requirements. It has reduced the labor intensity and saved time, while increasing yields and improving quality [4]. With the rise of centralized rice transplanting in mechanized production, the demand for seedling substrates is increasing [5]. However, as soils become increasingly degraded, soils that meet the criteria for rice nursery soils are becoming increasingly scarce [6]. Many farmers have started using native soils that have been piled up for many years as rice seedling substrate, leading to issues such as an inconsistent soil quality, increased pest and disease incidence, and reduced rice yields. Additionally, large-scale soil extraction causes severe environmental problems [7]. Thus, finding alternative seedling substrate sources and exploring methods to improve them is crucial for lowering rice production costs, enhancing environmental conditions, and boosting the rice yield and quality.
Humic substances (HS) are the most important and effective component of organic matter in soil, which has a great influence on soil fertility and nutrient retention [8]. According to the International Humic Substances Society (IHSS), HS are complex heterogeneous mixtures of polydisperse materials formed by a humification process, in which chemical and biochemical reactions occur during the decomposition of plant and microbial residues. In recent years, a large number of studies have demonstrated the significant positive effect of HS on the soil structure and plant growth [9,10]. Applying HS improves the effectiveness of soil nutrients, increases the SOC and nutrient content, and has a positive effect on the soil’s physical, chemical, and biological properties [11]. HS act as plant biostimulants, positively influencing growth and regulating nutrient cycling [12]. Their redox buffering effect also promotes microbial growth and metabolism. However, in the absence of external factors, the formation of natural HS is a slow process [13]. Therefore, the over-exploitation of natural HS is unscientific, which makes finding natural HS substitutes particularly crucial. Building on hydrothermal carbonization technology [14], we proposed a hydrothermal humification (HTH) synthesis strategy [15]. Under 200 °C and 2 MPa conditions, AHS can be produced within 24 h. The resulting A-HS exhibits high similarity in both structure and functionality with the HS extracted from the black soil of the Northeast China Black Soil Region [15]. We also proposed humification–hydrothermal carbonization (HTH-HTC) technology. This technology involved a 24 h treatment at 200 °C and 2 MPa, using rice straw and degraded soil (soil with extremely low organic matter content) as raw materials, with the addition of KOH as a catalyst to accelerate the reaction. After mixing and maturation, artificial soil is synthesized. This technology can not only quickly restore degraded soils but also enable the green recycling of agricultural waste like straw [16]. The increased organic matter content in artificial soil effectively improved the soil-water holding capacity, enhanced the soils’ capacity to absorb nutrients and significantly improved the quality of the cultivated rice seedlings [17,18]. Although the application of A-HS and the use of HTH-HTC technology have shown notable effects in enhancing soil quality and crop growth, to our knowledge, no studies have explored the combined application of A-HS and artificial seedling substrates for cultivating rice seedlings.
This study used native soil (NS) and engineered soil (ES), as well as rice straw, all of which were collected from Qianjin Farm in Jiamusi, China, in order to prepare artificial soils (ANS and AES) via HTH-HTC technology. In terms of soil type, both NS and ES belong to “Phaeozems” (WRB, 2006). NS was directly collected from conventional paddy fields at Qianjin Farm, while ES refers to discarded soil generated during engineering construction at Qianjin Farm. Experiments were conducted to cultivate rice seedlings using ANS and AES as substrates, to which A-HS was added. This study analyzed changes in the structure and nutrient content of the artificial substrates, as well as the quality of the seedlings at various growth stages and nutrient levels. The aim was to explore the combined application of A-HS and artificial soils for enhancing the quality of seedling substrates and promoting the growth of rice seedlings.

2. Materials and Methods

2.1. Test Sites and the Preparation of A-HS and Artificial Soils

The experiment was conducted in a standardized seedling greenhouse at Qianjin Farm in Heilongjiang Province, China (47°34′ N, 132°17′ E). This region is one of the most important areas for rice production in China, with a typical temperate continental monsoon climate. The A-HS used in the experiment was prepared using rice straw as the raw material and the one-step HTH technology proposed by our research group [15]. Pure water, rice straw powder, and KOH were added to a polytetrafluoroethylene-lined stainless steel autoclave at a mass ratio of 40:5:1, and the reactor was heated at 200 °C for 24 h. After the temperature naturally cooled to room temperature, the solid–liquid product was separated by a vacuum filtration machine (NanBei, SHZ-DIII, Zhengzhou, China) to isolate the solid from the liquid. The resulting liquid was acidified to pH = 3 with 6.0 mol/L HCl, filtered, and then dried in an oven (YiHeng, DHG-9010, Shanghai, China) at 60 °C to finally obtain A-HS. The seedling substrates ANS and AES were prepared using HTH-HTC technology [18]. In this study, ES and NS are used as raw soil, and dried straw powder and KOH are used as auxiliary raw materials. Among these, KOH acts as a catalyst to accelerate the reaction. Pure water, NS/ES, rice straw powder, and KOH were added to a polytetrafluoroethylene-lined stainless-steel autoclave at a mass ratio of 40:10:5:1, and the reactor was heated at 200 °C and 2 MPa for 24 h. The obtained solid–liquid products were separated using a centrifuge. Subsequently, the solid portion was dried in an oven (YiHeng, DHG-9010, Shanghai, China) at 60 °C. The dried solid was ground and uniformly mixed with the original soil (ES and NS) at a 1:1 ratio, followed by maturation for 28 days to obtain the artificial seedling substrates (AES and ANS). The basic indicators of NS and ES used in this study, as well as those of the generated ANS and AES, are shown in Table 1.

2.2. Experimental Design

The experiment began in April 2025 and ran for a total of 35 days. The experiment consisted of two treatment groups (AES+A-HS and ANS+A-HS) and two control groups (ES and NS), each of which was replicated three times. Seedling trays measuring 60 cm × 30 cm × 3 cm were selected for cultivating the rice seedlings. Each tray was filled with 2.5 kg of soil (NS, ES, ANS and AES) as the seedling substrate, with a substrate thickness of 2.5 cm. The rice seeds were prepared by cleaning, drying, selecting, soaking and germinating them before sowing them at an amount of 80 g per tray. After sowing, the concentration of the A-HS solution was adjusted to 500 mg/L and sprayed onto the experimental groups [19]. Following extensive experimentation and analysis, it was determined that the amount of diluted A-HS liquid to be sprayed per tray was 20 mL [20]. The concentration and application amount of A-HS used in this study have already demonstrated favorable results in prior research [19,20]. The temperature was maintained at 25–30 °C during rice cultivation, and the trays were regularly watered. Rice seedlings from each treatment group were collected at the one-leaf-one-heart stage, the two-leaves-one-heart stage, and the stage before transplanting for quality and nutrient analysis. The structure and nutrient properties of the artificial seedling substrates were also compared with NS and ES.

2.3. Rice Seedling Analysis

According to the description of rice growth stages by BBCH (Biologische Bundesanstalt, Bundessortenamt und CHemische Industrie) [21,22], the five-point sampling method was adopted to conduct focused observations on rice seedlings at BBCH 11, BBCH 12, and BBCH 13 stages. To more vividly describe these three growth stages, we defined BBCH 11, BBCH 12, and BBCH 13 as the one-leaf-one-heart stage, the two-leaves-one-heart stage, and the before transplanting stage, respectively. The height and width of the stems of the seedlings were measured using a ruler and vernier calipers, and the average value was recorded. The chlorophyll content was determined spectrophotometrically. Fresh rice leaves were thoroughly ground with a small amount of quartz sand and calcium carbonate powder. After adding 2 mL of acetone, the mixture was left to turn white to yield the chlorophyll extract. The absorbance values of the extract were measured at 662 nm and 645 nm, and the chlorophyll a and b contents were calculated accordingly [23]. The total nitrogen content of the seedlings was determined using the Kjeldahl method [24]. The total and available phosphorus content of the seedlings was determined using an auto discrete chemical analyzer (Auto Smartchem 200, Beijing, China) [25,26].

2.4. Soil Analysis

Soil samples were taken from a 1 cm depth below the rice seedlings, and the soil organic carbon (SOC) content was determined using a total organic carbon analyzer (Shimadzu TOC-L CPN, Kyoto, Japan) [27]. The total nitrogen content of the soil was determined using the Kjeldahl method [24]. The soil samples were digested at a high temperature using concentrated sulfuric acid and then analyzed using a Kjeldahl nitrogen analyzer (KjelROC, Opseth, Lund, Sweden). The total and available phosphorus content of the soil was determined using an auto discrete chemical analyzer (Auto Smartchem 200, Beijing, China). The determination of Residual-P, NaOH-P, HCl-P, NaHCO3-P, and Residual-P in soil followed the modified Hedley phosphorus fractionation method, using sequential extraction to distinguish different phosphorus fractions [28]. Soil bulk density and porosity were measured using the core method [29]. A soil sample was collected using a ring knife of known volume, filling it completely. After drying and weighing, the soil’s bulk density was calculated. Porosity was determined by combining oven-drying, weighing, and the principles of saturation and drainage. Soil pH was measured at a 1:5 soil-to-water ratio using a calibrated pH meter (PHS-3E, Shanghai Leici, Shanghai, China) [30]. The cation exchange capacity (CEC) was measured with the sodium acetate method [31]. Firstly, 5 g soil was mixed with sodium acetate solution. Subsequently, excess sodium ions were removed by washing with absolute ethanol. Next, an ammonium acetate solution was added to replace the adsorbed sodium ions with ammonium ions. Each step was repeated three times. After shaking for 10 min, the mixture was centrifuged until the supernatant became clear. Finally, the concentration of displaced sodium ions was measured by flame photometry, and the cation exchange capacity was calculated based on the sodium concentration.

2.5. Soil Microbial Community Analysis

This study used high-throughput sequencing technology to analyze the composition and diversity of soil bacterial and fungal communities in ES, NS, ANS+A-HS and AES+A-HS employing 16S rRNA and 18S rRNA gene amplification techniques [32]. Microbial DNA was extracted using the MP FastDNA Spin Kit (MP Biomedicals, Solon, OH, USA) according to the instructions. A NanoDrop 2000 spectrophotometer was employed to assess the concentration and purity of the extracted DNA. And the quality was verified via 1% agarose gel electrophoresis. Specific primers were utilized for the amplification of bacterial 16S rRNA (338F: ACTCCTACGGGAGGCAGCAG; 806R: GGACTACHVGGGTWTCTAAT) and fungal 18S rRNA (SSU0817F: TTAGCATGGAATAATRRAATAGGA; 1196R: TCTGGACCTGGTGAGTTTCC). The PCR reaction conditions were as follows: predenaturation at 95 °C for 3 min, denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 45 s, and retention at 72 °C for 10 min. The purified PCR products were sequenced on the Illumina MiSeq PE300 platform. After purification, equimolar concentrations of amplicons were pooled and sequenced on an Illumina MiSeq platform, adhering to the standard protocols set by Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China). Raw fastq files were quality-filtered in Trimmomatic and merged via FLASH. The data were processed using the Majorbio Cloud online platform (www.majorbio.com).

2.6. Correlation and Statistical Analysis

Statistical analyses were performed with SPSS (Statistical Product and Service Solutions) version 19, while figures were generated using Origin 2022. Error analysis was based on three or more experimental replicates. Correlation analysis and the relationship between variables were examined using Pearson’s correlation coefficient, plotted with Origin 2022’s correlation plot plug-in.

3. Results

3.1. Physical–Chemical Properties of Seedling Substrates

Figure 1 presents the key physical–chemical properties of the original seedling substrates (NS and ES) and modified substrates (ANS+A-HS and AES+A-HS). As Figure 1a shows, compared to NS and ES, the soil bulk density of the ANS+A-HS and AES+A-HS decreased by 9.1% and 6.5%, respectively. Figure 1b shows that the pH values of NS, ES, ANS+A-HS and AES+A-HS exhibited weakly acidic conditions. This weakly acidic environment promotes nutrient uptake by rice seedlings and supports their growth and development [6]. Figure 1c,d indicate that compared to the original seedling substrates (NS and ES), ANS+A-HS and AES+A-HS exhibited significant increases in both total porosity and ventilation porosity. Specifically, ANS+A-HS achieved a total porosity and ventilation porosity of 83.2% and 61.3% respectively, while AES+A-HS exhibited increases of 12.13% and 6.87% in these parameters. Increased porosity promotes air and water exchange with the external environment.
SEM images (Figure 2) revealed the morphologies of the original (ES and NS) and artificial (AHS and AES) seedling substrates. The surfaces of NS and ES are smooth, with occasional sheet-like fractures. In contrast, the surfaces of ANS and AES feature numerous flocculants formed by bonding and irregular particles of varying sizes. This is related to the adherent hydrochar particles generated on the surface during the HTH-HTC process. The increased organic carbon content in ANS and AES is mainly attributed to the formation of hydrochar particles during the HTH-HTC process.

3.2. Nutrient Contents of Seedling Substrates

The carbon, nitrogen and phosphorus content of the seedling substrate has an important effect on seedling quality [6,33]. Figure 3 shows the main nutrient content of the control groups (NS and ES) and the experimental groups (ANS+A-HS and AES+A-HS). Figure 3a,b show the total phosphorus and available phosphorus content in the seedling substrates, respectively. Compared to the control group, the total phosphorus content in the experimental group substrates increased slightly but not significantly. However, the available phosphorus content showed a marked increase: ANS+A-HS reached 103.6 mg/kg, while AES+A-HS contained 68.4 mg/kg. Furthermore, to clarify the composition and availability of phosphorus in the seedling substrates, the phosphorus fractionation method proposed by Hedley was employed for analysis [22], with the results shown in Figure 4. Among the fractions, H2O-P and NaHCO3-P exhibited the highest availability and were most readily utilized by plants. NaOH-P is considered a moderately available phosphorus fraction, while HCl-P is regarded as a stable phosphorus form with low plant availability. Residual-P is the most stable and least accessible. The concentrations of H2O-P, NaHCO3-P and Residual-P significantly increased in the artificial seedling substrates, while the levels of NaOH-P and HCl-P remained virtually unchanged (Figure 4a). The proportions of H2O-P and NaHCO3-P within the artificial seedling substrates were markedly higher than those in NS and ES, while the proportions of NaOH-P, HCl-P, and Residual-P were slightly lower than those in NS and ES. (Figure 4b). Figure 3c shows that the total nitrogen content of the ANS+A-HS and AES+A-HS increased significantly compared to the original substrates. The total nitrogen content increased to 3.1 g/kg in the ANS+A-HS and to 2.1 g/kg in the AES+A-HS. As Figure 3d shows, the organic carbon content of ANS and AES with A-HS applied increased significantly compared to the original NS and ES. The organic carbon content increased from 1.9% to 3.7% for the ANS+A-HS and from 1.3% to 2.5% for the AES+A-HS.

3.3. Growth of Rice Seedlings

The stem width and plant height were measured at the one-leaf-one-heart stage and the two-leaves-one-heart stage, as well as before transplanting. The emergence of rice seedlings and their survival rate after transplanting were also measured, and the results are shown in Figure 5.
As shown in Figure 5a, the rice seedling emergence rate was 95.3% in the AES+A-HS and 89.3% in the NS+A-HS, which were both significantly higher than in the control group (NS and ES). Figure 5b shows that the survival rate of the rice seedlings after transplantation was higher in both experimental groups, indicating a superior seedling quality and an increased capacity to survive in the experimental treatments. Figure 5c,d reveal seedling development through plant height and stem width at different growth stages. Compared to the control group, both experimental groups exhibited a significant increase in plant height and stem width. The NS+A-HS had the highest plant height (21.1 cm) and stem width (11.9 mm) before transplanting.
To illustrate the growth of rice seedlings in each treatment group at different stages more clearly, the growth at critical periods was photographed and recorded, as shown in Figure 6. Figure 6a shows the rice seedlings at the one-leaf-one-heart and two-leaves-one-heart stages, and Figure 6b shows the rice seedlings before transplanting. Compared with the control group, the rice seedlings in the AES+A-HS and ANS+A-HS experimental groups exhibited more vigorous growth. Additionally, Figure 6c records the root systems of the control group and experimental group rice seedlings before transplanting. The root systems of the AES+A-HS and ANS+A-HS were more developed than those of the control group and exhibited a better root morphology. Based on the above analysis, the development of rice seedlings in the experimental group was significantly better than that in the control group. This confirms that the combined application of artificial substrate and A-HS promotes the growth of rice seedlings.

3.4. Quality of Rice Seedling

The nutrient content of rice seedlings one week after transplanting was analyzed. The nitrogen and phosphorus content as well as the total chlorophyll content were measured separately. The results are shown in Figure 7.
As can be seen from Figure 7a,b, there was no significant difference in the total phosphorus content of rice shoots and roots in the experimental groups (AES+A-HS, ANS+A-HS), while the total nitrogen content was significantly higher as compared to the control group. The highest total nitrogen and total phosphorus contents were found in the rice of ANS+A-HS. Chlorophyll is an important pigment involved in photosynthesis in the chloroplasts of green plants, and it plays an important role in energy capture and energy transfer in photosynthesis, which is an important factor in determining the crop yield [34,35]. The ANS+A-HS exhibited chlorophyll a and b contents of 1.1 and 0.4 mg/g FW, respectively. Similarly, the AES+A-HS exhibited significantly higher levels of chlorophyll, with chlorophyll a and chlorophyll b contents of 1.0 and 0.3 mg/g FW, respectively.

3.5. Soil Microbial Diversity

Soil microorganisms play a pivotal role in the soil environment, significantly influencing factors such as soil structural stability, carbon sequestration capacity and crop productivity [36,37]. This study analyzed the composition of the microbial community in ES, NS, ANS+A-HS and AES+A-HS. The richness, evenness, and diversity of the bacterial communities are shown in Figure 8a,b. The ACE (Abundance-based Coverage Estimator) index (Kruskal–Wallis test) reflects community richness. Richness in AES+A-HS was lower than in ES, while the richness in ANS+A-HS was higher than NS. A higher Shannon index value indicates greater community diversity. The diversity in AES+A-HS and ANS+A-HS were both higher than in ES and NS (Kruskal–Wallis test). In addition, PCoA based on the Bray–Curtis distance was performed to analyze the bacterial community structure (Figure 8c). The first two axes accounted for 52.9% and 14.0% of the total variation, respectively. The richness, evenness, and diversity of the fungal communities are shown in Figure 8d,e. The ACE index of AES+A-HS was lower than ES, while the ACE index of ANS+A-HS was higher than NS (Kruskal–Wallis test). The trend of the Shannon index is broadly consistent with that of the ACE index. PCoA based on the Bray–Curtis distance was performed to analyze the fungal community structure (Figure 8f). The first two axes accounted for 32.9% and 14.9% of the total variation, respectively. The dominant bacterial phyla in ES, NS, ANS+A-HS, and AES+A-HS were Pseudomonadota (47.9%, 49.4%, 45.8%, 39.0%), Actinomycetota (8.5%, 10.8%, 12.2%, 9.4%), Chloroflexota (8.7%, 4.1%, 10.1%, 16.4%), and Bacteroidota (6.3%, 11.8%, 8.2%, 6.9%) respectively (Figure 8g). Compared to NS, the relative abundance of Actinomycetota and Chloroflexota in ANS+A-HS increased by 1.4% and 6.0%, respectively. Compared to ES, the relative abundance of Actinomycetota and Chloroflexota in AES+A-HS increased by 0.9% and 7.7%, respectively. As shown in Figure 8h, the dominant fungal phyla in ES, NS, ANS+A-HS, and AES+A-HS were Ascomycota (76.1%, 88.5%, 80.1%, 77.3%), Basidiomycota (5.1%, 3.5%, 10.1%, 7.9%) and Chytridiomycota (5.9%, 3.9%, 7.4%, 7.8%). Compared to NS, the relative abundance of Basidiomycota and Chytridiomycota in ANS+A-HS increased by 6.6% and 3.5%, respectively. Compared to ES, the relative abundance of Basidiomycota and Chytridiomycota in AES+A-HS increased by 2.8% and 1.9%, respectively.
Based on the analysis of rice seedlings and seedling substrates from Section 3.1, Section 3.2, Section 3.3 and Section 3.4, the nutrient content of the seedling substrate, the physical and chemical properties of the seedling substrate, and the nutrient and chlorophyll content of the rice seedlings are all closely related to rice seedling quality. As shown in Figure 9, there is a significant correlation between the main key factors and rice seedling quality. The analysis results indicate that the rice transplant survival rate and emergence rate are negatively correlated with bulk density and pH values. The rice transplant survival rate and emergence rate are significantly positively correlated with soil total porosity and soil total nitrogen (p < 0.001). The rice transplant survival rate and emergence rate are positively correlated with soil available phosphorus, total nitrogen in the rice roots and shoots, the amounts of chlorophyll a and b in the rice, rice plant height and stem width (0.001 < p < 0.01). There was a generally positive correlation between the rice transplant survival rate and emergence rate and soil total organic carbon (0.01 < p < 0.05).

4. Discussion

4.1. The Combined Effect of A-HS and Rice Straw-Derived Hydrochar in Artificial Seedling Substrates on Physico-Chemical Properties

The combination of A-HS and rice straw-derived hydrochar in artificial seedling substrates significantly reduced the soil bulk density of original soils (ES and NS) and increased the porosity of original soils (ES and NS) while maintaining weak acidity. The phenolic and carboxylic components of A-HS determine its ability to modify the soil pH [38]. Similar in structure to natural humic substances, A-HS can bind dispersed soil particles together to form branched aggregates containing many empty matrices that provide space for soil aeration and water permeability [39]. There were also significant changes in the nitrogen and phosphorus content of the substrates, particularly in total nitrogen and available phosphorus. Furthermore, levels of H2O-P and NaHCO3-P in the substrates increased significantly. Additionally, A-HS has a high nitrogen content. When added into the soil, it can significantly increase its nitrogen content [40]. Previous studies [41] have shown that A-HS can influence the content and activity of phosphorus in soil. It effectively increases the amount of available phosphorus, thereby preventing excessive fixation of phosphorus by soil minerals and promoting the activation of soil reactive phosphorus. Large amounts of hydrothermal carbon particles formed in the soil surface layer during the HTH-HTC process significantly increased the SOC content. The high organic carbon content of A-HS further enhances SOC levels. The HTH-HTC process forms more stable structures through chelation, effectively preventing soil nitrogen loss. Overall, the combination of A-HS and artificial seedling substrates effectively supplements SOC and the nitrogen and phosphorus contents, while improving the availability of phosphorus.

4.2. The Combined Effect of A-HS and Rice Straw-Derived Hydrochar in Artificial Seedling Substrates on Microbial Communities

Compared with NS, ANS+A-HS exhibited increased bacterial and fungal richness and diversity, as well as greater stability in the diversity of the microbial community. In AES+A-HS, the richness of soil bacteria and fungi declined, leading to a reduction in their diversity. β-diversity analysis revealed significant differences in species composition among the ES, NS, AES+A-HS and ANS+A-HS microbial communities. Analysis of the taxonomic composition of the bacterial communities revealed that the dominant phyla in four types of seedling substrates did not differ much, and all of them were Pseudomonadota, Actinomycetota, Chloroflexota and Bacteroidota. The bacterial community structure in ANS+A-HS and AES+A-HS changed significantly compared with the original seedling substrates (NS and ES), especially in terms of relative abundance. The relative abundance of Actinomycetota and Chloroflexota increased significantly in the artificial seedling substrates (ANS+A-HS and AES+A-HS). Actinomycetota play a crucial role in soil carbon cycling, soil structure formation and ecosystem health. Actinomycetota are generally considered to possess competitive advantages under stress conditions, participate in the decomposition of soil humus and other resistant SOM, and make profound contributions to lignocellulosic degradation genes. They can also form symbiotic relationships with plants or act as beneficial rhizosphere microorganisms to promote growth [42]. ANS+A-HS and AES+A-HS contain more substrates required for microbial decomposition, directly stimulating the metabolic activity and growth of Actinomycetota. Furthermore, the soil structure of ANS+A-HS and AES+A-HS was improved, creating a physical environment that is conducive to the extension and colonization of Actinomycetota mycelium within the soil particle network. This gives Actinomycetota a competitive advantage in terms of spatial competition. Chloroflexota play a pivotal role in the carbon cycle, capable of fixing carbon dioxide through photosynthesis. Chloroflexota secrete vast quantities of extracellular polysaccharides [43]. These viscous substances significantly improve soil aggregate stability and enhance its structure and water retention capacity. ANS+A-HS and AES+A-HS are rich in organic acids, which are readily utilized by Chloroflexota, thereby stimulating their growth and reproduction. As for fungi, the dominant fungal phyla in four types of seedling soils were Ascomycota, Basidiomycota and Chytridiomycota. The relative abundance of Basidiomycota and Chytridiomycota in ANS+A-HS and AES+A-HS showed a significant increase. Basidiomycota perform vital ecological functions in soil. They do this primarily by efficiently decomposing plant debris and lignocellulose, which promotes the accumulation and transformation of soil organic matter [44]. Some fungi in this phylum form symbiotic relationships with plant root systems. This enhances the plants’ ability to absorb water and nutrients, accelerating their growth rate [45]. The high organic matter content in ANS+A-HS and AES+A-HS can increase the relative abundance of Basidiomycota, which is consistent with conclusions from previous researchers [46]. Chytridiomycota perform vital ecological functions in soil through various processes, such as decomposing organic matter, promoting nutrient cycling, suppressing pathogens and maintaining the ecological balance. These activities have a positive impact on soil health and agricultural production. Similar to Basidiomycota, the high organic matter content in ANS+A-HS and AES+A-HS also significantly enhances the abundance of Chytridiomycota.

4.3. The Combined Effect of A-HS and Rice Straw-Derived Hydrochar in Artificial Seedling Substrates on Rice Seedling Growth

The quality of seedlings is a direct reflection of the effectiveness of cultivation. This study investigated the combined effect of A-HS and artificial seedling substrates on rice seedling growth. The pH of ANS+A-HS and AES+A-HS was 5–6, an ideal range for seedling growth. SOC is vital for soil health, improving the structure, enhancing quality, and boosting crop yields [47,48]. During the preparation of the artificial seedling substrate, a large amount of hydrothermal carbon particles was generated, which increased the SOC content. The addition of A-HS further enriched the SOC levels, contributing to a better seedling quality. The nutrients in the seedling substrates are also a key factor affecting seedling growth. In ANS+A-HS and AES+A-HS, the nitrogen and phosphorus content increased compared to the control groups (NS and ES), with a particularly significant rise in available phosphorus. The results in Figure 4 indicate that the levels of H2O-P and NaHCO3-P in ANS+A-HS and AES+A-HS were significantly elevated. H2O-P represents mobile phosphorus that can be directly absorbed and utilized by crops, while NaHCO3-P represents unstable phosphorus exhibiting high bioavailability [49]. In the ANS+A-HS and AES+A-HS, the increase in nutrient content and the enhancement of nutrient availability promoted plant nutrient uptake, thereby effectively stimulating rice growth and root elongation. Well-developed roots and stems promoted chlorophyll accumulation, improving photosynthetic efficiency and further enhancing seedling quality [50].

5. Conclusions

This study used artificial soil supplemented with A-HS as a rice seedling substrate. Compared to the original seedling substrates (NS and ES), the total porosity of ANS+A-HS and AES+A-HS increased by 7.8% and 12.13%, respectively, while the bulk density decreased by 9.1% and 6.5%, respectively. A significant amount of hydrothermal carbon particles was generated during the preparation of artificial seedling substrates, which increased the SOC content. The high organic carbon and nitrogen content of A-HS further increased both the SOC and nitrogen content after its application. Additionally, A-HS promoted the activation of soil reactive phosphorus, significantly increasing the content of available phosphorus fractions such as H2O-P and NaHCO3-P. An enhanced nutrient availability promotes the uptake of nutrients by rice. Adding A-HS creates a mildly acidic environment that is conducive to rice growth and development. Acting as both a plant growth regulator and a crop growth stimulator, A-HS effectively promotes root development, chlorophyll accumulation and photosynthetic efficiency, while also improving the seedling quality. The combined application of A-HS and artificial soil increased the abundance of beneficial microbial groups such as Actinobacteria and Basidiomycota, effectively promoting the improvement of the microbial environment. In summary, using artificial soil as the seedling substrate for rice seedlings and supplementing it with A-HS can effectively improve the seedling quality, laying a solid foundation for increased rice yields. This approach also effectively addresses the shortage of high-quality rice seedling substrates.

Author Contributions

H.Q.: Conceptualization, Data Curation, Formal Analysis, Writing—Original Draft. F.M.: Software, Supervision, Writing—Review and Editing. H.X.: Conceptualization, Visualization, Writing—Review and Editing. C.W.: Data Curation, Validation, Software. C.C.: Software, Supervision, Writing—Review and Editing. S.H.: Formal Analysis, Software, Methodology. Y.L. (Yongping Leng): Investigation, Methodology, Writing—Review and Editing. Y.L. (Yibo Lan): Data Curation, Investigation, Supervision, Writing—Review and Editing. F.Y.: Funding Acquisition, Project Administration, Resources. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Postdoctoral Fellowship Program of CPSF under Grant Number GZC20251607, the China Postdoctoral Science Foundation under Grant Number 2025MD774053, the National Key Research and Development Program of China under Grant Number 2022YFD1500100 and the National Natural Science Foundation of China under Grant Number 52279034.

Data Availability Statement

The data presented in this study are openly available in Mendeley Data at https://data.mendeley.com/datasets/6kd6p2h6hx/1 (accessed on 2 February 2026).

Acknowledgments

We sincerely thank the reviewers for their dedication to our article. The academic experience of reviewers has brought us great convenience.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Abbreviations

The following abbreviations are used in this manuscript:
A-HSArtificial humic substances
NSNative soil
ESEngineered soil
ANSArtificial native soil
AESArtificial engineered soil
HTH-HTCHydrothermal humification–hydrothermal carbonization
SOCSoil organic carbon
HSHumic substances
IHSSInternational Humic Substances Society
HTHHydrothermal humification
BBCHBiologische Bundesanstalt, Bundessortenamt und CHemische Industrie
SPSSStatistical Product and Service Solutions
ACEAbundance-based Coverage Estimator

References

  1. Zhang, L.; Zhang, F.; Zhang, K.; Wang, Y.; Agathokleous, E.; Fang, C.; Zhang, Z.K.; Wei, H.Y.; Huo, Z.Y. Nitrogen and organic matter managements improve rice yield and affect greenhouse gas emissions in China’s rice-wheat system. Field Crops Res. 2025, 326, 109838. [Google Scholar] [CrossRef]
  2. Yang, X.; Song, Z.; Van Zwieten, L.; Guo, L.; Chen, J.; Luo, Z.; Wang, Y.D.; Luo, Y.; Wang, Z.G.; Wang, W.Q.; et al. Significant accrual of soil organic carbon through long-term rice cultivation in paddy fields in China. Glob. Change Biol. 2024, 30, e17213. [Google Scholar] [CrossRef]
  3. He, W.J.; He, B.; Wu, B.Y.; Wang, Y.H.; Yan, F.Y.; Ding, Y.F.; Li, G.H. Growth of tandem long-mat rice seedlings using controlled release fertilizers: Mechanical transplantation can be more economical and high yielding. J. Integr. Agric. 2023, 22, 3652–3666. [Google Scholar] [CrossRef]
  4. Guru, P.K.; Sahu, P.; Shukla, P.; Diwan, P.; Panwar, J.; Tiwari, P.; Nagori, A.; Carpenter, G.; Sanodiya, R.; Meena, B.S.; et al. A critical review on rice cultivation and mechanization level in Indian perspective. Results Eng. 2025, 26, 105632. [Google Scholar] [CrossRef]
  5. Qin, C.; Kan, X.Y.; Xu, D.L.; Zhao, Y.; Qi, Y.; Wu, N.; Xu, W.L. Adjustable P(AM-co-NIPAM)/gelatin hydrogel soilless cultivation substrates for soybean seedling and root growth. Ind. Crops Prod. 2024, 231, 121189. [Google Scholar] [CrossRef]
  6. Varghese, E.M.; Kour, B.; Ramya, S.; Krishna, P.D.; Nazla, K.A.; Sudheer, K.; Anith, K.N.; Jisha, M.S.; Ramakrishnan, B. Rice in acid sulphate soils: Role of microbial interactions in crop and soil health management. Appl. Soil Ecol. 2024, 196, 105309. [Google Scholar] [CrossRef]
  7. Ajith, S.; Vijayakumar, S.; Elakkiya, N. Yield prediction, pest and disease diagnosis, soil fertility mapping, precision irrigation scheduling, and food quality assessment using machine learning and deep learning algorithms. Discov Food 2025, 5, 67. [Google Scholar] [CrossRef]
  8. Dou, S.; Shan, J.; Song, X.Y.; Cao, R.; Wu, M.; Li, C.L.; Song, G. Are humic substances soil microbial residues or unique synthesized compounds? A perspective on their distinctiveness. Pedosphere 2020, 30, 159–167. [Google Scholar] [CrossRef]
  9. Rose, M.T.; Patti, A.F.; Little, K.R.; Brown, A.L.; Jackson, W.R.; Cavagnaro, T.R. Chapter Two—A Meta-Analysis and Review of Plant-Growth Response to Humic Substances: Practical Implications for Agriculture. Adv. Agron. 2014, 124, 37–89. [Google Scholar]
  10. Nardi, S.; Pizzeghello, D.; Muscolo, A.; Vianello, A. Physiological effects of humic substances on higher plants. Soil Boil. Biochem. 2002, 34, 1527–1536. [Google Scholar] [CrossRef]
  11. Guo, X.X.; Liu, H.T.; Wu, S.B. Humic substances developed during organic waste composting: Formation mechanisms, structural properties, and agronomic functions. Sci. Total Environ. 2019, 662, 501–510. [Google Scholar] [CrossRef]
  12. Tiwari, J.; Ramanathan, A.; Bauddh, K.; Korstad, J. Humic substances: Structure, function and benefits for agroecosystems-a review. Pedosphere 2023, 33, 237–249. [Google Scholar] [CrossRef]
  13. Dou, S.; Zhang, Y.F.; Shan, J.; Wu, M.; Ma, R.; Guan, S.; Jia, Z.J. Soil organic matter revisited: Why humic substances still matter? Pedosphere 2026, 36, 6–11. [Google Scholar] [CrossRef]
  14. Polomino, A.; Slodczyk, A.; Canizarès, A.; Champallier, R.; Bostyn, S.; Raymundo-Piñero, E. Monitoring the hydrothermal carbonization of biomass derived compounds by in-situ high-temperature-high-pressure Raman spectroscopy. Carbon 2026, 251, 121360. [Google Scholar] [CrossRef]
  15. Yang, F.; Zhang, S.S.; Cheng, K.; Antonietti, M. A hydrothermal process to turn waste biomass into artificial fulvic and humic acids for soil remediation. Sci. Total Environ. 2019, 686, 1140–1151. [Google Scholar] [CrossRef]
  16. Yang, F.; Fu, Q.; Antonietti, M. Anthropogenic, Carbon-Reinforced Soil as a Living Engineered Material. Chem. Rev. 2023, 123, 2420–2435. [Google Scholar] [CrossRef]
  17. Yang, F.; Zhang, S.S.; Fu, Q.; Antonietti, M. Conjugation of artificial humic acids with inorganic soil matter to restore land for improved conservation of water and nutrients. Land Degrad. Dev. 2020, 31, 884–893. [Google Scholar] [CrossRef]
  18. Yang, F.; Lan, Y.B.; Li, R.H.; Fu, Q.; Cheng, K.; Liu, Z.Q.; Antonietti, M. Anthropogenic soil as an environmental material, as exemplified with improved growth of rice seedlings. Carbon Res. 2024, 3, 46. [Google Scholar] [CrossRef]
  19. Yuan, Y.; Liu, Q.Y.; Zhang, S.; Liu, Z.; Zhang, X.; Cheng, K.; Yang, F. Exogenous application of artificial humic substance can improve black soil properties and rice yield. Pedosphere 2025, 35, 504–515. [Google Scholar] [CrossRef]
  20. Yuan, Y.; Gai, S.; Tang, C.Y.; Jin, Y.X.; Cheng, K.; Antonietti, M.; Yang, F. Artificial humic acid improves maize growth and soil phosphorus utilization efficiency. Appl. Soil Ecol. 2022, 179, 104587. [Google Scholar] [CrossRef]
  21. Wang, B.; Liu, Y.; Sheng, Q.H.; Li, J.; Tao, J.H.; Yan, Z.J. Rice Phenology Retrieval Based on Growth Curve Simulation and Multi-Temporal Sentinel-1 Data. Sustainability 2022, 14, 8009. [Google Scholar] [CrossRef]
  22. Lancashire, P.D.; Bleiholder, H.; Boom, T.V.D.; Langelüddeke, P.; Stauss, R.; Weber, E.; Witzenberger, A. A uniform decimal code for growth stages of crops and weeds. Ann. Appl. Biol. 1991, 119, 561–601. [Google Scholar] [CrossRef]
  23. Fernández-León, M.F.; Lozana, M.; Ayuso, M.C.; Fernández-León, A.M.; González-Gómez, D. Fast and accurate alternative UV-chemometric method for the determination of chlorophyll A and B in broccoli (Brassica oleracea Italica) and cabbage (Brassica oleracea Sabauda) plants. J. Food Compos. Anal. 2010, 23, 809–813. [Google Scholar] [CrossRef]
  24. Li, Y.Z.; Song, D.P.; Dang, P.F.; Wei, L.N.; Qin, X.L.; Siddique, K. Combined ditch buried straw return technology in a ridge–furrow plastic film mulch system: Implications for crop yield and soil organic matter dynamics. Soil Tillage Res. 2020, 199, 104596. [Google Scholar] [CrossRef]
  25. Ma, S.C.; Guo, R.; Wang, Y.; Yan, Y.; Chu, Q.W.; Cui, N.; Zhang, Y.F.; Zhang, L.; Jiang, L.; Shi, L.X.; et al. Nitrogen and phosphorus addition affected soil organic carbon storage and arbuscular mycorrhizal fungi contributions. J. Environ. Manag. 2025, 393, 126904. [Google Scholar] [CrossRef]
  26. Webb, B.; Adeloju, S. Evaluation of some wet digestions methods for reliable determination of total phosphorus in Australian soils. Microchem. J. 2013, 111, 47–52. [Google Scholar] [CrossRef]
  27. Pan, X.F.; Li, H.; Zhao, L.X.; Yang, X.R.; Su, J.Q.; Dai, S.Q.; Ning, J.; Li, C.X.; Cai, G.J.; Zhu, G.F. Response of syntrophic bacterial and methanogenic archaeal communities in paddy soil to soil type and phenological period of rice growth. J. Clean. Prod. 2021, 278, 123418. [Google Scholar] [CrossRef]
  28. Li, L.; Liang, X.Q.; Ye, Y.S.; Zhao, Y.; Zhang, Y.X.; Jin, Y.; Yuan, J.L.; Chen, Y.X. Effects of repeated swine manure applications on legacy phosphorus and phosphomonoesterase activities in a paddy soil. Biol. Fertil. Soils 2015, 51, 167–181. [Google Scholar] [CrossRef]
  29. AL-Shammary, A.A.G.; Kouzani, A.Z.; Kaynak, A.; Khoo, S.Y.; Norton, M.; Gates, W. Soil Bulk Density Estimation Methods: A Review. Pedosphere 2018, 28, 581–596. [Google Scholar] [CrossRef]
  30. Liu, B.S.; Huang, L.H.; Zhang, F.Y.; Cai, J.H.; Tian, L.; Jiang, X.T.; Liang, Y.P.; Zhu, G.; Huang, G.Z. High pH decreases the contents of stable organic nitrogen fractions and nitrogen supply capacity by inhibiting soil organic carbon in saline-sodic paddy fields. Soil Tillage Res. 2026, 258, 107018. [Google Scholar] [CrossRef]
  31. Meimaroglou, N.; Mouzakis, C. Cation Exchange Capacity (CEC), texture, consistency and organic matter in soil assessment for earth construction: The case of earth mortars. Constr. Build. Mater. 2019, 221, 27–39. [Google Scholar] [CrossRef]
  32. Oros-Sichler, M.; Gomes, N.; Neuber, G.; Smalla, K. A new semi-nested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities. J. Microbiol. Methods 2006, 65, 63–75. [Google Scholar] [CrossRef]
  33. Zheng, S.M.; Xia, Y.H.; Hu, Y.J.; Chen, X.B.; Rui, Y.C.; Gunina, A.; He, X.Y.; Ge, T.D.; Wu, J.S.; Su, Y.R.; et al. Stoichiometry of carbon, nitrogen, and phosphorus in soil: Effects of agricultural land use and climate at a continental scale. Soil Tillage Res. 2021, 209, 104903. [Google Scholar] [CrossRef]
  34. Marahatta, S.; Sah, S.K.; McDonald, A.; Timsina, J.; Devkota, K.P. Improving soil health and crop productivity through conservation agriculture and nitrogen management in rice-mustard-maize systems. Field Crops Res. 2025, 325, 109825. [Google Scholar] [CrossRef]
  35. Mokhtari, A.; Yang, H.B.; Croft, H.; Luca, S.V.; Li, F.; Minceva, M.; Schmidthalter, U.; Yu, K. Satellite-based winter wheat yield estimation with a newly parameterized LUE model based on crop water status and leaf chlorophyll content. Field Crops Res. 2025, 333, 110106. [Google Scholar] [CrossRef]
  36. Geng, G.P.; Gu, Q.; Zhou, H.K.; Zhang, B.; He, Z.X.; Zheng, R.L. Random forest model that incorporates solar-induced chlorophyll fluorescence data can accurately track crop yield variations under drought conditions. Ecol. Inform. 2025, 85, 102972. [Google Scholar] [CrossRef]
  37. Zhang, Y.; Shangguan, Z.P. Long-term N addition accelerated organic carbon mineralization in aggregates by shifting microbial community composition. Agric. Ecosyst. Environ. 2023, 342, 108249. [Google Scholar] [CrossRef]
  38. Fan, J.L.; Jin, H.; Zhang, C.H.; Zheng, J.J.; Zhang, J.; Han, G.D. Grazing intensity induced alternations of soil microbial community composition in aggregates drive soil organic carbon turnover in a desert steppe. Agric. Ecosyst. Environ. 2021, 313, 107387. [Google Scholar] [CrossRef]
  39. Piccolo, A.; Pietramellara, G.; Mbagwu, J. Effects of coal derived humic substances on water retention and structural stability of Mediterranean soils. Soil Use Manag. 1996, 12, 209–213. [Google Scholar] [CrossRef]
  40. Ai, S.; Zhang, Z.X.; Wang, X.B.; Meng, X.H.; Gao, Q.H.; Liu, Z.Q.; Yang, F.; Cheng, K. Coupling mechanism of methane production and carbon fixation regulated by artificial humic acid in paddy soils: Insights into microbial communities and metabolic pathways. Environ. Sci. Technol. 2025, 59, 15777–15791. [Google Scholar] [CrossRef]
  41. Mamedov, A.I.; Bar-Yosef, B.; Levkovic, I.; Rosenberg, R.; Silber, A.; Fine, P.; Levy, G.J. Amending soil with sludge, manure, humic acid, orthophosphate and phytic acid: Effects on aggregate stability. Soil Res. 2014, 52, 317–326. [Google Scholar] [CrossRef]
  42. Wang, X.Q.; Muhmood, A.; Dong, R.J.; Wu, S.B. Synthesis of humic-like acid from biomass pretreatment liquor: Quantitative appraisal of electron transferring capacity and metal-binding potential. J. Clean. Prod. 2020, 255, 120243. [Google Scholar] [CrossRef]
  43. Kimaro, O.D.; Desie, E.; Verbist, B.; Kimaro, D.N.; Vancampenhout, K.; Feger, K.H. Soil organic carbon stocks and fertility in smallholder indigenous agroforestry systems of the North-Eastern mountains, Tanzania. Geoderma Reg. 2024, 36, e00759. [Google Scholar] [CrossRef]
  44. Meng, W.S.; An, N.; Guan, S.; Dou, S.; Zhang, B.W.; Zhu, W.J.; Yue, J.H. Unraveling mechanisms of carbon enrichment via straw and biochar application to enhance soil fertility and improve maize yield. Eur. J. Agron. 2025, 169, 127673. [Google Scholar] [CrossRef]
  45. Teng, Z.D.; Zhu, J.; Shao, W.; Zhang, K.Y.; Li, M.; Whelan, M.J. Increasing plant availability of legacy phosphorus in calcareous soils using some phosphorus activators. J. Environ. Manag. 2019, 256, 109952. [Google Scholar] [CrossRef] [PubMed]
  46. Fan, H.M.; Wang, X.W.; Sun, X.; Li, Y.Y.; Sun, X.Z.; Zheng, C.S. Effects of humic acid derived from sediments on growth, photosynthesis and chloroplast ultrastructure in chrysanthemum. Sci. Hortic. 2014, 177, 118–123. [Google Scholar] [CrossRef]
  47. Zhi, Y.C.; Li, X.N.; Lian, F.; Wang, C.X.; White, J.C.; Wang, Z.Y.; Xing, B.S. Nanoscale iron trioxide catalyzes the synthesis of auxins analogs in artificial humic acids to enhance rice growth. Sci. Total Environ. 2022, 848, 157536. [Google Scholar] [CrossRef]
  48. Ren, H.; Huang, B.L.; Fernandez-Garcia, V.; Miesel, J.; Yan, L.; Lv, C. Biochar and rhizobacteria amendments improve several soil properties and bacterial diversity. Microorganisms 2020, 8, 502. [Google Scholar] [CrossRef]
  49. Daassi, R.; Khasa, D.P.; Stevanovic, T. Effect of ramial chipped wood and poultry manure amendments on soil chemical properties and fungal communities in Benin. Soil Tillage Res. 2024, 237, 105974. [Google Scholar] [CrossRef]
  50. Lai, J.Y.; Palaniveloo, K.; Sharma, S.; Zakaria, R.M.; Cheah, W. Influence of stand age on sediment bacterial communities in restored mangrove forests. Ecol. Indic. 2025, 173, 113316. [Google Scholar] [CrossRef]
Agriculture 16 00572 g001
Figure 1. Changes in basic physical and chemical indexes of seedling substrates: (a): bulk density, (b): pH, (c): total porosity, (d): ventilation porosity.
Figure 1. Changes in basic physical and chemical indexes of seedling substrates: (a): bulk density, (b): pH, (c): total porosity, (d): ventilation porosity.
Agriculture 16 00572 g001
Agriculture 16 00572 g002
Figure 2. Surface morphology of seedling substrates: (a): NS, (b): ES, (c): ANS, (d): AES.
Figure 2. Surface morphology of seedling substrates: (a): NS, (b): ES, (c): ANS, (d): AES.
Agriculture 16 00572 g002
Agriculture 16 00572 g003
Figure 3. Changes in nutrient indexes of seedling substrates: (a): total phosphorus, (b): available phosphorus, (c): total nitrogen, (d): total organic carbon. Note: Different letters in the graph represent significant differences (p < 0.05).
Figure 3. Changes in nutrient indexes of seedling substrates: (a): total phosphorus, (b): available phosphorus, (c): total nitrogen, (d): total organic carbon. Note: Different letters in the graph represent significant differences (p < 0.05).
Agriculture 16 00572 g003
Agriculture 16 00572 g004
Figure 4. Changes in soil phosphorus fractions of seedling substrates: (a): the content of phosphorus components, (b): the proportion of phosphorus components. Note: Different letters in the graph represent significant differences (p < 0.05).
Figure 4. Changes in soil phosphorus fractions of seedling substrates: (a): the content of phosphorus components, (b): the proportion of phosphorus components. Note: Different letters in the graph represent significant differences (p < 0.05).
Agriculture 16 00572 g004
Agriculture 16 00572 g005
Figure 5. Analysis of rice seedling growth at different stages: (a): the rate of seedling emergence, (b): the transplant survival rate, (c): the plant height, (d): the stem width. Note: Different letters in the graph represent significant differences (p < 0.05).
Figure 5. Analysis of rice seedling growth at different stages: (a): the rate of seedling emergence, (b): the transplant survival rate, (c): the plant height, (d): the stem width. Note: Different letters in the graph represent significant differences (p < 0.05).
Agriculture 16 00572 g005
Agriculture 16 00572 g006
Figure 6. Growth of seedlings at different stages: (a): growth characteristics of rice seedlings during the one-leaf-one-heart and two-leaves-one-heart stages, (b): growth characteristics of rice seedlings before transplanting, (c): root development of rice seedlings.
Figure 6. Growth of seedlings at different stages: (a): growth characteristics of rice seedlings during the one-leaf-one-heart and two-leaves-one-heart stages, (b): growth characteristics of rice seedlings before transplanting, (c): root development of rice seedlings.
Agriculture 16 00572 g006
Agriculture 16 00572 g007
Figure 7. Changes in nutrient indexes of rice seedlings: (a): the content of total phosphorus, (b): the content of total nitrogen, (c): the content of chlorophyll. Note: Different letters in the graph represent significant differences (p < 0.05).
Figure 7. Changes in nutrient indexes of rice seedlings: (a): the content of total phosphorus, (b): the content of total nitrogen, (c): the content of chlorophyll. Note: Different letters in the graph represent significant differences (p < 0.05).
Agriculture 16 00572 g007
Agriculture 16 00572 g008
Figure 8. Comparison of the α-diversity indices through (a) bacterial ACE index, (b) bacterial Shannon index, and (c) beta diversity of soil bacterial communities, (d) fungal ACE index, (e) fungal Shannon index, and (f) beta diversity of soil fungal communities. The relative abundance of major bacterial taxonomic groups at the phylum level (g). The relative abundance of major fungal taxonomic groups at the phylum level (h). Significant differences are shown with * (p < 0.05).
Figure 8. Comparison of the α-diversity indices through (a) bacterial ACE index, (b) bacterial Shannon index, and (c) beta diversity of soil bacterial communities, (d) fungal ACE index, (e) fungal Shannon index, and (f) beta diversity of soil fungal communities. The relative abundance of major bacterial taxonomic groups at the phylum level (g). The relative abundance of major fungal taxonomic groups at the phylum level (h). Significant differences are shown with * (p < 0.05).
Agriculture 16 00572 g008
Agriculture 16 00572 g009
Figure 9. Correlation analysis between key factors and seedling quality (the symbol * represents a significant difference (0.01 < p < 0.05), the symbol ** indicates a highly significant difference (0.001 < p < 0.01) and the symbol *** indicates the highest significant difference (p < 0.001)).
Figure 9. Correlation analysis between key factors and seedling quality (the symbol * represents a significant difference (0.01 < p < 0.05), the symbol ** indicates a highly significant difference (0.001 < p < 0.01) and the symbol *** indicates the highest significant difference (p < 0.001)).
Agriculture 16 00572 g009
Table 1. Basic indicators of NS, ES, ANS and AES.
Table 1. Basic indicators of NS, ES, ANS and AES.
Soil TypepH/KClTOC
(%)		CEC
(cmol(+)/kg)		Total Nitrogen
(g/kg)		Total
Phosphorus
(g/kg)
NS5.431.8924.682.482.59
ES6.561.2725.391.361.98
ANS5.997.9527.782.593.13
AES7.046.9829.681.462.78
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Qiao, H.; Meng, F.; Xian, H.; Wang, C.; Chang, C.; Huang, S.; Leng, Y.; Lan, Y.; Yang, F. The Addition of Artificial Humic Substances to Artificial Seedling Substrate Can Improve Soil Properties and Rice Quality. Agriculture 2026, 16, 572. https://doi.org/10.3390/agriculture16050572

AMA Style

Qiao H, Meng F, Xian H, Wang C, Chang C, Huang S, Leng Y, Lan Y, Yang F. The Addition of Artificial Humic Substances to Artificial Seedling Substrate Can Improve Soil Properties and Rice Quality. Agriculture. 2026; 16(5):572. https://doi.org/10.3390/agriculture16050572

Chicago/Turabian Style

Qiao, Hui, Fanyu Meng, Husheng Xian, Changyuan Wang, Cheng Chang, Sikai Huang, Yongping Leng, Yibo Lan, and Fan Yang. 2026. "The Addition of Artificial Humic Substances to Artificial Seedling Substrate Can Improve Soil Properties and Rice Quality" Agriculture 16, no. 5: 572. https://doi.org/10.3390/agriculture16050572

APA Style

Qiao, H., Meng, F., Xian, H., Wang, C., Chang, C., Huang, S., Leng, Y., Lan, Y., & Yang, F. (2026). The Addition of Artificial Humic Substances to Artificial Seedling Substrate Can Improve Soil Properties and Rice Quality. Agriculture, 16(5), 572. https://doi.org/10.3390/agriculture16050572

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop