Next Article in Journal
A Comparative Transcriptomic and Proteomic Analysis of the Pileus of Agaricus bisporus During Its Different Developmental Phases
Next Article in Special Issue
Impacts of Weed Resistance to Glyphosate on Herbicide Commercialization in Brazil
Previous Article in Journal
Determination Model of Epidermal Wettability for Apple Rootstock Cutting Based on the Improved U-Net
Previous Article in Special Issue
Abiotic and Biotic Factors Affecting Crop Growth and Productivity: Unique Buckwheat Production in Egypt
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman

by
Fatma Khuseib Hamed Al-Rashdi
1,*,
Abdullah Mohammed Al-Sadi
1,2,
Mostafa Ibrahim Waly
3,
Shah Hussain
1,4 and
Rethinasamy Velazhahan
1,*
1
Department of Plant Sciences, College of Agricultural and Marine Sciences, Sultan Qaboos University, Al-Khoud, Muscat 123, Oman
2
College of Agriculture, University of Al Dhaid, Sharjah P.O. Box 27272, United Arab Emirates
3
Department of Food Science and Nutrition, College of Agricultural and Marine Sciences, Sultan Qaboos University, Al-Khoud, Muscat 123, Oman
4
Center for Environmental Studies and Research (CESAR), Sultan Qaboos University, Al-Khoud, Muscat 123, Oman
*
Authors to whom correspondence should be addressed.
Agriculture 2024, 14(12), 2225; https://doi.org/10.3390/agriculture14122225
Submission received: 31 October 2024 / Revised: 27 November 2024 / Accepted: 3 December 2024 / Published: 5 December 2024

Abstract

Mycotoxin contamination in agricultural goods is a major global problem due to its negative impact on human and animal health. The principal mycotoxin producers are fungal species from the genera Fusarium, Aspergillus, Alternaria, and Penicillium. The toxigenic fungal species produce the mycotoxins as secondary metabolites when they invade agricultural commodities during crop cultivation in the field (preharvest) or after harvesting or during transport and storage. This study was designed to investigate the levels of Fusarium mycotoxins, viz., fumonisin (FUM), zearalenone (ZEN), and deoxynivalenol (DON) in cereal grain samples collected from Muscat, Sultanate of Oman during 2023-24. A total of 90 cereal grain (wheat, corn, rice, barley) samples from local markets at Muscat, the Plant Quarantine Department, Oman, and Oman Flour Mills Company were analyzed using competitive enzyme immunoassay kits. Furthermore, Fusarium spp. associated with the contaminated grain samples were isolated, and their mycotoxin-producing potential was assessed. The results indicated that FUM, ZEN, and DON levels were below the detection limit (LOD) in 81%, 97%, and 44% of the samples, respectively. Two out of fifteen corn samples and one out of thirty-seven wheat samples tested exceeded the maximum permissible limit for FUM and ZEN, respectively, as set by the European Commission. A total of 19 Fusarium spp. associated with the contaminated grain samples were isolated and identified through molecular techniques. Sixteen isolates of F. verticillioides, one isolate of F. thapsinum, and two new Fusarium species were identified based on nuclear ribosomal DNA internal transcribed spacer and elongation factor 1-alpha sequences. Two isolates of F. verticillioides (FQD-1 and FQD-20) produced FUM levels exceeding 2000 µg kg−1. The maximum ZEN concentration was observed in F. verticillioides FQD-20 (9.2 µg kg−1), followed by F. verticillioides FQD-2 (2.8 µg kg−1) and Fusarium sp. FOFMC-26 (2.5 µg kg−1). All tested Fusarium strains produced DON, with levels ranging from 25.6 to 213 µg kg−1, with F. thapsinum FQD-4 producing the highest level (213 µg kg−1). To our knowledge, this is the first report on the occurrence of Fusarium mycotoxins and mycotoxigenic Fusarium spp. in food commodities in Oman.

1. Introduction

Food security is a serious issue among the global communities as the world population anticipated to expand to 9.7 billion by 2050 [1]. Threats to food security include limitations in the supply of nutritious and safe foods to consumers [2,3]. Mold contamination in agricultural commodities is considered as a major food safety hazard, as several mold species secrete harmful toxic secondary metabolites known as “mycotoxins” on various food matrices. Reports indicate that 5–10% of agricultural products worldwide are spoiled by mold contamination, rendering them unfit for human or animal consumption. Several mold species from the genera Fusarium, Aspergillus, Alternaria, and Penicillium produce mycotoxins on the substrates during their growth under favorable conditions [4]. This contamination can occur at various stages, including crop cultivation in the field, harvest, storage, and processing [5]. Consuming food that is contaminated with mycotoxins might lead to mycotoxicosis and food poisoning, potentially causing death in both humans and animals [6]. There are around 300 different mycotoxins, but only about 20 are known to cause toxic effects on humans when consumed through contaminated food. These include aflatoxin, sterigmatocystin, ochratoxin (A, B, C), trichothecenes (deoxynivalenol, diacetoxyscirpenol, T2 toxin, HT-2 toxin, nivalenol), fumonisin (B1, B2), moniliformin, zearalenone, cyclopiazonic acid, patulin, alternariol monomethyl ether, alternariol, tenuazonic acid, and citrinin [7]. Among them, fumonisins, aflatoxins, zearalenone, and deoxynivalenol are frequently found in cereal grains. Each mycotoxin is associated with specific health risks in humans and animals. Aflatoxins are considered the most carcinogenic mycotoxin and are classified in Group I. Fumonisins and ochratoxins are classified in Group 2B, while trichothecenes and zearalenone are categorized as non-carcinogenic and placed in Group 3 [8]. These mycotoxins are exceptionally stable compounds that can withstand high temperatures, storage, and processing conditions [9]. For example, DON remains stable at 120 °C, showing moderate stability at 180 °C and partial stability at 210 °C [10]. ZEN can be inactivated after 60 min at 175 °C [11], whereas fumonisins remain stable even at temperatures as high as 250 °C [12].
Fusarium spp. produce three major classes of mycotoxins as secondary metabolites: fumonisins, trichothecenes, and zearalenone [13]. Fumonisin (FUM) contamination is common in maize and maize-based products. Fumonisins are primarily produced by F. verticillioides and F. proliferatum as secondary metabolites [14,15]. Other Fusarium species such as F. oxysporum, F. napiforme, F. nygamai, F. anthophilum, and F. dlamini are also known to produce fumonisins [16,17]. About 15 types of fumonisin (fumonisin A, B, C, and P) have been characterized [18]. The primary food contaminants are fumonisin B1 (FB1), fumonisin B2 (FB2), and fumonisin B3 (FB3), with FB1 being the most dangerous [19]. F. verticillioides is an important pathogen in corn, causing seedling blight, ear rot, seed rot, and stalk rot. The pathogen produces fumonisins mainly during the pre-harvesting stage, and under improper storage conditions, the pathogen continues to produce the toxin during the post-harvesting stage [20]. Besides corn, fumonisins have been detected in wheat, barley, rye, oat, rice, and other millets [17,21]. Other food products reported to contain FB1 include dried figs, garlic, asparagus, beers, and milk [17]. Fumonisins have been connected with esophageal cancer [17] and harmful effects on the liver and kidneys in animals [22]. Fumonisin consumption has been associated with pulmonary edema syndrome in pigs [23], leukoencephalomalacia in horses [24], hepatotoxicity and nephrotoxicity in rats [25], and apoptosis in several different types of animal cells [26].
Zearalenone (ZEN; F-2 toxin; C18H22O5) is a non-steroidal estrogenic compound primarily produced by F. graminearum, F. oxysporum, F. verticillioides, F. culmorum, F. cerealis, F. semitectum, F. equiseti, F. acuminatum, F. sporotrichioides, and F. crookwellense [27]. Maize, wheat, barley, oats, rice, rye, and sorghum are highly susceptible to ZEN contamination [28]. ZEN is a xenoestrogen biosynthesized via polyketide pathway [27]. The chemical structure of ZEN mimics natural estrogens like 17β-estradiol, allowing it to bind to estrogen receptor sites and disrupt hormonal balance, leading to various reproductive system diseases [29]. Furthermore, ZEN is rapidly absorbed in the body of mammals and metabolized into highly toxic compounds [30]. ZEN exposure has been proven to diminish the progesterone and serum testosterone levels in the bloodstream, resulting in sterility and decreased conception rates in animals such as rats, pigs, and cows [31,32].
Deoxynivalenol (DON; Vomitoxin; C15H20O6) is a trichothecene mycotoxin produced by many Fusarium species such as F. graminearum, F. oxysporum, F. avenae, F. asiaticum, and F. culmorum [33,34]. Corn, wheat, barley, rye, and oats are commonly contaminated by DON following infection by the toxigenic fungi in the field and during storage [35,36]. DON is a highly stable mycotoxin in both storage and processing [37,38]. Acute poisoning from DON causes emesis, while chronic low-dose exposure leads to anorexia, growth retardation, immunotoxicity, and reproduction impairment in experimental animal models [39,40,41]. In addition, DON is phytotoxic and is regarded as a virulence factor in fungal pathogenesis [42,43,44]. In many cases, these mycotoxins can co-exist in agricultural commodities, leading to synergistic, additive, or antagonistic toxic effect on the host [45].
According to the European Commission regulatory standards, the maximum tolerable limits of fumonisins (FB1 + FB2) in unprocessed corn; deoxynivalenol in unprocessed durum wheat, oats, and maize; and zearalenone in unprocessed corn are 2000, 1750, and 200 µg kg−1, respectively [46]. Oman sources most of its cereal grains from international markets [47]. Though there are a few reports on the occurrence of aflatoxins in food commodities [48,49,50], studies on the level of Fusarium toxins in imported and marketed agricultural products in Oman is limited. This study was conducted to quantify the levels of fumonisin, deoxynivalenol, and zearalenone in cereal grains (wheat, corn, rice, and barley) collected from Muscat, Oman. The occurrence of toxigenic strains of Fusarium in the mycotoxin-contaminated samples was also investigated.

2. Materials and Methods

2.1. Sample Collection

Ninety cereal grain samples consisting of wheat (37 samples), corn (15 samples), rice (5 samples), and barley (33 samples) (100 g to 1 kg) were collected from the local markets in Muscat, the Plant Quarantine Department of the Ministry of Agriculture, Fisheries and Water Resources (MAFWR), Oman, and Oman Flour Mills Company (S.A.O.G), Muscat in 2023 and 2024. The collected samples were analyzed for grain contamination with FUM, ZEN, and DON.

2.2. Mycotoxin Estimation

A quantitative analysis of Fusarium mycotoxins in the cereal grain samples was performed using RIDASCREEN® Fumonisin ECO (Art. No. R3411), RIDASCREEN® Zearalenon (Art. No. R1401), and RIDASCREEN® DON (Art. No. R5906) competitive enzyme immunoassay kits (R-Biopharm AG, Darmstadt, Germany), following the manufacturer’s instructions. These kits had detection limits of 30 µg kg−1 for Fumonisin and 1.75 µg kg−1 for Zearalenone and 18.5 µg kg−1 for DON. The software RIDASOFT Win.NET Food & Feed Version 1.5.2 (Art. No. Z9996FF; R-Biopharm AG, Darmstadt, Germany) was used for determination of mycotoxin levels.

2.3. Isolation of Fusarium spp.

The cereal grains (wheat, corn, rice, and barley) were surface-sterilized with 1% NaOCl for 2 min. To eliminate NaOCl residues, the samples were washed three times with sterilized distilled water (SDW) before being plated on a potato dextrose agar (PDA) medium (Oxoid Ltd., Basingstoke, UK). The plates were then incubated for 3–5 days at 27 °C. Pure cultures of the fungi were obtained by using the hyphal tip isolation method.

2.4. DNA Extraction, Amplification, and Sequencing

Lee and Taylor’s [51] method was followed to recover the DNA from the fungal mycelium. The fungal mycelium (~80 mg) was taken in a sterile 2 mL centrifuge tube from a 7-day-old PDA culture with a sterile scalpel and ground in the presence of acid-washed sand and suspended in 600 µL extraction buffer (50 mM Tris-HCl pH 7.6, 50 mM EDTA, 3% SDS, 1% 2-mercaptoethanol). The sample was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1, v/v; Sigma-Aldrich, St. Louis, MO, USA). DNA was precipitated with 1/10 volume of 3 M sodium acetate and 0.6 volume of isopropanol, washed with 70% ethanol, and resuspended in 50 µL SDW. A NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to evaluate the quality and amount of isolated DNA.
The primer combinations ITS5/ITS4 [52] and EF-1α-F/EF-1α-R [53] were used to amplify two DNA regions: internal transcribed spacer (ITS) and translation elongation factor (EF-1α) (Table 1). The reaction mixture (25 μL) consisted of 1 µL of DNA template (100 ng), 1 µL of each primer (10 µmol), a puReTaq Ready-to-Go PCR bead (GE Healthcare, Buckinghamshire, UK), and 22 µL of nuclease free water [54]. For ITS amplification, the PCR conditions described by Hussain et al. [55] were used. At Macrogen Inc. (Seoul, Republic of Korea), the PCR products were purified and subsequently sequenced in both directions using the same primers.

2.5. Sequence Alignment and Phylogenetic Analyses

BioEdit v. 7.0.9 was used to align and transform the forward and reverse primer readings of the ITS and EF-1α regions into consensus sequences [56]. Sequence similarity was checked against the GenBank sequences using BLAST tools (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (accessed on 3 September 2024). The most similar species in BLAST results were F. verticillioides, F. thapsinum, and F. chlamydosporum. It is obvious from the literature that both F. verticillioides and F. thapsinum belonged to the F. fujikuroi species complex [57]. Therefore, we constructed a combined ITS-EF-1α dataset comprised of the F. fujikuroi species complex and the F. chlamydosporum species complex along with representative species from other species complexes [58]. The dataset consisted of 52 specimens, including Fusicolla aquaeductuum (CBS 734.79) as an outgroup taxon. The data matrix was aligned using Mafft v. 7 (https://mafft.cbrc.jp/alignment/server/) (accessed on 3 September 2024) [59]. A maximum likelihood (ML) method was used for the phylogenetic analyses, with the ML phylogeny generated using RAxML-HPC BlackBox on the Cipres Science Gateway [60,61]. According to jModelTest2, the best model (GTR + F + I + G4) was chosen [62]. In total, 1000 bootstrap repeats were used to evaluate branch support for the ML phylogeny, and a bootstrap (BT) percentage of >50 was deemed significant. The phylogenetic tree was visualized using FigTree v.1.4.2 [63] and annotated with Adobe Illustrator CC2019.

2.6. Mycotoxigenic Potential of Fusarium spp.

The mycotoxin-producing potential of Fusarium strains on the maize grain substrate was assessed following a method described by Shi et al. [64]. Briefly, 25 mL of distilled water was added to 50 g of mycotoxin-free maize and left overnight. The medium was then sterilized by autoclaving at 121 °C for 20 min. A 6 mm diameter agar disk cut from a 7-day-old PDA culture of the fungus was transferred to the sterilized maize grain medium and incubated at 25 °C for 21 days. After that, the medium containing a fungal mycelial mat was dried in an oven at 40–50 °C until constant weight was achieved, then ground into powders and analyzed for mycotoxins (FUM, DON, ZEN) by using R-Biopharm RIDASCREEN competitive enzyme immunoassay kits as described earlier. The uninoculated maize grain medium prepared in the same manner served as the control. Each treatment was replicated thrice.

3. Results

3.1. Occurrence of Fumonisin

Fumonisin levels in 73 out of 90 grain samples (81%) were below the detection limit (Table 2). Twelve corn samples, three wheat samples, and two barley samples tested positive for fumonisin. In general, corn samples exhibited higher levels of fumonisin, with two out of the fifteen tested samples exceeding the EC’s maximum tolerance level of 2000 µg kg−1 for fumonisin. All five rice samples tested were below the detection limit for fumonisin.

3.2. Occurrence of Zearalenone

The results indicated that 87 out of 90 grain samples tested (97%) were below the detection limit (Table 3). One corn sample, one barley sample, and one wheat sample tested positive for zearalenone, with the wheat sample exceeding the EC’s maximum tolerance level of 200 µg kg−1 for zearalenone. All five rice samples were below the detection level for zearalenone.

3.3. Occurrence of DON

Out of ninety cereal grain samples tested, forty samples (44%) were below the detection level for DON, and none exceeded the EC’s maximum tolerance level of 1750 µg kg−1 for unprocessed durum wheat, oats, or maize (Table 4). Nine of the fifteen corn samples had DON levels ranging from 21 to 398 µg kg−1, with one sample reaching 519 µg kg−1. Among the thirty-seven wheat samples, nineteen had DON levels ranging from 22 to 311 µg kg−1, with one sample reaching 559 µg kg−1. The DON levels in three out of five rice samples ranged from 20 to 56 µg kg−1, while seventeen out of thirty-three barley samples had levels between 19 and 67 µg kg−1, respectively.

3.4. Isolation of Fusarium spp. from Cereal Grains

A total of 19 Fusarium species associated with the contaminated cereal grain samples were isolated on the PDA medium. Initial BLAST analysis of the ITS sequences confirmed that the isolates belonged to the Fusarium genus. Further identification of species within the Fusarium genus was conducted using combined ITS and EF-1α-sequence alignment.

3.5. Phylogenetic Analysis

The final ITS-EF-1α dataset was 2104 characters long, including 1557 constant sites, 390 parsimony informative sites, and 157 uninformative sites. The ML phylogeny is presented in Figure 1, where the species of Fusarium recovered in two clades. Clade-I corresponding to the F. fujikuroi species complex (FFSC) and Clade-II to the F. chlamydosporum species complex (FCSC), F. tricinctum species complex (FTSC), F. citricola species complex (FCCSC), and F. incarnatum-equiseti species complex (FIESC), respectively. There were sixteen isolates of F. verticillioides and one isolate of F. thapsinum (FQD-4) recovered in this study. Both F. verticillioides and F. thapsinum fall in FFSC. The two isolates (FOFMC-26, FOFMC-27), representing an undescribed species in Fusarium, recovered with an independent lineage in Clade-II. The GenBank accession numbers of the ITS and EF-1α gene sequences of the Fusarium spp. isolated in this study are given in Table 5.

3.6. Mycotoxin Production by Fusarium spp.

These Fusarium isolates produced varying levels of mycotoxins (Table 6). The Fusarium species produced FUM at levels ranging from 49.7 to 2489.2 µg kg−1. F. verticillioides isolate FQD-1 produced the highest level of FUM (2489 µg kg−1), followed by FQD-20 (2408 µg kg−1), FQD-17 (1895 µg kg−1), and FQD-13 (1044 µg kg−1). No FUM production was detected in F. verticillioides isolates FQD-3, FQD-9, and FQD-10; F. thapsinum isolate FOD-4; and Fusarium sp. isolates FOFMC-26 and FOFMC-27. The production of ZEN by the Fusarium spp. ranged from 2.5 to 9.2 µg kg−1. The maximum level of ZEN was produced by F. verticillioides FQD-20 (9.2 µg kg−1), followed by F. verticillioides FQD-2 (2.8 µg kg−1), and Fusarium sp. FOFMC-26 (2.5 µg kg−1). All other isolates tested showed no ZEN production. All tested Fusarium strains produced DON, with levels ranging from 26 to 213 µg kg−1. F. thapsinum FQD-4 produced the highest level (213 µg kg−1) of DON, followed by F. verticillioides FQD-13 (192 µg kg−1) and Fusarium sp. FOFMC-26 (188 µg kg−1). The control samples (uninoculated corn substrate) showed no detectable levels of FUM, ZEN, and DON.
Among the Fusarium isolates tested, F. verticillioides FQD-20 produced high levels of both FUM and ZEN. F. thapsinum FQD-4, which produced the highest level of DON, did not produce FUM and ZEN. Similarly, F. verticillioides FQD-1, which produced the highest level of FUM, produced no ZEN and low levels of DON.

4. Discussion

Food contamination by Fusarium toxins poses serious health and economic problems globally. For example, the natural occurrence of Fusarium toxins in wheat and corn varied significantly between China’s high- and low-risk areas for esophageal cancer, according to Luo et al. [65]. Both the incidence and average levels of DON were higher in the high-risk areas compared to the low-risk areas. Hence, the occurrence of Fusarium toxins in agricultural commodities has been monitored worldwide [65,66,67,68,69,70,71,72,73,74,75,76,77]. In this study, out of 90 cereal grain samples consisting of wheat, corn, rice, and barley, only 3 samples (3.3%), one wheat and two corn, exceeded the EU’s maximum permissible limit for ZEN (200 µg kg−1) and FUM (2000 µg kg−1), respectively. DON levels remained within the permissible limits (1750 µg kg−1). FUM, ZEN, and DON levels in 81%, 97%, and 44% of the samples, respectively, were below the detection limits.
Several studies reported the prevalence of Fusarium toxins in agricultural commodities [17,27,78,79]. Scudamore and Patel [71], while analyzing 82 consignments of maize imported into the UK for Fusarium toxins, reported that fumonisins were detected in almost every sample, and the maximum concentrations found for deoxynivalenol, nivalenol, zearalenone, and fumonisin B1 + fumonisin B2 were 444, 496, 165, and 5002 ppb, respectively. Logrieco et al. [66] reported that wheat and maize collected from Mediterranean countries were contaminated with DON, with levels reaching up to 8 mg kg−1 in wheat and 30 mg kg−1 in maize. Vrabcheva et al. [68] reported that DON and ZEA were the predominant toxins in wheat samples from Bulgaria, with contamination frequencies of 67% and 69%, respectively. The average levels in the contaminated samples were 180 µg kg−1 for DON and 17 µg kg−1 for ZEA, with maximum concentrations of 1800 µg kg−1 and 120 µg kg−1, respectively. In Korea, Lee et al. [80] examined polished rice, brown rice, and two kinds of by-products, viz., discolored rice and blue-tinged (less-ripe) rice, for Fusarium mycotoxins. DON (59 to 1355 ng g−1), Nivalenol (NIV) (66 to 4180 ng g−1), and ZEA (25 to 3305 ng g−1) were found in rice samples that had discolored. ZEA (26 to 3156 ng g−1), NIV (50 to 3607 ng g−1), and DON (86 to 630 ng g−1) were detected in blue-tinged rice. The main contaminants found in brown rice samples were ZEA (47 to 235 ng g−1) and NIV (52 to 569 ng g−1). However, samples of polished rice were mostly devoid of mycotoxins. Birr et al. [81] analyzed forage maize samples collected from Northern Germany and reported high incidences of DON and ZEN (100 and 96%, respectively), with concentrations reaching up to 10,972 μg kg−1 for DON and 3910 μg kg−1 for ZEN. Deoxynivalenol-3-glucoside (DON3G) and 3- and 15-acetyl-deoxynivalenol (3 + 15-AcDON), two modified forms of DON, were also found in almost all samples (100 and 97%, respectively), with maximal values of 3038 μg kg−1 and 2237 μg kg−1. Additionally, ZEN metabolites, α- and β-zearalenol (α-ZEL and β-ZEL), were found in lower incidences (59 and 32%), with concentrations up to 423 μg kg−1 and 203 μg kg−1, respectively. The natural presence of Fusarium mycotoxins in barley and corn samples from Korea was examined by Kim et al. [82]. They discovered that the main contaminants in barley were DON, NIV, and ZEA, with mean concentrations of 170 ng g−1, 1011 ng g−1, and 287 ng g−1, respectively. With mean concentrations of 310 ng g−1 and 297 ng g−1, respectively, DON and 15-acetyldeoxynivalenol (15-ADON) were the main contaminants in corn. Shantika et al. [77] reported that more than 35% of maize food products collected from Indonesia markets contained both DON and FUM simultaneously. DON was found in 42.2% of the samples, but FUM was found in 84.4%. FUM and DON mean values varied from 0.12 µg kg−1 to 264.24 µg kg−1 and 2.62 µg kg−1 to 122.28 µg kg−1, respectively. In their analysis of wheat grain samples gathered from Nakuru and Nyandarua, Kenya, Muthomi et al. [70] discovered that the majority of the samples were tainted with mycotoxins, with occurrence rates of up to 86% for T-2 toxin and 75% for deoxynivalenol (DON). Zearalenone and aflatoxin B1 were among the other mycotoxins found. Up to 35% of the samples had DON, T-2 toxin, and zearalenone co-occurring. Chilaka et al. [75] investigated maize, sorghum, millet, and ogi (akamu) samples from Nigerian markets for Fusarium mycotoxins contamination. Their findings revealed that fumonisins were the most common, particularly in maize and ogi, with occurrence rates of 65% and 93% and mean concentrations of 935 and 1128 μg kg−1, respectively. In addition, multiple toxins were found to be present in 43% of the samples. Stanciu et al. [76] investigated the presence of Fusarium mycotoxins in Romanian wheat flour and grains. They reported that DON was detected in 14% of the samples, containing levels between 111 and 1787 µg kg−1, while ZEN was present in 9% of the samples, with levels between 51 and 1135 µg kg−1. The low levels of mycotoxin contamination in the cereal grain samples in this study might be due to strict import regulations on food commodities and monitoring and good storage practices followed by the traders.
In this study, nineteen Fusarium isolates were found in the tainted grain samples and identified by PCR. On the basis of combined analysis of ITS and EF-1α sequences, these fungal isolates were identified as F. verticillioides (16 isolates), F. thapsinum (1 isolate), and new Fusarium species (2 isolates). Chrpova et al. [83] detected the presence of F. poae and F. graminearum in winter wheat from the Czech Republic. They found that DON production by F. graminearum and F. culmorum was significantly elevated in instances of mixed infections with other species. F. graminearum was the most often observed species in wheat grown in the Netherlands, according to Van der Fels-Klerx et al. [72], followed by F. avenaceum and Microdochium nivale. The incidence and concentrations of DON were the highest, followed by ZEN and beauvericin. According to Lee et al. [80], the blue-tinged rice in Korea had the highest contamination rate with F. graminearum (3.8%), followed by discolored rice (2.4%), and brown rice (1.6%). According to Muthomi et al. [70], samples of freshly harvested wheat grain from Kenya’s Nakuru and Nyandarua exhibited high levels of fungal contamination, particularly from Epicoccum, Alternaria, and Fusarium species. Isolates of F. graminearum demonstrated high virulence and significantly reducing kernel weight.
Numerous mycotoxins, such as FUM, ZEN, fusaric acid, T-2 toxin, HT-2 toxin, and DON, are known to be produced by Fusarium species [66,84,85,86,87,88]. Shi et al. [64] reported that F. proliferatum, F. verticillioides, F. solani, and F. fujikuroi produced fumonisins and fusaric acid; F. oxysporum, F. temperatum, F. subglutinans, F. tricinctum, F. equiseti, F. concentricum, F. musae, F. andiyazi, and F. sacchari produced only fusaric acid; F. sporotrichioides, F. polyphialidicum, and F. langsethiae produced type A trichothecenes; and F. graminearum, F. poae, F. culmorum, and F. meridionale produced type B trichothecenes. The Fusarium species isolated in this study produced FUM at levels ranging from 49.7 to 2489.2 µg kg−1. F. verticillioides isolates exhibited the highest production of FUM. The production of ZEN by the Fusarium spp. ranged from 2.5 to 9.2 µg kg−1. Among them, F. verticillioides FQD-20 yielded the highest concentration at 9.2 µg kg−1. All Fusarium spp. tested produced DON, with concentrations ranging from 26 to 213 µg kg−1. F. thapsinum FQD-4 recorded the highest DON level at 213 µg kg−1, followed by F. verticillioides FQD-13 at 192 µg kg−1 and Fusarium sp. FOFMC-26 at 188 µg kg−1. DON is primarily produced by F. graminearum and F. culmorum [89,90]. When examining the toxigenic potential of certain Fusarium isolates from Mediterranean cereals, Logrieco et al. [66] found that F. culmorum produced ZON, α- and β-ZOH, DON, and 3-AcDON; F. graminearum produced ZON, DON, and 15-AcDON; F. crookwellense produced ZON, α- and β-ZOH, FUS, and NIV; F. equiseti produced ZON and α-ZOH; and F. avenaceum produced moniliformin. None of the isolates of F. moniliforme, F. proliferatum, and F. semitectum were able to produce mycotoxins. However, Ramakrishna et al. [91] reported that F. moniliforme (syn: F. verticillioides) produced DON under optimum conditions, albeit at low concentrations (0.01–0.09 µg g−1 liquid medium). In this study, F. thapsinum FQD-4 isolated from corn produced the highest level of DON. F. thapsinum is a pathogen that causes stalk rot and grain mold of sorghum [92] and stalk rot of maize [93]. It is known to produce high levels of moniliformin and fusaric acid [94]. Leslie et al. [95] reported that F. thapsinum recovered from sorghum produced little to no fumonisins but substantial amounts of moniliformin. Considering the economic significance of corn in Oman and globally, F. thapsinum may be emerging as an important mycotoxigenic fungus.

5. Conclusions

This study revealed that Fusarium toxin levels in 97% of the cereal grain samples collected from Muscat, Oman, were within the permissible limits set by the European Commission. However, 13% of corn samples and 3% of wheat samples exceeded the maximum permissible limit for FUM and ZEN, respectively. The co-occurrence of these mycotoxins could pose health risks to local consumers due to their potential synergistic or additive effects. Fusarium species are a significant source of mycotoxins in food and feed. Furthermore, the presence of toxigenic Fusarium strains in certain grain samples could serve as a source of inoculum, potentially leading to disease outbreaks in wheat crops across various wilayats (provinces) in Oman, where wheat is cultivated. The mold growth and mycotoxin contamination could pose a threat to the quality of cereal grains. Oman imports most cereal grains from other countries, and hence, stricter quarantine regulations are essential to mitigate the risk of mycotoxin contamination. Enhancing consumer awareness about mycotoxins, ensuring proper storage conditions, and promoting food safety practices are essential for preventing Fusarium growth and toxin production in cereal grains. Further investigation is needed to ascertain the production of other mycotoxins by these Fusarium species. As far as we are aware, this is the first report documenting the presence of Fusarium spp. and their associated mycotoxins in cereal grains sold in Oman.

Author Contributions

F.K.H.A.-R., R.V., A.M.A.-S. and M.I.W. planned the study; F.K.H.A.-R. and S.H. conducted the laboratory experiments; F.K.H.A.-R., R.V., A.M.A.-S., M.I.W. and S.H. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

This article includes all data generated or analyzed during this study.

Acknowledgments

The authors are grateful to Ali Al-Raeesi, Central Lab for Phytosanitary & Food Safety, United Integrated Laboratories LLC., Barka, Sultanate of Oman for his help in collection of samples. The first author is thankful to the Deanship of Postgraduate Studies, Sultan Qaboos University for the scholarship, research funds and facilities for this research.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

  1. Lal, R. Feeding 11 billion on 0.5 billion hectare of area under cereal crops. Food Energy Secur. 2016, 5, 239–251. [Google Scholar] [CrossRef]
  2. Bazerghi, C.; McKay, F.H.; Dunn, M. The role of food banks in addressing food insecurity: A systematic review. J. Community Health 2016, 41, 732–740. [Google Scholar] [CrossRef] [PubMed]
  3. Vagsholm, I.; Arzoomand, N.S.; Boqvist, S. Food security, safety, and sustainability—Getting the trade-offs right. Front. Sustain. Food Syst. 2020, 4, 16. [Google Scholar] [CrossRef]
  4. Kabak, B.; Dobson, A.D.W.; Var, I.I.L. Strategies to prevent mycotoxin contamination of food and animal feed: A review. Crit. Rev. Food Sci. Nutr. 2006, 46, 593–619. [Google Scholar] [CrossRef]
  5. Shephard, G.S. Impact of mycotoxins on human health in developing countries. Food Addit. Contam. 2008, 25, 146–151. [Google Scholar] [CrossRef]
  6. Wagacha, J.M.; Muthomi, J.W. Mycotoxin problem in Africa: Current status, implications to food safety and health and possible management strategies. Int. J. Food Microbiol. 2008, 124, 1–12. [Google Scholar] [CrossRef]
  7. Abdin, M.Z.; Ahmad, M.M.; Javed, S. Advances in molecular detection of Aspergillus: An update. Arch. Microbiol. 2010, 192, 409–425. [Google Scholar] [CrossRef]
  8. International Agency for Research on Cancer (IARC). Traditional herbal medicines, some mycotoxins, naphthalene and styrene. In IARC Monographs on the Evaluation of Carcinogenic Risks to Humans; International Agency for Research on Cancer: Lyon, France, 2002; Volume 82, pp. 301–366. [Google Scholar]
  9. Gallo, A.; Mosconi, M.; Trevisi, E.; Santos, R.R. Adverse effects of Fusarium toxins in ruminants: A review of in vivo and in vitro studies. Dairy 2022, 3, 474–499. [Google Scholar] [CrossRef]
  10. Mishra, S.; Dixit, S.; Dwivedi, P.D.; Pandey, H.P.; Das, M. Influence of temperature and pH on the degradation of deoxynivalenol (DON) in aqueous medium: Comparative cytotoxicity of DON and degraded product. Food Addit. Contam. Part A 2014, 31, 121–131. [Google Scholar] [CrossRef]
  11. Ryu, D.; Hanna, M.A.; Eskridge, K.M.; Bullerman, L.B. Heat stability of zearalenone in an aqueous buffered model system. J. Agric. Food Chem. 2003, 51, 1746–1748. [Google Scholar] [CrossRef]
  12. Bryła, M.; Waśkiewicz, A.; Szymczyk, K.; Jędrzejczak, R. Effects of pH and temperature on the stability of fumonisins in maize products. Toxins 2017, 9, 88. [Google Scholar] [CrossRef] [PubMed]
  13. Ji, F.; He, D.; Olaniran, A.O.; Mokoena, M.P.; Xu, J.; Shi, J. Occurrence, toxicity, production and detection of Fusarium mycotoxin: A review. Food Prod. Process. Nutr. 2019, 1, 1–14. [Google Scholar] [CrossRef]
  14. Rheeder, J.P.; Marasas, W.F.; Vismer, H.F. Production of fumonisin analogs by Fusarium species. Appl. Environ. Microbiol. 2002, 68, 2101–2105. [Google Scholar] [CrossRef]
  15. Sanchez-Rangel, D.; SanJuan-Badillo, A.; Plasencia, J. Fumonisin production by Fusarium verticillioides strains isolated from maize in Mexico and development of a polymerase chain reaction to detect potential toxigenic strains in grains. J. Agric. Food Chem. 2005, 53, 8565–8571. [Google Scholar] [CrossRef] [PubMed]
  16. Mogensen, J.M.; Frisvad, J.C.; Thrane, U.; Nielsen, K.F. Production of fumonisin B2 and B4 by Aspergillus niger on grapes and raisins. J. Agric. Food Chem. 2010, 58, 954–958. [Google Scholar] [CrossRef] [PubMed]
  17. Kamle, M.; Mahato, D.K.; Devi, S.; Lee, K.E.; Kang, S.G.; Kumar, P. Fumonisins: Impact on agriculture, food, and human health and their management strategies. Toxins 2019, 11, 328. [Google Scholar] [CrossRef]
  18. Braun, M.S.; Wink, M. Exposure, occurrence, and chemistry of fumonisins and their cryptic derivatives. Compr. Rev. Food Sci. Food Saf. 2018, 17, 769–791. [Google Scholar] [CrossRef]
  19. Damiani, T.; Righetti, L.; Suman, M.; Galaverna, G.; Dall’Asta, C. Analytical issue related to fumonisins: A matter of sample comminution? Food Control 2019, 95, 1–5. [Google Scholar] [CrossRef]
  20. Chulze, S.N. Strategies to reduce mycotoxin levels in maize during storage: A review. Food Addit. Contam. 2010, 27, 651–657. [Google Scholar] [CrossRef]
  21. Cendoya, E.; Chiotta, M.L.; Zachetti, V.; Chulze, S.N.; Ramirez, M.L. Fumonisins and fumonisin-producing Fusarium occurrence in wheat and wheat by products: A review. J. Cereal Sci. 2018, 80, 158–166. [Google Scholar] [CrossRef]
  22. Chu, F.S.; Li, G.Y. Simultaneous occurrence of fumonisin B1 and other mycotoxins in moldy corn collected from the People’s Republic of China in regions with high incidences of esophageal cancer. Appl. Environ. Microbiol. 1994, 60, 847–852. [Google Scholar] [CrossRef] [PubMed]
  23. Harrison, L.R.; Colvin, B.M.; Greene, J.T.; Newman, L.E.; Cole, J.R., Jr. Pulmonary edema and hydrothorax in swine produced by fumonisin B1, a toxic metabolite of Fusarium moniliforme. J. Vet. Diagn. Investig. 1990, 2, 217–221. [Google Scholar] [CrossRef] [PubMed]
  24. Ross, P.F.; Rice, L.G.; Osweiler, G.D.; Nelson, P.E.; Richard, J.L.; Wilson, T.M. A review and update of animal toxicoses associated with fumonisin-contaminated feeds and production of fumonisins by Fusarium isolates. Mycopathologia 1992, 117, 109–114. [Google Scholar] [CrossRef] [PubMed]
  25. Voss, K.A.; Plattner, R.D.; Riley, R.T.; Meredith, F.I.; Norred, W.P. In vivo effects of fumonisin B1-producing and fumonisin B1-nonproducing Fusarium moniliforme isolates are similar: Fumonisins B2 and B3 cause hepato-and nephrotoxicity in rats. Mycopathologia 1998, 141, 45–58. [Google Scholar] [CrossRef] [PubMed]
  26. Jones, C.; Ciacci-Zanella, J.R.; Zhang, Y.; Henderson, G.; Dickman, M. Analysis of fumonisin B1-induced apoptosis. Environ. Health Perspect. 2001, 109, 315–320. [Google Scholar] [CrossRef]
  27. Ropejko, K.; Twarużek, M. Zearalenone and its metabolites- General overview, occurrence, and toxicity. Toxins 2021, 13, 35. [Google Scholar] [CrossRef]
  28. Golge, O.; Kabak, B. Occurrence of deoxynivalenol and zearalenone in cereals and cereal products from Turkey. Food Control 2020, 110, 106982. [Google Scholar] [CrossRef]
  29. Kowalska, K.; Habrowska-Gorczynska, D.E.; Piastowska-Ciesielska, A.W. Zearalenone as an endocrine disruptor in humans. Environ. Toxicol. Pharmacol. 2016, 48, 141–149. [Google Scholar] [CrossRef]
  30. Brodehl, A.; Möller, A.; Kunte, H.J.; Koch, M.; Maul, R. Biotransformation of the mycotoxin zearalenone by fungi of the genera Rhizopus and Aspergillus. FEMS Microbiol. Lett. 2014, 359, 124–130. [Google Scholar] [CrossRef]
  31. Yang, J.Y.; Wang, G.X.; Liu, J.L.; Fan, J.J.; Cui, S. Toxic effects of zearalenone and its derivatives α-zearalenol on male reproductive system in mice. Reprod. Toxicol. 2007, 24, 381–387. [Google Scholar] [CrossRef]
  32. Rai, A.; Das, M.; Tripathi, A. Occurrence and toxicity of a fusarium mycotoxin, zearalenone. Crit. Rev. Food Sci. Nutr. 2020, 60, 2710–2729. [Google Scholar] [CrossRef] [PubMed]
  33. Khan, M.K.; Pandey, A.; Athar, T.; Choudhary, S.; Deval, R.; Gezgin, S.; Hamurcu, M.; Topal, A.; Atmaca, E.; Santos, P.A.; et al. Fusarium head blight in wheat: Contemporary status and molecular approaches. 3 Biotech 2020, 10, 1–17. [Google Scholar] [CrossRef] [PubMed]
  34. Sumarah, M.W. The deoxynivalenol challenge. J. Agric. Food Chem. 2022, 70, 9619–9624. [Google Scholar] [CrossRef] [PubMed]
  35. European Food Safety Authority. Deoxynivalenol in food and feed: Occurrence and exposure. EFSA J. 2013, 11, 3379. [Google Scholar]
  36. Yao, Y.; Long, M. The biological detoxification of deoxynivalenol: A review. Food Chem. Toxicol. 2020, 145, 111649. [Google Scholar] [CrossRef]
  37. Lauren, D.R.; Smith, W.A. Stability of the Fusarium mycotoxins nivalenol, deoxynivalenol and zearalenone in ground maize under typical cooking environments. Food Addit. Contam. 2001, 18, 1011–1016. [Google Scholar] [CrossRef]
  38. Ma, Y.Y.; Guo, H.W. Mini-review of studies on the carcinogenicity of deoxynivalenol. Environ. Toxicol. Pharmacol. 2008, 25, 1–9. [Google Scholar] [CrossRef]
  39. Pestka, J.J.; Smolinski, A.T. Deoxynivalenol: Toxicology and potential effects on humans. J. Toxicol. Environ. Health Part B Crit. Rev. 2005, 8, 39–69. [Google Scholar] [CrossRef]
  40. Pestka, J.J. Deoxynivalenol: Mechanisms of action, human exposure, and toxicological relevance. Arch. Toxicol. 2010, 84, 663–679. [Google Scholar] [CrossRef]
  41. Pinto, A.C.S.M.; De Pierri, C.R.; Evangelista, A.G.; Gomes, A.S.D.L.P.B.; Luciano, F.B. Deoxynivalenol: Toxicology, degradation by bacteria, and phylogenetic analysis. Toxins 2022, 14, 90. [Google Scholar] [CrossRef]
  42. Pestka, J.J. Deoxynivalenol: Toxicity, mechanisms and animal health risks. Anim. Feed Sci. Technol. 2007, 137, 283–298. [Google Scholar] [CrossRef]
  43. Ferrigo, D.; Raiola, A.; Causin, R. Fusarium toxins in cereals: Occurrence, legislation, factors promoting the appearance and their management. Molecules 2016, 21, 627. [Google Scholar] [CrossRef] [PubMed]
  44. Freire, L.; Sant’Ana, A.S. Modified mycotoxins: An updated review on their formation, detection, occurrence, and toxic effects. Food Chem. Toxicol. 2018, 111, 189–205. [Google Scholar] [CrossRef]
  45. Speijers, G.J.A.; Speijers, M.H.M. Combined toxic effects of mycotoxins. Toxicol. Lett. 2004, 153, 91–98. [Google Scholar] [CrossRef] [PubMed]
  46. European Commission. Commission Regulation (EC) No 1881/2006 of 19 December 2006 setting maximum levels for certain contaminants in foodstuffs. Off. J. Eur. Union 2006, L364, 5–24. [Google Scholar]
  47. Mbaga, M.D. Alternative mechanisms for achieving food security in Oman. Agric. Food Secur. 2013, 2, 3. [Google Scholar] [CrossRef]
  48. Elshafie, A.E.; Al-Rashdi, T.A.; Al-Bahry, S.N.; Bakheit, C.S. Fungi and aflatoxins associated with spices in the Sultanate of Oman. Mycopathologia 2002, 155, 155–160. [Google Scholar] [CrossRef]
  49. Al-Alawi, A.K.S.; Al-Mandhari, A.A.S.; Al-Mahmooli, I.H.; Al-Harrasi, M.M.A.; Al-Bulushi, I.M.; Al-Sadi, A.M.; Velazhahan, R. Assessment of aflatoxin B1 content and aflatoxigenic molds in imported food commodities in Muscat, Oman. J. Agric. Mar. Sci. 2023, 28, 1–6. [Google Scholar]
  50. Akintola, A.; Al-Dairi, M.; Imtiaz, A.; Al-Bulushi, I.M.; Gibreel, T.; Al-Sadi, A.M.; Velazhahan, R. The extent of aflatoxin B1 contamination in chili (Capsicum annuum L.) and consumer awareness and knowledge of aflatoxins in Oman. Agriculture 2024, 14, 1536. [Google Scholar] [CrossRef]
  51. Lee, S.B.; Taylor, J.W. Isolation of DNA from Fungal Mycelia and Single Spores. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 282–287. [Google Scholar]
  52. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press, Inc.: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
  53. O’Donnell, K.; Sarver, B.A.J.; Brandt, M.; Chang, D.C.; Noble-Wang, J.; Park, B.J.; Sutton, D.A.; Benjamin, L.; Lindsley, M.; Padhye, A.; et al. Phylogenetic diversity and microsphere array-based genotyping of human pathogenic Fusaria, including isolates from the multistate contact lens-associated US keratitis outbreaks of 2005 and 2006. J. Clin. Microbiol. 2007, 45, 2235–2248. [Google Scholar] [CrossRef]
  54. Al-Sadi, A.M.; Al-Ghaithi, A.G.; Al-Balushi, Z.M.; Al-Jabri, A.H. Analysis of diversity in Pythium aphanidermatum populations from a single greenhouse reveals phenotypic and genotypic changes over 2006 to 2011. Plant Dis. 2012, 96, 852–858. [Google Scholar] [CrossRef] [PubMed]
  55. Hussain, S.; Al-Kharousi, M.; Al-Muharabi, M.A.; Al-Maqbali, D.A.; Al-Shabibi, Z.; Al-Balushi, A.H.; Al-Yahya’ei, M.N.; Al Saady, N.; Abdel-Jalil, R.; Velazhahan, R.; et al. Phylogeny of Agaricus subgenus Pseudochitonia with the description of a new section and a new species from Oman. Mycol. Prog. 2022, 21, 72. [Google Scholar] [CrossRef]
  56. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  57. Summerell, B.A.; Leslie, J.F. Fifty years of Fusarium: How could nine species have ever been enough? Fungal Divers. 2011, 50, 135–144. [Google Scholar] [CrossRef]
  58. Sandoval-Denis, M.; Guarnaccia, V.; Polizzi, G.; Crous, P.W. Symptomatic citrus trees reveal a new pathogenic lineage in Fusarium and two new Neocosmospora species. Persoonia 2018, 40, 1–25. [Google Scholar] [CrossRef]
  59. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
  60. Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; IEEE: Piscataway, NJ, USA, 2010; pp. 1–8. [Google Scholar]
  61. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
  62. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and high-performance computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef]
  63. Rambaut, A. FigTree, Tree Figure Drawing Tool Version 131; Institute of Evolutionary 623 Biology, University of Edinburgh: Edinburgh, UK, 2012. [Google Scholar]
  64. Shi, W.; Tan, Y.; Wang, S.; Gardiner, D.M.; De Saeger, S.; Liao, Y.; Wang, C.; Fan, Y.; Wang, Z.; Wu, A. Mycotoxigenic potentials of Fusarium species in various culture matrices revealed by mycotoxin profiling. Toxins 2017, 9, 6. [Google Scholar] [CrossRef]
  65. Luo, Y.; Yoshizawa, T.; Katayama, T. Comparative study on the natural occurrence of Fusarium mycotoxins (trichothecenes and zearalenone) in corn and wheat from high-and low-risk areas for human esophageal cancer in China. Appl. Environ. Microbiol. 1990, 56, 3723–3726. [Google Scholar] [CrossRef]
  66. Logrieco, A.; Bottalico, A.; Ricci, V. Occurrence of Fusarium species and their mycotoxins in cereal grains from some Mediterranean countries. Phytopathol. Mediterr. 1990, 29, 81–89. [Google Scholar]
  67. Park, J.J.; Smalley, E.B.; Chu, F.S. Natural occurrence of Fusarium mycotoxins in field samples from the 1992 Wisconsin corn crop. Appl. Environ. Microbiol. 1996, 62, 1642–1648. [Google Scholar] [CrossRef]
  68. Vrabcheva, T.; Geßler, R.; Usleber, E.; Märtlbauer, E. First survey on the natural occurrence of Fusarium mycotoxins in Bulgarian wheat. Mycopathologia 1996, 136, 47–52. [Google Scholar] [CrossRef] [PubMed]
  69. Nikiema, P.N.; Worrillow, L.; Traore, A.S.; Wild, C.P.; Turner, P.C. Fumonisin contamination of maize in Burkina Faso, West Africa. Food Addit. Contam. 2004, 21, 865–870. [Google Scholar] [CrossRef] [PubMed]
  70. Muthomi, J.W.; Ndung’u, J.K.; Gathumbi, J.K.; Mutitu, E.W.; Wagacha, J.M. The occurrence of Fusarium species and mycotoxins in Kenyan wheat. Crop Prot. 2008, 27, 1215–1219. [Google Scholar] [CrossRef]
  71. Scudamore, K.A.; Patel, S. Occurrence of Fusarium mycotoxins in maize imported into the UK, 2004–2007. Food Addit. Contam. Part A 2009, 26, 363–371. [Google Scholar] [CrossRef]
  72. Van der Fels-Klerx, H.J.; De Rijk, T.C.; Booij, C.J.H.; Goedhart, P.W.; Boers, E.A.M.; Zhao, C.; Waalwijk, C.; Mol, H.G.J.; Van der Lee, T.A.J. Occurrence of Fusarium head blight species and Fusarium mycotoxins in winter wheat in the Netherlands in 2009. Food Addit. Contam. Part A 2012, 29, 1716–1726. [Google Scholar] [CrossRef]
  73. Juan, C.; Ritieni, A.; Mañes, J. Occurrence of Fusarium mycotoxins in Italian cereal and cereal products from organic farming. Food Chem. 2013, 141, 1747–1755. [Google Scholar] [CrossRef]
  74. Rodríguez-Carrasco, Y.; Fattore, M.; Albrizio, S.; Berrada, H.; Mañes, J. Occurrence of Fusarium mycotoxins and their dietary intake through beer consumption by the European population. Food Chem. 2015, 178, 149–155. [Google Scholar] [CrossRef]
  75. Chilaka, C.A.; De Boevre, M.; Atanda, O.O.; De Saeger, S. Occurrence of Fusarium mycotoxins in cereal crops and processed products (Ogi) from Nigeria. Toxins 2016, 8, 342. [Google Scholar] [CrossRef]
  76. Stanciu, O.; Juan, C.; Miere, D.; Loghin, F.; Manes, J. Occurrence and co-occurrence of Fusarium mycotoxins in wheat grains and wheat flour from Romania. Food Control 2017, 73, 147–155. [Google Scholar] [CrossRef]
  77. Shantika, Z.R.; Rahayu, W.P.; Lioe, H.N. Co-occurrence and exposure assessment of deoxynivalenol and fumonisins from maize and maize-based products in Indonesia. Food Res. 2024, 8, 413–426. [Google Scholar] [CrossRef] [PubMed]
  78. Sohn, H.B. Co-occurrence of Fusarium mycotoxins in mouldy and healthy corn from Korea. Food Addit. Contam. 1999, 16, 153–158. [Google Scholar] [CrossRef] [PubMed]
  79. Mahato, D.K.; Devi, S.; Pandhi, S.; Sharma, B.; Maurya, K.K.; Mishra, S.; Dhawan, K.; Selvakumar, R.; Kamle, M.; Mishra, A.K.; et al. Occurrence, impact on agriculture, human health, and management strategies of zearalenone in food and feed: A review. Toxins 2021, 13, 92. [Google Scholar] [CrossRef]
  80. Lee, T.; Lee, S.H.; Lee, S.H.; Shin, J.Y.; Yun, J.C.; Lee, Y.W.; Ryu, J.G. Occurrence of Fusarium mycotoxins in rice and its milling by-products in Korea. J. Food Prot. 2011, 74, 1169–1174. [Google Scholar] [CrossRef]
  81. Birr, T.; Jensen, T.; Preußke, N.; Sönnichsen, F.D.; De Boevre, M.; De Saeger, S.; Hasler, M.; Verreet, J.A.; Klink, H. Occurrence of Fusarium mycotoxins and their modified forms in forage maize cultivars. Toxins 2021, 13, 110. [Google Scholar] [CrossRef]
  82. Kim, J.C.; Kang, H.J.; Lee, D.H.; Lee, Y.W.; Yoshizawa, T. Natural occurrence of Fusarium mycotoxins (trichothecenes and zearalenone) in barley and corn in Korea. Appl. Environ. Microbiol. 1993, 59, 3798–3802. [Google Scholar] [CrossRef]
  83. Chrpova, J.; Sip, V.; Sumikova, T.; Salava, J.; Palicova, J.; Stockova, L.; Dzuman, Z.; Hajslova, J. Occurrence of Fusarium species and mycotoxins in wheat grain collected in the Czech Republic. World Mycotoxin J. 2016, 9, 317–327. [Google Scholar] [CrossRef]
  84. Molto, G.A.; Gonzalez, H.H.L.; Resnik, S.L.; Gonzalez, A.P. Production of trichothecenes and zearalenone by isolates of Fusarium spp. from Argentinian maize. Food Addit. Contam. 1997, 14, 263–268. [Google Scholar] [CrossRef]
  85. Bottalico, A.; Perrone, G. Toxigenic Fusarium species and mycotoxins associated with head blight in small-grain cereals in Europe. Eur. J. Plant Pathol. 2002, 108, 611–624. [Google Scholar] [CrossRef]
  86. Quarta, A.; Mita, G.; Haidukowski, M.; Santino, A.; Mulè, G.; Visconti, A. Assessment of trichothecene chemotypes of Fusarium culmorum occurring in Europe. Food Addit. Contam. 2005, 22, 309–315. [Google Scholar] [CrossRef] [PubMed]
  87. Schollenberger, M.; Muller, H.M.; Rufle, M.; Suchy, S.; Plank, S.; Drochner, W. Natural occurrence of 16 Fusarium toxins in grains and feedstuffs of plant origin from Germany. Mycopathologia 2006, 161, 43–52. [Google Scholar] [CrossRef] [PubMed]
  88. Tian, Y.; Tan, Y.; Liu, N.; Liao, Y.; Sun, C.; Wang, S.; Wu, A. Functional agents to biologically control deoxynivalenol contamination in cereal grains. Front. Microbiol. 2016, 7, 395. [Google Scholar] [CrossRef] [PubMed]
  89. Audenaert, K.; Vanheule, A.; Höfte, M.; Haesaert, G. Deoxynivalenol: A major player in the multifaceted response of Fusarium to its environment. Toxins 2013, 6, 1–19. [Google Scholar] [CrossRef] [PubMed]
  90. Munkvold, G.P.; Proctor, R.H.; Moretti, A. Mycotoxin production in Fusarium according to contemporary species concepts. Annu. Rev. Phytopathol. 2021, 59, 373–402. [Google Scholar] [CrossRef]
  91. Ramakrishna, Y.; Bhat, R.V.; Ravindranath, V. Production of deoxynivalenol by Fusarium isolates from samples of wheat associated with a human mycotoxicosis outbreak and from sorghum cultivars. Appl. Environ. Microbiol. 1989, 55, 2619–2620. [Google Scholar] [CrossRef]
  92. Petrovic, T.; Walsh, J.L.; Burgess, L.W.; Summerell, B.A. Fusarium species associated with stalk rot of grain sorghum in the northern grain belt of eastern Australia. Australas. Plant Pathol. 2009, 38, 373–379. [Google Scholar] [CrossRef]
  93. Tahir, A.; Khan, S.N.; Javaid, A.; Riaz, M. Morphological and molecular characterization of Fusarium thapsinum, causing stalk tot of maize in Punjab, Pakistan. Mycopath 2018, 16, 57–64. [Google Scholar]
  94. Pena, G.A.; Sulyok, M.; Chulze, S.N. Effect of interacting conditions of water activity, temperature and incubation time on Fusarium thapsinum and Fusarium andiyazi growth and toxin production on sorghum grains. Int. J. Food Microbiol. 2020, 318, 108468. [Google Scholar] [CrossRef]
  95. Leslie, J.F.; Zeller, K.A.; Lamprecht, S.C.; Rheeder, J.P.; Marasas, W.F. Toxicity, pathogenicity, and genetic differentiation of five species of Fusarium from sorghum and millet. Phytopathology 2005, 95, 275–283. [Google Scholar] [CrossRef]
Figure 1. Maximum likelihood (ML) phylogeny of Fusarium species based on combined ITS-EF-1α sequences, with Fusicolla aquaeductuum as the outgroup taxon. Species of the genus are recovered in two clades, where Clade-I consists of species F. fujikuroi species complex (FFSC), and Clade-II with F. citricola species complex (FCCSC), F. tricinctum species complex (FTSC), F. chlamydosporum species complex (FCSC), and F. incarnatum-equiseti species complex (FIESC). There were 16 isolates of F. verticillioides recovered from corn (10 isolates), barley (4 isolates) and wheat (2 isolates), one isolate of F. thapsinum from corn, and two isolates of a potential new species of Fusarium from wheat. The bootstrap (BT) percentages above 50% are shown above nodes, all the newly generated sequences are in blue highlighted shade in red fonts.
Figure 1. Maximum likelihood (ML) phylogeny of Fusarium species based on combined ITS-EF-1α sequences, with Fusicolla aquaeductuum as the outgroup taxon. Species of the genus are recovered in two clades, where Clade-I consists of species F. fujikuroi species complex (FFSC), and Clade-II with F. citricola species complex (FCCSC), F. tricinctum species complex (FTSC), F. chlamydosporum species complex (FCSC), and F. incarnatum-equiseti species complex (FIESC). There were 16 isolates of F. verticillioides recovered from corn (10 isolates), barley (4 isolates) and wheat (2 isolates), one isolate of F. thapsinum from corn, and two isolates of a potential new species of Fusarium from wheat. The bootstrap (BT) percentages above 50% are shown above nodes, all the newly generated sequences are in blue highlighted shade in red fonts.
Agriculture 14 02225 g001
Table 1. Primers used for identification of fungi in this study.
Table 1. Primers used for identification of fungi in this study.
GenePrimerDirectionSequence (5′→3′)
ITSITS5ForwardGGAAGTAAAAGTCGTAACAAGG
ITS4ReverseTCCTCCGCTTATTGATATGC
EF-1αEF-1α-FForwardATGGGTAAGGAAGACAAGAC
EF-1α-RReverseGGAAGTACCAGTGATCATGTT
Table 2. The levels of fumonisin in cereal grain samples collected from local markets, Oman flour mills company, and quarantine department, in Muscat, Oman.
Table 2. The levels of fumonisin in cereal grain samples collected from local markets, Oman flour mills company, and quarantine department, in Muscat, Oman.
Food ItemsAnalyzed Samples Sample Count and Range of Fumonisin Concentrations (µg kg−1)
<LOD (<30)31–1000 1001–2000 >2000
Corn1539 (38.7–954.3)1 (1096.2)2 (2011.3–2808.5)
Wheat37343 (34.9–95.9)00
Rice55000
Barley33312 (45.1–712.9)00
Total90731412
Table 3. The levels of zearalenone in cereal grain samples collected from local markets, Oman flour mills company, and quarantine department, in Muscat, Oman.
Table 3. The levels of zearalenone in cereal grain samples collected from local markets, Oman flour mills company, and quarantine department, in Muscat, Oman.
Food ItemsAnalyzed Samples Sample Count and Range of Zearalenone Concentrations (µg kg−1)
<LOD (<1.75)1.76–100101–200>200
Corn15141 (2.7)00
Wheat3736001 (293.4)
Rice55 000
Barley33321 (40.7)00
Total9087201
Table 4. The levels of deoxynivalenol (DON) in cereal grain samples collected from local markets, Oman flour mills company, and quarantine department, in Muscat, Oman.
Table 4. The levels of deoxynivalenol (DON) in cereal grain samples collected from local markets, Oman flour mills company, and quarantine department, in Muscat, Oman.
Food ItemsAnalyzed Samples Sample Count and Range of Deoxynivalenol Concentrations (µg kg−1)
<LOD (<18.5)18.6–500 501–1000 1001–1500 >1500
Corn1559 (20.7–398.3)1 (519.3)00
Wheat371719 (22.4–311.5)1 (559.4)00
Rice523 (20.1–56.0)000
Barley331617 (19.2–66.7)000
Total904048200
Table 5. Fusarium species isolated from mycotoxin-contaminated cereal grains and GenBank accession numbers for the internal transcribed spacer (ITS) and translation elongation factor 1-alpha (EF-1α) sequences.
Table 5. Fusarium species isolated from mycotoxin-contaminated cereal grains and GenBank accession numbers for the internal transcribed spacer (ITS) and translation elongation factor 1-alpha (EF-1α) sequences.
IsolateSourceIdentified FungusGenBank Accessions
ITSEF-1α
FQD-1WheatFusarium verticillioidesPQ325649PQ349965
FQD-2WheatFusarium verticillioidesPQ325650PQ349966
FQD-3CornFusarium verticillioidesPQ325651PQ349967
FQD-9BarleyFusarium verticillioidesPQ325652PQ362702
FQD-10BarleyFusarium verticillioidesPQ325653PQ604778
FQD-11BarleyFusarium verticillioidesPQ325654PQ369625
FQD-12BarleyFusarium verticillioidesPQ325655PQ349968
FQD-13CornFusarium verticillioidesPQ325656PQ349973
FQD-16CornFusarium verticillioidesPQ325657PQ409349
FQD-17CornFusarium verticillioidesPQ325658PQ362701
FQD-18CornFusarium verticillioidesPQ325659PQ362700
FQD-20CornFusarium verticillioidesPQ325660PQ409350
FQD-21CornFusarium verticillioidesPQ325661PQ349969
FQD-22CornFusarium verticillioidesPQ325662PQ349970
FQD-23CornFusarium verticillioidesPQ325663PQ349972
FQD-24CornFusarium verticillioidesPQ325664PQ369624
FOFMC-26WheatFusarium sp.PQ325667PQ330259
FOFMC-27WheatFusarium sp.PQ325668PQ330260
FQD-4CornFusarium thapsinumPQ325666PQ330258
Table 6. Mycotoxin production by Fusarium species from cereal grains.
Table 6. Mycotoxin production by Fusarium species from cereal grains.
Fungal IsolatesDeoxynivalenol (µg kg−1)Fumonisin
(µg kg−1)
Zearalenone
(µg kg−1)
Fusarium verticillioides FQD-169.2 ± 4.52489.2 ± 27.3 nd
Fusarium verticillioides FQD-2147.2 ± 13.2 336.5 ± 21.0 2.8 ± 0.1
Fusarium verticillioides FQD-3108.2 ± 4.6 ndnd
Fusarium verticillioides FQD-977.1 ± 8.6 ndnd
Fusarium verticillioides FQD-10161.0 ± 4.0 ndnd
Fusarium verticillioides FQD-1127.7 ± 0.9 379.6 ± 21.0 nd
Fusarium verticillioides FQD-1254.1 ± 2.4 106.0 ± 1.7 nd
Fusarium verticillioides FQD-13192.0 ± 9.9 1044.6 ± 45.1 nd
Fusarium verticillioides FQD-16104.6 ± 12.7 173.9 ± 3.9 nd
Fusarium verticillioides FQD-1767.7 ± 5.2 1895.5± 23.7 nd
Fusarium verticillioides FQD-18133.3 ± 2.6 229.6 ± 60.9 nd
Fusarium verticillioides FQD-2096.7 ± 11.8 2408.1 ± 32.9 9.2 ± 0.0
Fusarium verticillioides FQD-2131.1 ± 0.7 137.8 ± 42.3 nd
Fusarium verticillioides FQD-2225.6 ± 0.4 49.7 ± 5.1 nd
Fusarium verticillioides FQD-2329.4 ± 0.9 101.4 ± 1.0 nd
Fusarium verticillioides FQD-24149.0 ± 15.9 92.1 ± 13.2 nd
Fusarium sp. FOFMC-26188.3 ± 23.6 nd2.5 ± 0.1
Fusarium sp. FOFMC -2768.5 ± 1.4 ndnd
Fusarium thapsinum FQD-4213.0 ± 9.8ndnd
Controlnd * ndnd
Data are means ± standard deviation from triplicate analysis. * Not detected, refers to values below quantification limit of assay.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Al-Rashdi, F.K.H.; Al-Sadi, A.M.; Waly, M.I.; Hussain, S.; Velazhahan, R. Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman. Agriculture 2024, 14, 2225. https://doi.org/10.3390/agriculture14122225

AMA Style

Al-Rashdi FKH, Al-Sadi AM, Waly MI, Hussain S, Velazhahan R. Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman. Agriculture. 2024; 14(12):2225. https://doi.org/10.3390/agriculture14122225

Chicago/Turabian Style

Al-Rashdi, Fatma Khuseib Hamed, Abdullah Mohammed Al-Sadi, Mostafa Ibrahim Waly, Shah Hussain, and Rethinasamy Velazhahan. 2024. "Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman" Agriculture 14, no. 12: 2225. https://doi.org/10.3390/agriculture14122225

APA Style

Al-Rashdi, F. K. H., Al-Sadi, A. M., Waly, M. I., Hussain, S., & Velazhahan, R. (2024). Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman. Agriculture, 14(12), 2225. https://doi.org/10.3390/agriculture14122225

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop