Effects of Low-Protein Diet Supplemented with Fermented Feed on Meat Quality, Fatty Acid Composition, and Gut Microbiota in Growing–Fattening Pigs

Abstract

Fermented feed has considerable potential as a high-quality protein source in animal production. This research aimed to examine the effects of a low-protein (LP) diet, supplemented with fermented feed, on the meat quality and intestinal health of growing–fattening pigs. The pigs were randomly divided into three groups, and a total of 72 growing–fattening pigs were subjected to the experiment. They were fed the control (CON) diet, LP diet, and LP diet supplemented with fermented rapeseed meals and fermented distiller’s grains (FLP), respectively. The results indicated that the FLP diet altered the structure of the intestinal microbiota and regulated the composition of unsaturated fatty acids in the longissimus dorsi. Furthermore, the FLP diet upregulated the expression of genes associated with myosin heavy chain isoforms (p < 0.05) and modified the content of short-chain fatty acids in the intestines (p < 0.05). In summary, the addition of fermented distiller’s grains (FDGs) and fermented rapeseed meals (FRMs) to the LP diet enhanced fatty acid metabolism and intestinal barrier function in growing–fattening pigs.

1. Introduction

Pork is a vital source of nutrition for humans and constitutes a significant portion of global animal products [1]. The replacement of protein sources has been shown to enhance meat quality, as the gut microbiota influences the propionate-mediated peroxisome proliferator-activated receptor (PPAR) signaling pathway in response to dietary alterations [2]. Furthermore, the type of protein source included in the diet does not negatively impact meat quality [3,4].

In recent years, the establishment and development of ideal amino acid profiles, along with advancements in synthetic amino acid production technology, have made the formulation of low-protein (LP) diets and their application in animal production significant areas of research. LP diets modulate muscle fiber characteristics, intramuscular fat (IMF) content, fatty acid composition, and amino acid content, thereby improving meat quality [5]. Additionally, LP diets lead to a reduction in nitrogen emissions from growing pigs [6].

Fermented rapeseed meals (FRMs) are rich in protein and amino acids, positioning them as a major protein source for animals and a viable alternative to soybean meals in animal diets [7,8]. A dietary intervention with 8% FRMs resulted in a significant increase in lactic acid bacteria populations within piglet feces, while concurrently reducing the populations of Clostridium perfringens and Escherichia coli and enhancing the levels of albumin (ALB) and total protein (TP) in the plasma of piglets while decreasing the levels of low-density lipoprotein (LDL), total cholesterol (TC), and triglycerides (TG) [9]. Furthermore, the incorporation of 10% FRMs into the diets of weaned piglets resulted in a reduction in the incidence of diarrhea, the regulation of intestinal inflammatory responses, and improvements in both the plasma and intestinal antioxidant status of the piglets [10].

Currently, the application of fermented distiller’s grains (FDGs) in animal production has focused primarily on ruminants and poultry, with limited research conducted on pigs [11,12,13,14]. The supplementation of distiller’s grains has been demonstrated to positively impact the intestinal health of pigs, demonstrating a positive correlation between the concentration of short-chain fatty acids (SCFAs) and the quantity of FDGs incorporated into their diet [14]. Furthermore, including 15% FDGs in the diet increased the abundance of nonpathogenic bacteria while reducing the presence of pathogenic bacteria in the colonic microbiota, indicating that the addition of FDGs significantly improved the intestinal health of pigs [15].

Overall, fermented rapeseed meals and fermented distiller’s grains present considerable potential in animal production, as it not only enhances the growth performance and feed efficiency of animals but also improves their intestinal health and meat quality. Consequently, this study aims to investigate the effects of incorporating fermented feed into LP diets on the carcass traits, meat quality, fatty acid composition, and microbiota of growing–fattening pigs. Additionally, we aimed to examine the differences in gene expression related to muscle type and SCFAs in the intestines under various treatment conditions.

2. Materials and Methods

This study was performed according to the Regulations for the Administration of Affairs Concerning Experimental Animals. The procedure of the slaughter trial was approved by the Institute Ethics Committee of the Chongqing Academy of Animal Science (Approval Code: XKY-20231109). The preparation of fermented feed and animal trials were both conducted in 2023.

2.1. Fermentative Processing

The production of FRMs involved mixing rapeseed meals, wheat bran, and water at a ratio of 55:15:35. The fermentation inoculant consisted of Lactiplantibacillus plantarum and Candida tropicalis, with inoculation rates of 1% and 2%, respectively. The enzyme preparation included acidic protease (FDG-3004, Sunson Biotechnology, Beijing, China, 100,000 U/g), cellulase (SDG-2425, Sunson Biotechnology, 10,000 U/g), β-glucanase (SDG-2402 Sunson Biotechnology, 50,000 U/g), xylanase (SDG-2409, Sunson Biotechnology, 30,000 U/g), and brown sugar, with addition rates of 0.5%, 0.3%, 0.1%, 0.1%, and 1%, respectively. The mixture underwent anaerobic fermentation for 7 days.

The production of FDGs involves mixing distiller’s grains, wheat bran, and water at a ratio of 85:15:24. The mixture was subjected to ammonization with ammonia water for 24 h. After this period, 30% water, 5% Candida tropicalis, 1% Bacillus subtilis, and 0.7% cellulase (SDG-2425, Sunson Biotechnology, 10,000 U/g) were added. The mixture was then fermented aerobically for 48 h. Finally, the mixture was supplemented with 1% Lactiplantibacillus plantarum and 0.3% pectinase (SDG-2450, Sunson Biotechnology, 30,000 U/g), followed by anaerobic fermentation for 4 days.

2.2. Experimental Design

The experiment employed a completely randomized design. A total of 72 Landrace × Rongchang pigs, with similar body weights (31.20 ± 0.06 kg) and an equal distribution of males and females, were divided into three groups, each consisting of 24 pigs (with 6 replicates per group and 4 pigs per replicate). The trial lasted a total of 80 days, which included an adaptation period of 3 days and a treatment period of 77 days. During the growing phase, the CON group received a basic diet containing 15.15% crude protein (CP); the LP group was fed LP diet contained 12.56% CP; and the FLP group was given LP diet supplemented with 10.00% FRMs and 5.00% FDGs, which contained 12.61% CP. In the fattening phase, the CON group was fed a basic diet containing 12.91% CP; the LP group received LP diet containing 10.43% CP; and the FLP group was given an LP diet supplemented with 4.50% FRMs and 5.00% FDGs, which contained 10.41% CP. The basic diet was an antibiotic-free meal formulation designed according to the “Nutritional Requirements of Swine” (GB/T 39235-2020) [16]. Diets were as shown in

Table 1. Diet ingredients and compositions (as-fed basis).

Items	Growing Period 3			Fattening Period 3
	CON	LP	FLP	CON	LP	FLP
Ingredients, %
Corn	64.58	70.00	71.64	71.17	75.92	74.00
Soybean meal	16.80	7.81	0.50	10.70	3.30	-
Corn husk	-	-	-	-	-	10.10
Wheat bran	14.54	17.66	8.80	14.62	16.86	2.74
Fermented rapeseed meal	-	-	10.00	-	-	4.50
Fermented distiller’s grains	-	-	5.00	-	-	5.00
Soybean oil	0.55	0.45	0.10	0.30	0.30	0.04
L-Lysine-HCl (78.8%)	0.42	0.67	0.78	0.40	0.57	0.65
DL-Methionine (99%)	0.06	0.11	0.10	0.03	0.07	0.07
L-Threonine (98.5%)	0.10	0.24	0.23	0.10	0.21	0.20
L-Tryptophan (98%)	0.01	0.06	0.08	0.02	0.06	0.06
Limestone	0.65	0.73	0.89	0.64	0.68	0.54
CaHPO4	0.90	0.88	0.49	0.72	0.73	0.80
NaCl	0.30	0.30	0.30	0.30	0.30	0.30
Fungicide	0.06	0.06	0.06	0.06	0.06	0.06
Antioxidants	0.03	0.03	0.03	0.03	0.03	0.03
Premix 1	1.00	1.00	1.00	0.91	0.91	0.91
	100.00	100.00	100.00	100.00	100.00	100.00
Nutrient level 2
Digestible energy, MJ/kg	13.42	13.42	13.42	13.65	13.65	13.65
Crude protein, %	15.15	12.56	12.61	12.91	10.43	10.41
Calcium, %	0.52	0.54	0.55	0.45	0.46	0.46
Total phosphorus, %	0.54	0.55	0.53	0.48	0.47	0.45
Lysine, %	0.86	0.86	0.86	0.73	0.73	0.73
Methionine, %	0.26	0.26	0.26	0.21	0.21	0.21
Threonine, %	0.53	0.53	0.53	0.46	0.46	0.46
Tryptophan, %	0.14	0.14	0.14	0.13	0.13	0.13

¹ Premix includes vitamins and trace elements, premix provides per kg of feed: Fe: 80 mg, Zn: 81 mg, Cu: 10 mg, Mn: 30 mg, Se: 30 mg, I: 6 mg, vitamin A: 9000 IU, Vitamin B₁: 3 mg, Vitamin B₂: 7.5 mg, Vitamin B₆: 3.6 mg, Vitamin B₁₂: 0.036 mg, Vitamin D₃: 3000 IU, Vitamin E: 24 IU, Vitamin K₃: 3 mg, D-Pantothenic Acid: 15 mg, Folic Acid: 1.5 mg, D-Biotin: 0.15 mg, Niacinamide: 30 mg. ² Dietary crude protein, Ca, and total P were measured, and the remaining nutrient levels were calculated [16]. ³ CON, basal diet; LP, LP diet; FLP, LP diet supplemented with fermented feeds.

. Each replicate was housed in a separate pen, with ad libitum access to diet and water for the duration of the study. The integration of mechanical ventilation and natural ventilation ensured effective air circulation within barns.

2.3. Sample Collection

The initial weight, final weight, and daily feed intake were recorded to calculate the average daily gain, average daily feed intake, and feed: gain ratio. Body weight measurements were obtained in the morning after a 12-h fasting period on both the 1st and 80th days of the trial. For each replicate, a pig that closely matched the average body weight was chosen for slaughter. The serum samples were collected for biochemical parameter and antioxidant stability analyses and stored at −80 °C. The longissimus dorsi samples were stored in a refrigerator at 4 °C for meat quality analysis and stored at −80 °C for fatty acid and mRNA expression analysis. The cecal digesta samples were collected for microbial and SCFA analysis, and stored at −80 °C.

2.4. Carcass Evaluation and Meat Quality Assessment

The weight of each pig before slaughter, known as the live weight, was recorded. After the slaughter process, the head, hooves, tail, and internal organs were removed; the leaf fat and kidneys were preserved and included in the total carcass weight. After midline division of the carcass via vertebral column dissection, the left section was designated for measurement. At 30 min postmortem, the longissimus dorsi from the left carcass were separated and the connective tissues were trimmed.

On the morning of the slaughtering day, a measuring tape was used to assess both the straight length and the skew length of the carcass (the rear edge of the pubic symphysis to the front edge of the first rib) on the slaughter line. Additionally, a caliper was used to measure the thickness of the back fat at its thickest points, which included the shoulder, the thoraco–lumbar junction, the lumbar–sacral junction, and the junction between the 6th and 7th ribs.

At 45 min and 24 h postmortem, the pH values were measured with a pH meter (pH-STAR, MATTHAUS, Eckelsheim, Germany), which was calibrated with standard buffers at pH values of 4.64 and 7.00. The electrode was inserted into the meat, and the displayed value was recorded after a waiting period of approximately 30 s (three times).

At 45 min postmortem, the color parameters lightness (L*), redness (a*), and yellowness (b*) were quantified via a Minolta Chroma Meter (CR-400, KONICA MINOLTA, Tokyo, Japan). Meat surface color parameters (L*a*b) were quantified via a vertically positioned colorimeter (CR-400, KONICA MINOLTA, Japan) following preheating and calibration per the manufacturer’s specifications. Three measurement points were designated for each sample, and the average of these readings was recorded as the representative color of the meat sample.

At 2 h postmortem, drip loss samples were collected. Approximately 8 cm of muscle tissue was excised, with the epimysium removed from the edges. The muscle fibers were then trimmed along their longitudinal axis into four distinct samples, which were subsequently weighed. The processed samples were placed in measurement tubes oriented in accordance with the direction of the muscle fibers and stored in a refrigerator at 4 °C for 24 h. Following this period, the samples were removed and weighed again, and the degree of drip loss was calculated as the percentage difference between the initial weight and the final weight [17].

The muscle samples were standardized for both thickness and weight (w1) prior to immersion in a constant water bath maintained at 80 °C (SW 22, Julabo GmbH, Seelbach, Germany). Once the central temperature of the samples reached 70 °C, the incubation period was extended for an additional 30 min. Following this duration, the samples were removed from the heat source and allowed to cool to room temperature. The samples were subsequently weighed (w2), and the cooking loss was subsequently calculated via the following formula:

Cooking loss = (w1 − w2)/w1 × 100%.

After cooling, the muscles were sectioned perpendicular to the muscle fibers into strips and subsequently subjected to shearing via a tenderness meter (CLM-3). This procedure was repeated five times to determine the average shear force for the samples [18]. The marbling score was assessed by a panel of 5 trained sensory evaluators through systematic comparison with standardized visual reference cards. The IMF content in the longissimus dorsi was evaluated using the Soxhlet extraction method (NY/T 821–2019) [19].

2.5. Serum Collection and Analysis

On the final day of the trial, blood was collected from each pig slaughtered through venipuncture via vacuum tubes that were free of anticoagulants. The samples were subsequently subjected to centrifugation at 4 °C to isolate the serum. The concentrations of alanine transaminase (ALT), alkaline phosphatase (ALP), albumin (ALB), aspartate transaminase (AST), blood urea nitrogen (BUN), globulin (GLB), total cholesterol (TC), triglyceride (TG), total protein (TP), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) in growing–fattening pigs were quantified via an automatic biochemical analyzer, model 7020 (Hitachi, Tokyo, Japan).

Furthermore, the concentrations of GSH (Reduced Glutathione Content Assay Kit, BC1175), MDA (Malondialdehyde Content Assay Kit, BC0025), T-AOC (Total Antioxidant Capacity Assay Kit, BC1315), and SOD (Superoxide Dismutase Activity Assay Kit, BC5165) activity were evaluated via antioxidant kits provided by Solarbio Biotechnology Co., Ltd., Beijing, China. All the measurements were performed according to the protocols specified in the kit manuals.

2.6. Measurement of Fatty Acids in the Longissimus Dorsi

The longissimus dorsi from the left carcass was excised, and the fatty acids within the muscle were measured via gas chromatography-mass spectrometry (GC-MS) [20,21,22]. Longissimus dorsi samples were homogenized and then extracted using a standardized protocol to isolate the fatty acids. The extracted fatty acids were derivatized to form fatty acid methyl esters (FAMEs) through a transesterification process. The prepared FAMEs were then injected into the mass spectrometer for analysis. The Thermo Scientific^TM ISQ 7000 (Thermo Fisher Scientific, Waltham, MA, USA) was operated in selected ion monitoring (SIM) mode to specifically target the characteristic ions of each fatty acid. Data acquisition and analysis were performed using the manufacturer’s software, and the fatty acid concentrations were determined by comparing the peak areas with those of known standards.

2.7. Microbial Sequencing and Analysis

The contents of the cecum were analyzed via 16S rRNA amplicon sequencing, followed by evaluations of microbial diversity and abundance. DNA extraction was performed in strict accordance with the manufacturer’s protocols via the TGuide S96 Magnetic Soil/Stool DNA Kit (Tiangen Biotech Co., Ltd., Beijing, China). The resulting PCR products were visualized on an agarose gel and subsequently purified via the Omega DNA Purification Kit (Omega Inc., Norcross, GA, USA). The purified PCR products were sequenced (Illumina NovaSeq 6000, San Diego, CA, USA) and generated paired-end reads of 250 base pairs. Sequences exhibiting over 97% similarity were clustered into operational taxonomic units (OTUs) via USEARCH (version 10.0). Taxonomic annotation of the OTUs/ASVs was performed via the SILVA database (version 138.1) in conjunction with the naive Bayes classifier within QIIME2 [23], applying a confidence threshold of 70%. Linear discriminant analysis (LDA) combined with effect size measurement (LEfSe) was employed to assess differences in cecal microbiota from the family to genus level among the CON, LP, and FLP groups of growing–fattening pigs. A species was designated a biomarker when the LDA score was equal to or greater than Section 3.5. The analysis of sequencing data was conducted via the online platform BMKCloud.

2.8. Real-Time Quantitative PCR Analysis (RT-qPCR)

RT-qPCR was used to detect the mRNA expression levels of tight junction proteins (ZO-1, occludin, and claudin-1) in jejunal and ileal tissues, as well as the mRNA expression levels of myosin heavy chain genes encoding fast glycolytic fibers (MyHC-IIb), intermediate fibers (MyHC-IIx), fast oxidative fibers (MyHC-IIa), and slow oxidative fibers (MyHC-I) in the longissimus dorsi. TRIzol reagent (Takara, Dalian, China) was used to extract total RNA. The extracted total RNA was reverse-transcribed into single-stranded cDNA via the PrimeScript™ RT Kit (Code No.: RR047A, Takara, Dalian, China) according to the manufacturer’s protocol. The reactions were repeated three times in the qPCR SYBR Green Master Mix system (Yisheng, Shanghai, China), and the data were analyzed via the relative quantification method (2^−ΔΔCt). All primers are listed in Appendix A 

Table A1. Primers used for quantitative real-time PCR analysis.

Gene Name	Primer Sequence (5′–3′)	Product Size (bp)
MyHC-IIb	F: CAGTGAAAGAAGACCAGGTGTTCCC	139
	R: GTGTAGATCATCCAGGCTGCGTAAC
MyHC-IIx	F: CAGTGAAAGAAGACCAGGTGTTCCC	139
	R: GTGTAGATCATCCAGGCTGCGTAAC
MyHC-IIa	F: CAGTGAAAGAAGACCAGGTGTTCCC	139
	R: GTGTAGATCATCCAGGCTGCGTAAC
MyHC-I	F: GGCAAGACGGTGACTGTGAAGG	148
	R: AGATCATCCAGGAGGCGTAGCG
zo-1	F: GTCAACCCACCAAACCCACCAAAG	129
	R: TGCCATCTCTTGCTGCCAAACTATC
occludin	F: GTAGTCGGGTTCGTTTCC	85
	R: GACCTGATTGCCTAGAGTGT
claudin-1	F: GATTTACTCCTACGCTGGTGAC	83
	R: CACAAAGATGGCTATTAGTCCC
β-actin	F: GATCTGGCACCACACCTTCTACAAC	107
	R: TCATCTTCTCACGGTTGGCTTTGG

.

2.9. Short Fatty Acid Composition

SCFA content in the cecal contents was determined via gas chromatography-mass spectrometry (GC-MS) [24]. The SCFA were extracted via organic solvent. The extracted SCFA were derivatized via a sialylation reagent to enhance their volatility and stability for GC-MS analysis. The GC-MS system was calibrated with standard solutions of known SCFA concentrations. The derivatized samples were injected into the GC-MS, and the separation of SCFA was achieved using a capillary column with an appropriate stationary phase. The column temperature was programmed to elute the SCFA in a specific order. The mass spectrometer was operated in electron impact ionization (EI) mode, and the SCFA were detected based on their characteristic mass-to-charge (m/z) ratios. The data acquisition and analysis were performed using the manufacturer’s software, which allowed for the identification of peaks corresponding to specific SCFA and the quantification of their concentrations by comparing the peak areas with those of the calibration standards. The concentration of SCFA in the cecal content was measured via a Thermo Scientific^TM 1310 ISQ LT (Thermo Fisher Scientific, USA).

2.10. Statistical Analysis

A one-way analysis of variance (ANOVA) was performed via SPSS version 26.0 to analyze the data and homogeneity of variance via Levene’s test, and Tamhane’s T2 test or the least significant difference (LSD) method was employed for multiple mean comparisons. The carcass traits and meat quality were assessed via the general linear model (GLM) procedure for univariate analysis, and carcass weight was used as the covariate. Unless otherwise specified, the mean ± standard error of the mean (SEM) was presented. Statistical significance was established at p < 0.05.

3. Results

3.1. Growth Performance and Carcass Traits

As shown in

Table 2. Effects of LP diet supplemented with fermented feeds on growth performance of growing–fattening pigs.

Items 1	Dietary Treatment			p-Value
	CON	LP	FLP
Initial body weight, kg	31.13 ± 0.13	31.27 ± 0.05	31.14 ± 0.12	0.714
Final body weight, kg	93.63 ± 2.52	96.1 ± 1.18	91.89 ± 1.50	0.316
ADG, kg/d	0.78 ± 0.03	0.81 ± 0.02	0.76 ± 0.02	0.360
ADFI, kg/d	2.48 ± 0.09	2.54 ± 0.07	2.33 ± 0.06	0.254
F:G	3.15 ± 0.05	3.09 ± 0.05	3.03 ± 0.04	0.224

¹ ADG, average daily gain; ADFI, average daily feed intake; F:G, feed-to-gain ratio; CON, basal diet; LP, LP diet; FLP, LP diet supplemented with fermented feeds. Data are presented as mean ± SEM (n = 6). Distinct letter superscripts indicated statistical significance at p < 0.05.

, no significant differences in growth performance were observed among the three groups (p > 0.05).

There were no interactions (p > 0.05) between dietary treatment and carcass weight for carcass traits (

Table 3. Effects of LP diet supplemented with fermented feeds on carcass traits of growing–fattening pigs.

Items 1	Dietary Treatment			p-Value 2
	CON	LP	FLP	p1	p2
Carcass yield, %	0.72 ± 0.01	0.73 ± 0.01	0.72 ± 0.01	0.898	0.997
Carcass straight length, cm	95.67 ± 1.67	101 ± 0.32	97.83 ± 1.14	0.067	0.582
Carcass skew length, cm	80.67 ± 0.80	82.5 ± 0.85	80.67 ± 1.12	0.520	0.080
Back fat thickness at the thickest part of the shoulder, mm	49.06 ± 0.67	51.54 ± 1.66	44.91 ± 0.81	0.134	0.777
Back fat thickness at thoraco–lumbar junction, mm	29.08 ± 0.61	26.15 ± 1.50	22.62 ± 2.15	0.105	0.195
Back fat thickness at the lumbar–sacral junction, mm	30.58 ± 1.33	30.58 ± 1.47	27.96 ± 2.19	0.870	0.205
Back fat thickness at the joint of 6–7 ribs, mm	35.17 ± 3.26	43.55 ± 2.01	35.22 ± 3.13	0.263	0.725
Loin eye area, cm2	32.37 ± 0.58	27.93 ± 0.41	28.13 ± 2.10	0.131	0.489

¹ The pig’s weight before slaughter, known as the live weight, was documented. After the slaughter process, the head, hooves, tail, and internal organs were removed; the leaf fat and kidneys were preserved and included in the total carcass weight. CON, basal diet; LP, LP diet; FLP, LP diet supplemented with fermented feeds; ² p₁: Dietary treatment, p₂: Carcass weight; Data are presented as the mean ± SEM (n = 6). Distinct letter superscripts indicate statistical significance at p < 0.05.

). Carcass yield, carcass straight length, back fat thickness at the thickest part of the shoulder, the thoraco–lumbar junction, the lumbar–sacral junction, the joint of 6–7 ribs, and the loin eye area were unaffected (p > 0.05) by dietary treatment or carcass weight for carcass traits.

3.2. Meat Quality

There were no interactions (p > 0.05) between dietary treatment and carcass weight for any of the meat quality variables (

Table 4. Effects of LP diet supplemented with fermented feeds on the meat quality of the longissimus dorsi in growing–fattening pigs.

Items 1	Dietary Treatment			p-Value 2
	CON	LP	FLP	p1	p2
pH45min	6.33 ± 0.08	6.3 ± 0.02	6.28 ± 0.06	0.907	0.695
pH24h	5.43 ± 0.02	5.48 ± 0.03	5.51 ± 0.03	0.060	0.141
Marbling score	2.8 ± 0.3	3.08 ± 0.15	3.08 ± 0.24	0.574	0.556
L* (lightness)	43.48 ± 0.85	42.63 ± 0.28	41.71 ± 0.29	0.205	0.814
a* (redness)	5.24 ± 0.47	4.94 ± 0.51	5.94 ± 0.29	0.352	0.582
b* (yellowness)	2.35 ± 0.13	2.17 ± 0.27	1.88 ± 0.36	0.686	0.381
Drip loss, %	2.6 ± 0.11	2.51 ± 0.15	2.37 ± 0.01	0.451	0.584
Cooking loss, %	31.85 ± 0.68	32.07 ± 0.55	32.18 ± 0.66	0.789	0.519
Shear force, N	37.34 ± 1.62	36.1 ± 0.87	35.39 ± 0.51	0.574	0.602
Intramuscular fat, %	3.08 ± 0.07	3.08 ± 0.09	2.91 ± 0.09	0.461	0.885

¹ CON, basal diet; LP, LP diet; FLP, LP diet supplemented with fermented feeds; ² p₁: Dietary treatment, p₂: Carcass weight; Data are presented as the mean ± SEM (n = 6). Distinct letter superscripts indicate statistical significance at p < 0.05.

), except for pH_24h there was a tendency (p = 0.060) for an increase in FLP group compared to CON group.

3.3. Serum Biochemical and Antioxidant Parameters

The results pertaining to serum biochemical parameters and oxidative stability in growing–fattening pigs are presented in

Table 5. Effects of LP diet supplemented with fermented feeds on serum biochemical parameters and oxidative stability of growing–fattening pigs.

Items 1	Dietary Treatment			p-Value
	CON	LP	FLP
ALT, U/L	58.6 ± 1.44	51.6 ± 5.28	56.6 ± 6.72	0.608
AST, U/L	55.8 ± 3.72	52.4 ± 10.86	72.83 ± 8.99	0.216
ALP, U/L	105.33 ± 17.31	112.67 ± 8.85	120 ± 6.79	0.690
TP, g/L	69.67 ± 0.96	66.43 ± 2.31	67 ± 0.77	0.321
ALB, g/L	41.72 ± 1.37	40.47 ± 1.08	41.57 ± 1.30	0.749
GLB, g/L	27.95 ± 1.03	24.44 ± 0.47	26.62 ± 1.03	0.059
BUN, mmol/L	4.6 ± 0.01 a	3.75 ± 0.36 a	2.67 ± 0.34 b	0.006
TC, mmol/L	2.76 ± 0.10	2.38 ± 0.09	2.37 ± 0.12	0.053
TG, mmol/L	0.53 ± 0.03	0.41 ± 0.04	0.45 ± 0.08	0.342
HDL-C, mmol/L	1.19 ± 0.08	1.08 ± 0.14	0.82 ± 0.08	0.059
LDL-C, mmol/L	1.29 ± 0.07	1.14 ± 0.11	1.22 ± 0.08	0.493
GSH, μg/mL	65.34 ± 5.83	61 ± 16.47	106.15 ± 15.08	0.058
MDA, nmol/mg	4.3 ± 0.77	2.63 ± 0.61	3.34 ± 0.58	0.237
T-AOC, μmol/mL	0.14 ± 0.01 c	0.23 ± 0.01 b	0.26 ± 0.01 a	0.000
SOD, U/mL	6.53 ± 1.20	7.65 ± 1.40	9.94 ± 4.79	0.718

¹ ALT: alanine transaminase; AST: aspartate transaminase; ALP: alkaline phosphatase; TP: total protein; ALB: albumin; GLB: globulin; BUN: blood urea nitrogen; TC, total cholesterol; TG: triglyceride; HDL-C: high-density lipoprotein cholesterol; LDL-C: low-density lipoprotein cholesterol; MDA, malondialdehyde; GSH, reduced glutathione; T-AOC, total antioxidant capacity; SOD, superoxide dismutase; CON, basal diet; LP, LP diet; FLP, LP diet supplemented with fermented feeds; Data are presented as the mean ± SEM (n = 6). Distinct letter superscripts indicate statistical significance at p < 0.05.

. Compared with the other treatments, FLP treatment noticeably decreased the BUN content (p < 0.05). In contrast, compared with the CON group, the LP group presented a significant increase in the T-AOC content (p < 0.05). Furthermore, T-AOC levels were significantly greater in the FLP group than in the other two groups (p < 0.05). No significant differences in the levels of GSH, MDA, or SOD were observed among the three groups (p > 0.05).

3.4. Fatty Acid Composition

The fatty acid composition results are shown in

Table 6. Effects of LP diet supplemented with fermented feeds on fatty acid content of the longissimus dorsi.

Items 1, μg/g	Dietary Treatment			p-Value
	CON	LP	FLP
C6:0	0.29 ± 0.03	0.38 ± 0.05	0.35 ± 0.01	0.202
C8:0	0.81 ± 0.09	0.95 ± 0.14	1.16 ± 0.18	0.270
C10:0	7.29 ± 0.51	7.4 ± 1.43	6.85 ± 0.78	0.924
C11:0	0.3 ± 0.05	0.29 ± 0.05	0.4 ± 0.08	0.418
C12:0	5.18 ± 0.87	5.76 ± 1.18	6.55 ± 1.08	0.665
C13:0	0.32 ± 0.02	0.34 ± 0.03	0.36 ± 0.02	0.414
C14:0	87.03 ± 14.96	93.62 ± 19.60	111.2 ± 24.18	0.686
C15:0	1.59 ± 0.09	1.89 ± 0.16	2.05 ± 0.13	0.091
C16:0	1605.36 ± 220.69	1747.17 ± 283.18	2089.84 ± 318.94	0.476
C17:0	7.07 ± 0.69	8.86 ± 1.37	9.44 ± 1.14	0.275
C18:0	968.37 ± 123.49	1078.5 ± 205.87	1158.38 ± 176.29	0.742
C20:0	14.14 ± 2.28	14.92 ± 1.73	12.22 ± 1.65	0.605
C21:0	0.58 ± 0.02	0.62 ± 0.04	0.63 ± 0.03	0.497
C22:0	1.45 ± 0.12	1.5 ± 0.04	1.68 ± 0.31	0.638
C23:0	0.72 ± 0.02	0.77 ± 0.04	0.8 ± 0.01	0.081
C24:0	0.99 ± 0.05	1.08 ± 0.05	1.11 ± 0.10	0.448
SFA	2700.83 ± 362.84	2964.11 ± 514.06	3412.17 ± 529.24	0.583
C16:1	233.39 ± 41.07	225.3 ± 49.72	356.81 ± 95.19	0.338
C17:1	24.5 ± 0.55 b	25.98 ± 0.78 b	28.9 ± 1.12 a	0.011
C19:1n-9t	6.52 ± 0.88	7.17 ± 1.44	10.09 ± 1.97	0.294
C19:1n-9c	2032.14 ± 201.67	1863.46 ± 287.14	2201.57 ± 24.82	0.555
C19:1n-7	306.52 ± 54.63	236.78 ± 49.83	451.84 ± 152.39	0.319
C20:1	59.72 ± 12.84	57.58 ± 16.49	89.27 ± 23.98	0.453
C22:1n-9t	2.6 ± 0.32	1.88 ± 0.17	1.95 ± 0.14	0.070
C22:1n-9	6.48 ± 0.46 a	4.98 ± 0.37 b	6.24 ± 0.43 ab	0.049
C24:1	1.3 ± 0.04 b	1.37 ± 0.09 b	1.61 ± 0.07 a	0.029
MUFA	2673.44 ± 299.05	2590.96 ± 475.68	3930.37 ± 996.37	0.329
C18:2n-6t	1.14 ± 0.05 b	1.47 ± 0.01 a	1.49 ± 0.04 a	0.001
C18:2n-6	570.48 ± 36.62	693.08 ± 61.65	696.81 ± 55.22	0.208
C18:3n-3	12.75 ± 1.47	13.91 ± 2.16	13.76 ± 1.74	0.886
C18:3n-6	4.41 ± 0.13	4.63 ± 0.54	4.91 ± 0.22	0.601
C20:3n-3	3.72 ± 0.37	3.8 ± 0.50	4.21 ± 0.48	0.725
C20:4n-6	133.77 ± 5.9 c	153.96 ± 2.64 b	172.86 ± 3.10 a	0.001
C22:2	1.92 ± 0.08 b	2.04 ± 0.13 b	2.42 ± 0.12 a	0.030
C20:5n-3	3.14 ± 0.16	3.13 ± 0.11	3.19 ± 0.10	0.945
C22:4	16.45 ± 0.24 b	19.5 ± 1.02 ab	21.91 ± 1.85 a	0.035
C22:5n-3	12.81 ± 0.69	14.34 ± 0.17	13.71 ± 0.81	0.275
C22:6n-3	9.7 ± 0.55 a	8.12 ± 0.46 b	10.29 ± 0.41 a	0.027
PUFA	765.27 ± 42.53 b	871.32 ± 67.94 b	1020.41 ± 3.35 a	0.028

¹ SFA: sum of saturated fatty acids; MUFA: sum of monounsaturated fatty acids; PUFA: sum of polyunsaturated fatty acids; CON, basal diet; LP, LP diet; FLP, LP diet supplemented with fermented feeds; Data are presented as the mean ± SEM (n = 6). Distinct letter superscripts indicate statistical significance at p < 0.05.

. Compared with the CON group, the LP group significantly reduced the concentration of C22:6n-3 (p < 0.05). Moreover, the contents of C18:2n-6t and C20:4n-6 were greater in the LP group than in the CON group, whereas the content of C22:1n-9 was significantly lower in the LP group than in the CON group (p < 0.05). Compared with the CON group, the FLP group presented a significant increase in C22:4 content (p < 0.05). The FLP treatment noticeably increased the contents of C17:1, C24:1, C20:4n-6, C22:2, and PUFA comparatively to the other two groups (p < 0.05). Furthermore, the contents of C20:4n-6 were greater in the FLP group than in the LP group (p < 0.05).

However, no statistically significant alterations in saturated fatty acid (SFA) concentrations were detected across the experimental groups, including C16:1, C19:1n-9t, C19:1n-9c, C19:1n-7, C20:1, C22:1n-9t, C18:2n-6, C18:3n-3, C18:3n-6, C20:3n-3, C20:5n-3, C22:5n-3, and MUFA in the longissimus dorsi (p > 0.05).

3.5. Microbial Community

To investigate the effects of fermented feeds on the cecal microbiome of growing–fattening pigs, we analyzed alterations in abundance and biomarkers. A total of 691 OTUs were delineated at the 97% similarity threshold across all groups (Figure 1A). The most abundant genera included Alloprevotella, Oscillospiraceae_UCG-005, Treponema, and Prevotellaceae (Figure 1B). The predominant phyla were Firmicutes, Bacteroidota, Spirochaetota, and Proteobacteria (Figure 1C). Additionally, the numbers of biomarkers identified at the order, family, genus, and species levels were 1, 1, 3, and 4, respectively (Figure 1D). In total, seven taxa served as biomarkers for the CON group, whereas one biomarker was identified for the other groups (Figure 1E).

3.6. mRNA Expression of Genes

As shown in Figure 2A, the LP group exhibited a significant upregulation of the mRNA levels of MyHC-IIa in comparison with the CON group (p < 0.05). Conversely, the FLP group significantly decreased the mRNA expressions of MyHC-IIa compared to the LP group (p < 0.05). Both the LP and FLP treatments significantly decreased the mRNA levels of MyHC-IIb in the muscle compared to the CON group (p > 0.05). However, the mRNA expressions of MyHC-I and MyHC-IIx were not significantly (p > 0.05) affected by the different dietary treatments in the muscle.

Moreover, as shown in Figure 2B, the FLP group exhibited a significant upregulation of mRNA levels of ZO-1 compared to the LP group (p < 0.05). No significant effects of the diet on the mRNA expression levels of intestinal tight junction proteins were observed in the ileum (p > 0.05).

3.7. Short-Chain Fatty Acids (SCFAs)

Figure 3 shows that LP improved the concentration of acetic acid (p < 0.05). Moreover, both the LP and FLP groups showed an elevation in the concentrations of butyric acid compared to the CON group (p < 0.05).

4. Discussion

Protein is an essential nutrient for the growth and development of pigs and directly affects their growth rate. An LP diet can lead to a decrease in pig growth performance, affecting normal development [25]. However, studies have reported that under the premise of meeting pigs’ nutritional needs for specific amino acids, appropriately reduced dietary CP levels do not negatively impact the growth performance of pigs [26,27,28,29], was consistent with our study.

In animal husbandry, the lean meat percentage of pigs is commonly assessed by combining backfat thickness and eye muscle area. Earlier studies reported that LP diets can reduce the percentage of lean meat in pigs [29]. The LP diet may lead to over-fatness in pigs due to the regulation of lipid metabolism and deposition by the nutritional level of the diet [30,31]. The fermented diet reduced backfat thickness and increased eye muscle area, thereby enhanced the lean meat percentage in pigs [32]. However, in this experiment, the addition of fermented feed in the LP diet did not significantly affect the eye muscle area in pigs, differing from earlier findings. This discrepancy may be related to the type and amount of fermented feed added.

Meat quality was an important factor in finding the value of pork. The pH affects the color and water-holding ability of meat by regulating protein activity; this water-holding ability influences the tenderness, color, and nutritional composition of the meat [33,34,35]. In this study, the FLP diet did not affect the pH, meat color, cooking or drip loss, shear force, or IMF of the longissimus dorsi. IMF is an important indicator of pork value, as it influences the tenderness and flavor of pork by synthesizing flavor substances. The marbling score reflects the distribution of IMF, and its rating was positively correlated with the content of IMF. Additionally, under the conditions of this experiment, there were no significant differences in the IMF content, which was consistent with the research results of Xu et al., indicating that the addition of fermented feed to the LP diet has no negative impact on pork quality [36]. However, other studies have shown that LP diets increased the IMF content in growing–fattening pigs, which may be due to breed specificity and differences in the levels of low protein [5,37,38].

The analysis of serum biochemical components helps to assess the overall health status of pigs. The activities of serum AST, ALT, and ALP were sensitive indicators of liver damage; when the liver and gallbladder are injured in animals, AST, ALT, and ALP activities in the serum are increased [4,39]. BUN was a major product of protein metabolism in the body and was an important indicator of protein metabolism status. Therefore, the health status of the liver and kidneys is judged by the activities of AST, ALT, ALP, and the concentration of BUN in the serum. Under the conditions of this experiment, no significant differences were observed in AST, ALT, and ALP activities in the LP group pigs, showing that the LP diet did not affect overall health. Moreover, the addition of the FLP diet significantly reduced the BUN concentration in the pigs, which was consistent with previous research findings [40]. T-AOC, SOD, GSH, and MDA are all important indices of the body’s antioxidant system. The T-AOC reflects the overall level of various antioxidant molecules in the body and the health status of the organism. SOD is a key antioxidant enzyme that uses superoxide radicals as its substrate. GSH is an important indicator of an organism’s redox state. MDA is a terminal product of lipid oxidation and reflects the degree of lipid peroxidation and cell damage within the body [41]. The addition of fermented feed to the LP diet significantly enhanced the serum T-AOC content in growing–fattening pigs, which was consistent with the finding of Xie et al., who reported that fermented feed enhances serum antioxidant performance in fattening pigs [42]. Fermented feed enhances the body’s antioxidant capacity, potentially because of the microbial degradation of proteins and carbohydrates in the substrate during fermentation, resulting in the production of substances such as small peptides, polyphenols, and bioactive compounds, which may contribute to the oxidative stability of pigs [41].

Muscle fatty acids are divided into two major categories: SFA and UFA (unsaturated fatty acids), with UFA further divided into MUFA and PUFA. These were important chemical components of fat and significantly influence the nutrient content, flavor, tenderness, and color of muscle. Studies indicate that the contents of C18:2n-6, C18:3n-3, C20:5n-3, C22:5n-3, and C22:6n-3 were negatively correlated with flavor, whereas the contents of C18:1, C18:1ω9, and C18:1ω11 were positively correlated with flavor [43]. In this experiment, the LP diet reduced the content of C22:6n-3 in the longissimus dorsi, suggesting that LP diet has a positive effect on enhancing muscle flavor, which was consistent with the conclusion of Martínez-Aispuro et al., who found that LP diet reduced the concentration of C22:6n-3 and increased the concentration of C20:0 in the longissimus dorsi of growing pigs [44]; conversely, the FLP group did not show a reduction in C22:6n-3 content comparable to that of the LP diet, possibly due to the impact of PUFA on the overall fatty acid profile [45]. PUFAs were essential for keeping healthy, and they have functions such as preventing the incidence of cardiovascular diseases, delaying aging, and promoting growth and development. The FLP diet increased the content of PUFA in the muscles of pigs, which was consistent with previous research findings [46]. The above research shows that fermented feed improves muscle flavor by altering the fatty acids in the muscles of pigs.

The types of muscle fibers plays a crucial role in meat quality [42]. There were four different types of myosin heavy chain isoforms expressed in the muscles of adult domestic animals, which were MyHC-I, MyHC-IIa, MyHC-IIb, and MyHC-IIx [47]. Studies have shown that the number of muscle fibers in animals is constant, but the composition of the diet and its nutritional level affect the composition and proportion of muscle fibers [32,42,48]. The FLP diet affected the composition and proportion of muscle fibers, increasing the proportion of MyHC-IIa fibers and decreasing the proportion of MyHC-IIb fibers [48], which is consistent with this study. Research indicates that the composition and proportion of muscle fibers are closely related to meat quality, with the proportion of MyHC-I and MyHC-IIa fibers positively correlated with meat quality, while the proportion of MyHC-IIb and MyHC-IIx fibers is negatively correlated with meat quality [49,50]. This suggests that the FLP diet may enhance meat quality by modulating the mRNA expressions of MyHC-IIa and MyHC-IIb muscle fibers.

Claudin-1, Occludin, and ZO-1 are the main junctional proteins that make up the tight junctions of intestinal epithelial cells [51,52,53]. Studies have found that supplementing LP diets with Bacillus subtilis significantly increased the mRNA levels of the ZO-1 gene in the ileum of piglets [54], which was similar to this experiment, where the FLP group showed significantly upregulated mRNA levels of the ZO-1 gene, indicating that FLP diets enhance the expression of tight junction proteins, which may be related to the increased butyrate in the gut [55]. The above research shows that FLP diets enhanced the function of the intestinal barrier in pigs and served as a potential measure to reduce the use of soybean meals and lower the production costs in animal husbandry.

The species abundance plot of the cecal microbiota shows that the LP diet significantly increased the relative abundance of Spirochaetota and decreased the relative abundance of the Firmicutes, indicating that reducing the CP level of diet altered the structure of the cecal microbiota, which was similar to the findings of previous studies [56,57,58]. The LP diet increased the relative abundance of Firmicutes and Proteobacteria and decreased the relative abundance of Bacteroidota in the feces of nursery pigs [59]. Reducing the dietary CP level by 2% increased relative abundance of Proteobacteria, Actinobacteriota, and Verrucomicrobiota in the jejunum of Hexi pigs while reducing the CP level by 4% increased relative abundance of Spirochaetota in the cecum [60]. This comprehensive analysis demonstrates that lowering the CP level in the diet alters the nutrient composition ingested by pigs, which in turn affects microbial fermentation and modifies the intestinal microecological environment.

Additionally, the FLP diet increased the relative abundance of Treponema, indicating that the FLP diet changed the structure of the pigs’ cecal microbiota. This finding was consistent with finding that the FLP diet changed the gut microbiota structure of nursery pigs, increasing the relative abundances of Acidaminococcus, Bifidobacterium, Roseburia, Blautia, Selenomonas, Ruminococcus, Faecalibacterium, and Megasphaera [61]. The FLP diet of piglets regulated the microbiota structure, increasing the relative abundance of Bacteroides and decreasing the relative abundance of Clostridium [62]. Fermented feed influences the gut health of pigs by regulating the structure of the gut microbiota. This may be due to the presence of certain microorganisms in the fermented feed, which enter the animal’s intestine along with the chyme, thus changing the composition of the gut microbiota. Additionally, metabolites produced by microorganisms during fermentation alter the microecological environment of the intestine, thereby affecting the structure of the gut microbiota.

SCFAs were important products of the fermentation of indigestible carbohydrates in food by the gut microbiota [63]. They play crucial roles in regulating the host’s energy metabolism, immune function, and intestinal cell proliferation [64]. In this study, the LP diet significantly increased the concentrations of acetic and butyric acids in the cecum of growing–fattening pigs compared to the CON group, which was consistent with the findings that the LP diet increased the concentrations of propionic and butyric acids in the cecum of piglets [65]. Moreover, the FLP diet increased the butyric acid in the cecum of growing–fattening pigs, which aligns with the results of Zhang et al. [66]. These findings indicate that both the dietary CP level and fermented feed influenced the microbial metabolism in the cecum of pigs. A comprehensive analysis suggested that the FLP diet may modulate gut health by regulating the concentration of SCFAs within the gut microbiota, thereby influencing microbial metabolism.

5. Conclusions

Overall, the supplementation of fermented distiller’s grains and fermented rapeseed meals in the LP diets significantly modified the lipid composition of the longissimus dorsi in growing–fattening pigs. More importantly, the inclusion of these fermented ingredients in LP diets altered the gut microbiota structure in growing–fattening pigs, thereby enhancing gut health by increasing intestinal butyrate levels and modifying the expression of tight junction proteins.