Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Mycotoxin Estimation
2.3. Isolation of Fusarium spp.
2.4. DNA Extraction, Amplification, and Sequencing
2.5. Sequence Alignment and Phylogenetic Analyses
2.6. Mycotoxigenic Potential of Fusarium spp.
3. Results
3.1. Occurrence of Fumonisin
3.2. Occurrence of Zearalenone
3.3. Occurrence of DON
3.4. Isolation of Fusarium spp. from Cereal Grains
3.5. Phylogenetic Analysis
3.6. Mycotoxin Production by Fusarium spp.
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lal, R. Feeding 11 billion on 0.5 billion hectare of area under cereal crops. Food Energy Secur. 2016, 5, 239–251. [Google Scholar] [CrossRef]
- Bazerghi, C.; McKay, F.H.; Dunn, M. The role of food banks in addressing food insecurity: A systematic review. J. Community Health 2016, 41, 732–740. [Google Scholar] [CrossRef] [PubMed]
- Vagsholm, I.; Arzoomand, N.S.; Boqvist, S. Food security, safety, and sustainability—Getting the trade-offs right. Front. Sustain. Food Syst. 2020, 4, 16. [Google Scholar] [CrossRef]
- Kabak, B.; Dobson, A.D.W.; Var, I.I.L. Strategies to prevent mycotoxin contamination of food and animal feed: A review. Crit. Rev. Food Sci. Nutr. 2006, 46, 593–619. [Google Scholar] [CrossRef]
- Shephard, G.S. Impact of mycotoxins on human health in developing countries. Food Addit. Contam. 2008, 25, 146–151. [Google Scholar] [CrossRef]
- Wagacha, J.M.; Muthomi, J.W. Mycotoxin problem in Africa: Current status, implications to food safety and health and possible management strategies. Int. J. Food Microbiol. 2008, 124, 1–12. [Google Scholar] [CrossRef]
- Abdin, M.Z.; Ahmad, M.M.; Javed, S. Advances in molecular detection of Aspergillus: An update. Arch. Microbiol. 2010, 192, 409–425. [Google Scholar] [CrossRef]
- International Agency for Research on Cancer (IARC). Traditional herbal medicines, some mycotoxins, naphthalene and styrene. In IARC Monographs on the Evaluation of Carcinogenic Risks to Humans; International Agency for Research on Cancer: Lyon, France, 2002; Volume 82, pp. 301–366. [Google Scholar]
- Gallo, A.; Mosconi, M.; Trevisi, E.; Santos, R.R. Adverse effects of Fusarium toxins in ruminants: A review of in vivo and in vitro studies. Dairy 2022, 3, 474–499. [Google Scholar] [CrossRef]
- Mishra, S.; Dixit, S.; Dwivedi, P.D.; Pandey, H.P.; Das, M. Influence of temperature and pH on the degradation of deoxynivalenol (DON) in aqueous medium: Comparative cytotoxicity of DON and degraded product. Food Addit. Contam. Part A 2014, 31, 121–131. [Google Scholar] [CrossRef]
- Ryu, D.; Hanna, M.A.; Eskridge, K.M.; Bullerman, L.B. Heat stability of zearalenone in an aqueous buffered model system. J. Agric. Food Chem. 2003, 51, 1746–1748. [Google Scholar] [CrossRef]
- Bryła, M.; Waśkiewicz, A.; Szymczyk, K.; Jędrzejczak, R. Effects of pH and temperature on the stability of fumonisins in maize products. Toxins 2017, 9, 88. [Google Scholar] [CrossRef] [PubMed]
- Ji, F.; He, D.; Olaniran, A.O.; Mokoena, M.P.; Xu, J.; Shi, J. Occurrence, toxicity, production and detection of Fusarium mycotoxin: A review. Food Prod. Process. Nutr. 2019, 1, 1–14. [Google Scholar] [CrossRef]
- Rheeder, J.P.; Marasas, W.F.; Vismer, H.F. Production of fumonisin analogs by Fusarium species. Appl. Environ. Microbiol. 2002, 68, 2101–2105. [Google Scholar] [CrossRef]
- Sanchez-Rangel, D.; SanJuan-Badillo, A.; Plasencia, J. Fumonisin production by Fusarium verticillioides strains isolated from maize in Mexico and development of a polymerase chain reaction to detect potential toxigenic strains in grains. J. Agric. Food Chem. 2005, 53, 8565–8571. [Google Scholar] [CrossRef] [PubMed]
- Mogensen, J.M.; Frisvad, J.C.; Thrane, U.; Nielsen, K.F. Production of fumonisin B2 and B4 by Aspergillus niger on grapes and raisins. J. Agric. Food Chem. 2010, 58, 954–958. [Google Scholar] [CrossRef] [PubMed]
- Kamle, M.; Mahato, D.K.; Devi, S.; Lee, K.E.; Kang, S.G.; Kumar, P. Fumonisins: Impact on agriculture, food, and human health and their management strategies. Toxins 2019, 11, 328. [Google Scholar] [CrossRef]
- Braun, M.S.; Wink, M. Exposure, occurrence, and chemistry of fumonisins and their cryptic derivatives. Compr. Rev. Food Sci. Food Saf. 2018, 17, 769–791. [Google Scholar] [CrossRef]
- Damiani, T.; Righetti, L.; Suman, M.; Galaverna, G.; Dall’Asta, C. Analytical issue related to fumonisins: A matter of sample comminution? Food Control 2019, 95, 1–5. [Google Scholar] [CrossRef]
- Chulze, S.N. Strategies to reduce mycotoxin levels in maize during storage: A review. Food Addit. Contam. 2010, 27, 651–657. [Google Scholar] [CrossRef]
- Cendoya, E.; Chiotta, M.L.; Zachetti, V.; Chulze, S.N.; Ramirez, M.L. Fumonisins and fumonisin-producing Fusarium occurrence in wheat and wheat by products: A review. J. Cereal Sci. 2018, 80, 158–166. [Google Scholar] [CrossRef]
- Chu, F.S.; Li, G.Y. Simultaneous occurrence of fumonisin B1 and other mycotoxins in moldy corn collected from the People’s Republic of China in regions with high incidences of esophageal cancer. Appl. Environ. Microbiol. 1994, 60, 847–852. [Google Scholar] [CrossRef] [PubMed]
- Harrison, L.R.; Colvin, B.M.; Greene, J.T.; Newman, L.E.; Cole, J.R., Jr. Pulmonary edema and hydrothorax in swine produced by fumonisin B1, a toxic metabolite of Fusarium moniliforme. J. Vet. Diagn. Investig. 1990, 2, 217–221. [Google Scholar] [CrossRef] [PubMed]
- Ross, P.F.; Rice, L.G.; Osweiler, G.D.; Nelson, P.E.; Richard, J.L.; Wilson, T.M. A review and update of animal toxicoses associated with fumonisin-contaminated feeds and production of fumonisins by Fusarium isolates. Mycopathologia 1992, 117, 109–114. [Google Scholar] [CrossRef] [PubMed]
- Voss, K.A.; Plattner, R.D.; Riley, R.T.; Meredith, F.I.; Norred, W.P. In vivo effects of fumonisin B1-producing and fumonisin B1-nonproducing Fusarium moniliforme isolates are similar: Fumonisins B2 and B3 cause hepato-and nephrotoxicity in rats. Mycopathologia 1998, 141, 45–58. [Google Scholar] [CrossRef] [PubMed]
- Jones, C.; Ciacci-Zanella, J.R.; Zhang, Y.; Henderson, G.; Dickman, M. Analysis of fumonisin B1-induced apoptosis. Environ. Health Perspect. 2001, 109, 315–320. [Google Scholar] [CrossRef]
- Ropejko, K.; Twarużek, M. Zearalenone and its metabolites- General overview, occurrence, and toxicity. Toxins 2021, 13, 35. [Google Scholar] [CrossRef]
- Golge, O.; Kabak, B. Occurrence of deoxynivalenol and zearalenone in cereals and cereal products from Turkey. Food Control 2020, 110, 106982. [Google Scholar] [CrossRef]
- Kowalska, K.; Habrowska-Gorczynska, D.E.; Piastowska-Ciesielska, A.W. Zearalenone as an endocrine disruptor in humans. Environ. Toxicol. Pharmacol. 2016, 48, 141–149. [Google Scholar] [CrossRef]
- Brodehl, A.; Möller, A.; Kunte, H.J.; Koch, M.; Maul, R. Biotransformation of the mycotoxin zearalenone by fungi of the genera Rhizopus and Aspergillus. FEMS Microbiol. Lett. 2014, 359, 124–130. [Google Scholar] [CrossRef]
- Yang, J.Y.; Wang, G.X.; Liu, J.L.; Fan, J.J.; Cui, S. Toxic effects of zearalenone and its derivatives α-zearalenol on male reproductive system in mice. Reprod. Toxicol. 2007, 24, 381–387. [Google Scholar] [CrossRef]
- Rai, A.; Das, M.; Tripathi, A. Occurrence and toxicity of a fusarium mycotoxin, zearalenone. Crit. Rev. Food Sci. Nutr. 2020, 60, 2710–2729. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.K.; Pandey, A.; Athar, T.; Choudhary, S.; Deval, R.; Gezgin, S.; Hamurcu, M.; Topal, A.; Atmaca, E.; Santos, P.A.; et al. Fusarium head blight in wheat: Contemporary status and molecular approaches. 3 Biotech 2020, 10, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Sumarah, M.W. The deoxynivalenol challenge. J. Agric. Food Chem. 2022, 70, 9619–9624. [Google Scholar] [CrossRef] [PubMed]
- European Food Safety Authority. Deoxynivalenol in food and feed: Occurrence and exposure. EFSA J. 2013, 11, 3379. [Google Scholar]
- Yao, Y.; Long, M. The biological detoxification of deoxynivalenol: A review. Food Chem. Toxicol. 2020, 145, 111649. [Google Scholar] [CrossRef]
- Lauren, D.R.; Smith, W.A. Stability of the Fusarium mycotoxins nivalenol, deoxynivalenol and zearalenone in ground maize under typical cooking environments. Food Addit. Contam. 2001, 18, 1011–1016. [Google Scholar] [CrossRef]
- Ma, Y.Y.; Guo, H.W. Mini-review of studies on the carcinogenicity of deoxynivalenol. Environ. Toxicol. Pharmacol. 2008, 25, 1–9. [Google Scholar] [CrossRef]
- Pestka, J.J.; Smolinski, A.T. Deoxynivalenol: Toxicology and potential effects on humans. J. Toxicol. Environ. Health Part B Crit. Rev. 2005, 8, 39–69. [Google Scholar] [CrossRef]
- Pestka, J.J. Deoxynivalenol: Mechanisms of action, human exposure, and toxicological relevance. Arch. Toxicol. 2010, 84, 663–679. [Google Scholar] [CrossRef]
- Pinto, A.C.S.M.; De Pierri, C.R.; Evangelista, A.G.; Gomes, A.S.D.L.P.B.; Luciano, F.B. Deoxynivalenol: Toxicology, degradation by bacteria, and phylogenetic analysis. Toxins 2022, 14, 90. [Google Scholar] [CrossRef]
- Pestka, J.J. Deoxynivalenol: Toxicity, mechanisms and animal health risks. Anim. Feed Sci. Technol. 2007, 137, 283–298. [Google Scholar] [CrossRef]
- Ferrigo, D.; Raiola, A.; Causin, R. Fusarium toxins in cereals: Occurrence, legislation, factors promoting the appearance and their management. Molecules 2016, 21, 627. [Google Scholar] [CrossRef] [PubMed]
- Freire, L.; Sant’Ana, A.S. Modified mycotoxins: An updated review on their formation, detection, occurrence, and toxic effects. Food Chem. Toxicol. 2018, 111, 189–205. [Google Scholar] [CrossRef]
- Speijers, G.J.A.; Speijers, M.H.M. Combined toxic effects of mycotoxins. Toxicol. Lett. 2004, 153, 91–98. [Google Scholar] [CrossRef] [PubMed]
- European Commission. Commission Regulation (EC) No 1881/2006 of 19 December 2006 setting maximum levels for certain contaminants in foodstuffs. Off. J. Eur. Union 2006, L364, 5–24. [Google Scholar]
- Mbaga, M.D. Alternative mechanisms for achieving food security in Oman. Agric. Food Secur. 2013, 2, 3. [Google Scholar] [CrossRef]
- Elshafie, A.E.; Al-Rashdi, T.A.; Al-Bahry, S.N.; Bakheit, C.S. Fungi and aflatoxins associated with spices in the Sultanate of Oman. Mycopathologia 2002, 155, 155–160. [Google Scholar] [CrossRef]
- Al-Alawi, A.K.S.; Al-Mandhari, A.A.S.; Al-Mahmooli, I.H.; Al-Harrasi, M.M.A.; Al-Bulushi, I.M.; Al-Sadi, A.M.; Velazhahan, R. Assessment of aflatoxin B1 content and aflatoxigenic molds in imported food commodities in Muscat, Oman. J. Agric. Mar. Sci. 2023, 28, 1–6. [Google Scholar]
- Akintola, A.; Al-Dairi, M.; Imtiaz, A.; Al-Bulushi, I.M.; Gibreel, T.; Al-Sadi, A.M.; Velazhahan, R. The extent of aflatoxin B1 contamination in chili (Capsicum annuum L.) and consumer awareness and knowledge of aflatoxins in Oman. Agriculture 2024, 14, 1536. [Google Scholar] [CrossRef]
- Lee, S.B.; Taylor, J.W. Isolation of DNA from Fungal Mycelia and Single Spores. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 282–287. [Google Scholar]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press, Inc.: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- O’Donnell, K.; Sarver, B.A.J.; Brandt, M.; Chang, D.C.; Noble-Wang, J.; Park, B.J.; Sutton, D.A.; Benjamin, L.; Lindsley, M.; Padhye, A.; et al. Phylogenetic diversity and microsphere array-based genotyping of human pathogenic Fusaria, including isolates from the multistate contact lens-associated US keratitis outbreaks of 2005 and 2006. J. Clin. Microbiol. 2007, 45, 2235–2248. [Google Scholar] [CrossRef]
- Al-Sadi, A.M.; Al-Ghaithi, A.G.; Al-Balushi, Z.M.; Al-Jabri, A.H. Analysis of diversity in Pythium aphanidermatum populations from a single greenhouse reveals phenotypic and genotypic changes over 2006 to 2011. Plant Dis. 2012, 96, 852–858. [Google Scholar] [CrossRef] [PubMed]
- Hussain, S.; Al-Kharousi, M.; Al-Muharabi, M.A.; Al-Maqbali, D.A.; Al-Shabibi, Z.; Al-Balushi, A.H.; Al-Yahya’ei, M.N.; Al Saady, N.; Abdel-Jalil, R.; Velazhahan, R.; et al. Phylogeny of Agaricus subgenus Pseudochitonia with the description of a new section and a new species from Oman. Mycol. Prog. 2022, 21, 72. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Summerell, B.A.; Leslie, J.F. Fifty years of Fusarium: How could nine species have ever been enough? Fungal Divers. 2011, 50, 135–144. [Google Scholar] [CrossRef]
- Sandoval-Denis, M.; Guarnaccia, V.; Polizzi, G.; Crous, P.W. Symptomatic citrus trees reveal a new pathogenic lineage in Fusarium and two new Neocosmospora species. Persoonia 2018, 40, 1–25. [Google Scholar] [CrossRef]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; IEEE: Piscataway, NJ, USA, 2010; pp. 1–8. [Google Scholar]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and high-performance computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef]
- Rambaut, A. FigTree, Tree Figure Drawing Tool Version 131; Institute of Evolutionary 623 Biology, University of Edinburgh: Edinburgh, UK, 2012. [Google Scholar]
- Shi, W.; Tan, Y.; Wang, S.; Gardiner, D.M.; De Saeger, S.; Liao, Y.; Wang, C.; Fan, Y.; Wang, Z.; Wu, A. Mycotoxigenic potentials of Fusarium species in various culture matrices revealed by mycotoxin profiling. Toxins 2017, 9, 6. [Google Scholar] [CrossRef]
- Luo, Y.; Yoshizawa, T.; Katayama, T. Comparative study on the natural occurrence of Fusarium mycotoxins (trichothecenes and zearalenone) in corn and wheat from high-and low-risk areas for human esophageal cancer in China. Appl. Environ. Microbiol. 1990, 56, 3723–3726. [Google Scholar] [CrossRef]
- Logrieco, A.; Bottalico, A.; Ricci, V. Occurrence of Fusarium species and their mycotoxins in cereal grains from some Mediterranean countries. Phytopathol. Mediterr. 1990, 29, 81–89. [Google Scholar]
- Park, J.J.; Smalley, E.B.; Chu, F.S. Natural occurrence of Fusarium mycotoxins in field samples from the 1992 Wisconsin corn crop. Appl. Environ. Microbiol. 1996, 62, 1642–1648. [Google Scholar] [CrossRef]
- Vrabcheva, T.; Geßler, R.; Usleber, E.; Märtlbauer, E. First survey on the natural occurrence of Fusarium mycotoxins in Bulgarian wheat. Mycopathologia 1996, 136, 47–52. [Google Scholar] [CrossRef] [PubMed]
- Nikiema, P.N.; Worrillow, L.; Traore, A.S.; Wild, C.P.; Turner, P.C. Fumonisin contamination of maize in Burkina Faso, West Africa. Food Addit. Contam. 2004, 21, 865–870. [Google Scholar] [CrossRef] [PubMed]
- Muthomi, J.W.; Ndung’u, J.K.; Gathumbi, J.K.; Mutitu, E.W.; Wagacha, J.M. The occurrence of Fusarium species and mycotoxins in Kenyan wheat. Crop Prot. 2008, 27, 1215–1219. [Google Scholar] [CrossRef]
- Scudamore, K.A.; Patel, S. Occurrence of Fusarium mycotoxins in maize imported into the UK, 2004–2007. Food Addit. Contam. Part A 2009, 26, 363–371. [Google Scholar] [CrossRef]
- Van der Fels-Klerx, H.J.; De Rijk, T.C.; Booij, C.J.H.; Goedhart, P.W.; Boers, E.A.M.; Zhao, C.; Waalwijk, C.; Mol, H.G.J.; Van der Lee, T.A.J. Occurrence of Fusarium head blight species and Fusarium mycotoxins in winter wheat in the Netherlands in 2009. Food Addit. Contam. Part A 2012, 29, 1716–1726. [Google Scholar] [CrossRef]
- Juan, C.; Ritieni, A.; Mañes, J. Occurrence of Fusarium mycotoxins in Italian cereal and cereal products from organic farming. Food Chem. 2013, 141, 1747–1755. [Google Scholar] [CrossRef]
- Rodríguez-Carrasco, Y.; Fattore, M.; Albrizio, S.; Berrada, H.; Mañes, J. Occurrence of Fusarium mycotoxins and their dietary intake through beer consumption by the European population. Food Chem. 2015, 178, 149–155. [Google Scholar] [CrossRef]
- Chilaka, C.A.; De Boevre, M.; Atanda, O.O.; De Saeger, S. Occurrence of Fusarium mycotoxins in cereal crops and processed products (Ogi) from Nigeria. Toxins 2016, 8, 342. [Google Scholar] [CrossRef]
- Stanciu, O.; Juan, C.; Miere, D.; Loghin, F.; Manes, J. Occurrence and co-occurrence of Fusarium mycotoxins in wheat grains and wheat flour from Romania. Food Control 2017, 73, 147–155. [Google Scholar] [CrossRef]
- Shantika, Z.R.; Rahayu, W.P.; Lioe, H.N. Co-occurrence and exposure assessment of deoxynivalenol and fumonisins from maize and maize-based products in Indonesia. Food Res. 2024, 8, 413–426. [Google Scholar] [CrossRef] [PubMed]
- Sohn, H.B. Co-occurrence of Fusarium mycotoxins in mouldy and healthy corn from Korea. Food Addit. Contam. 1999, 16, 153–158. [Google Scholar] [CrossRef] [PubMed]
- Mahato, D.K.; Devi, S.; Pandhi, S.; Sharma, B.; Maurya, K.K.; Mishra, S.; Dhawan, K.; Selvakumar, R.; Kamle, M.; Mishra, A.K.; et al. Occurrence, impact on agriculture, human health, and management strategies of zearalenone in food and feed: A review. Toxins 2021, 13, 92. [Google Scholar] [CrossRef]
- Lee, T.; Lee, S.H.; Lee, S.H.; Shin, J.Y.; Yun, J.C.; Lee, Y.W.; Ryu, J.G. Occurrence of Fusarium mycotoxins in rice and its milling by-products in Korea. J. Food Prot. 2011, 74, 1169–1174. [Google Scholar] [CrossRef]
- Birr, T.; Jensen, T.; Preußke, N.; Sönnichsen, F.D.; De Boevre, M.; De Saeger, S.; Hasler, M.; Verreet, J.A.; Klink, H. Occurrence of Fusarium mycotoxins and their modified forms in forage maize cultivars. Toxins 2021, 13, 110. [Google Scholar] [CrossRef]
- Kim, J.C.; Kang, H.J.; Lee, D.H.; Lee, Y.W.; Yoshizawa, T. Natural occurrence of Fusarium mycotoxins (trichothecenes and zearalenone) in barley and corn in Korea. Appl. Environ. Microbiol. 1993, 59, 3798–3802. [Google Scholar] [CrossRef]
- Chrpova, J.; Sip, V.; Sumikova, T.; Salava, J.; Palicova, J.; Stockova, L.; Dzuman, Z.; Hajslova, J. Occurrence of Fusarium species and mycotoxins in wheat grain collected in the Czech Republic. World Mycotoxin J. 2016, 9, 317–327. [Google Scholar] [CrossRef]
- Molto, G.A.; Gonzalez, H.H.L.; Resnik, S.L.; Gonzalez, A.P. Production of trichothecenes and zearalenone by isolates of Fusarium spp. from Argentinian maize. Food Addit. Contam. 1997, 14, 263–268. [Google Scholar] [CrossRef]
- Bottalico, A.; Perrone, G. Toxigenic Fusarium species and mycotoxins associated with head blight in small-grain cereals in Europe. Eur. J. Plant Pathol. 2002, 108, 611–624. [Google Scholar] [CrossRef]
- Quarta, A.; Mita, G.; Haidukowski, M.; Santino, A.; Mulè, G.; Visconti, A. Assessment of trichothecene chemotypes of Fusarium culmorum occurring in Europe. Food Addit. Contam. 2005, 22, 309–315. [Google Scholar] [CrossRef] [PubMed]
- Schollenberger, M.; Muller, H.M.; Rufle, M.; Suchy, S.; Plank, S.; Drochner, W. Natural occurrence of 16 Fusarium toxins in grains and feedstuffs of plant origin from Germany. Mycopathologia 2006, 161, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Tan, Y.; Liu, N.; Liao, Y.; Sun, C.; Wang, S.; Wu, A. Functional agents to biologically control deoxynivalenol contamination in cereal grains. Front. Microbiol. 2016, 7, 395. [Google Scholar] [CrossRef] [PubMed]
- Audenaert, K.; Vanheule, A.; Höfte, M.; Haesaert, G. Deoxynivalenol: A major player in the multifaceted response of Fusarium to its environment. Toxins 2013, 6, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Munkvold, G.P.; Proctor, R.H.; Moretti, A. Mycotoxin production in Fusarium according to contemporary species concepts. Annu. Rev. Phytopathol. 2021, 59, 373–402. [Google Scholar] [CrossRef]
- Ramakrishna, Y.; Bhat, R.V.; Ravindranath, V. Production of deoxynivalenol by Fusarium isolates from samples of wheat associated with a human mycotoxicosis outbreak and from sorghum cultivars. Appl. Environ. Microbiol. 1989, 55, 2619–2620. [Google Scholar] [CrossRef]
- Petrovic, T.; Walsh, J.L.; Burgess, L.W.; Summerell, B.A. Fusarium species associated with stalk rot of grain sorghum in the northern grain belt of eastern Australia. Australas. Plant Pathol. 2009, 38, 373–379. [Google Scholar] [CrossRef]
- Tahir, A.; Khan, S.N.; Javaid, A.; Riaz, M. Morphological and molecular characterization of Fusarium thapsinum, causing stalk tot of maize in Punjab, Pakistan. Mycopath 2018, 16, 57–64. [Google Scholar]
- Pena, G.A.; Sulyok, M.; Chulze, S.N. Effect of interacting conditions of water activity, temperature and incubation time on Fusarium thapsinum and Fusarium andiyazi growth and toxin production on sorghum grains. Int. J. Food Microbiol. 2020, 318, 108468. [Google Scholar] [CrossRef]
- Leslie, J.F.; Zeller, K.A.; Lamprecht, S.C.; Rheeder, J.P.; Marasas, W.F. Toxicity, pathogenicity, and genetic differentiation of five species of Fusarium from sorghum and millet. Phytopathology 2005, 95, 275–283. [Google Scholar] [CrossRef]

| Gene | Primer | Direction | Sequence (5′→3′) |
|---|---|---|---|
| ITS | ITS5 | Forward | GGAAGTAAAAGTCGTAACAAGG |
| ITS4 | Reverse | TCCTCCGCTTATTGATATGC | |
| EF-1α | EF-1α-F | Forward | ATGGGTAAGGAAGACAAGAC |
| EF-1α-R | Reverse | GGAAGTACCAGTGATCATGTT |
| Food Items | Analyzed Samples | Sample Count and Range of Fumonisin Concentrations (µg kg−1) | |||
|---|---|---|---|---|---|
| <LOD (<30) | 31–1000 | 1001–2000 | >2000 | ||
| Corn | 15 | 3 | 9 (38.7–954.3) | 1 (1096.2) | 2 (2011.3–2808.5) |
| Wheat | 37 | 34 | 3 (34.9–95.9) | 0 | 0 |
| Rice | 5 | 5 | 0 | 0 | 0 |
| Barley | 33 | 31 | 2 (45.1–712.9) | 0 | 0 |
| Total | 90 | 73 | 14 | 1 | 2 |
| Food Items | Analyzed Samples | Sample Count and Range of Zearalenone Concentrations (µg kg−1) | |||
|---|---|---|---|---|---|
| <LOD (<1.75) | 1.76–100 | 101–200 | >200 | ||
| Corn | 15 | 14 | 1 (2.7) | 0 | 0 |
| Wheat | 37 | 36 | 0 | 0 | 1 (293.4) |
| Rice | 5 | 5 | 0 | 0 | 0 |
| Barley | 33 | 32 | 1 (40.7) | 0 | 0 |
| Total | 90 | 87 | 2 | 0 | 1 |
| Food Items | Analyzed Samples | Sample Count and Range of Deoxynivalenol Concentrations (µg kg−1) | ||||
|---|---|---|---|---|---|---|
| <LOD (<18.5) | 18.6–500 | 501–1000 | 1001–1500 | >1500 | ||
| Corn | 15 | 5 | 9 (20.7–398.3) | 1 (519.3) | 0 | 0 |
| Wheat | 37 | 17 | 19 (22.4–311.5) | 1 (559.4) | 0 | 0 |
| Rice | 5 | 2 | 3 (20.1–56.0) | 0 | 0 | 0 |
| Barley | 33 | 16 | 17 (19.2–66.7) | 0 | 0 | 0 |
| Total | 90 | 40 | 48 | 2 | 0 | 0 |
| Isolate | Source | Identified Fungus | GenBank Accessions | |
|---|---|---|---|---|
| ITS | EF-1α | |||
| FQD-1 | Wheat | Fusarium verticillioides | PQ325649 | PQ349965 |
| FQD-2 | Wheat | Fusarium verticillioides | PQ325650 | PQ349966 |
| FQD-3 | Corn | Fusarium verticillioides | PQ325651 | PQ349967 |
| FQD-9 | Barley | Fusarium verticillioides | PQ325652 | PQ362702 |
| FQD-10 | Barley | Fusarium verticillioides | PQ325653 | PQ604778 |
| FQD-11 | Barley | Fusarium verticillioides | PQ325654 | PQ369625 |
| FQD-12 | Barley | Fusarium verticillioides | PQ325655 | PQ349968 |
| FQD-13 | Corn | Fusarium verticillioides | PQ325656 | PQ349973 |
| FQD-16 | Corn | Fusarium verticillioides | PQ325657 | PQ409349 |
| FQD-17 | Corn | Fusarium verticillioides | PQ325658 | PQ362701 |
| FQD-18 | Corn | Fusarium verticillioides | PQ325659 | PQ362700 |
| FQD-20 | Corn | Fusarium verticillioides | PQ325660 | PQ409350 |
| FQD-21 | Corn | Fusarium verticillioides | PQ325661 | PQ349969 |
| FQD-22 | Corn | Fusarium verticillioides | PQ325662 | PQ349970 |
| FQD-23 | Corn | Fusarium verticillioides | PQ325663 | PQ349972 |
| FQD-24 | Corn | Fusarium verticillioides | PQ325664 | PQ369624 |
| FOFMC-26 | Wheat | Fusarium sp. | PQ325667 | PQ330259 |
| FOFMC-27 | Wheat | Fusarium sp. | PQ325668 | PQ330260 |
| FQD-4 | Corn | Fusarium thapsinum | PQ325666 | PQ330258 |
| Fungal Isolates | Deoxynivalenol (µg kg−1) | Fumonisin (µg kg−1) | Zearalenone (µg kg−1) |
|---|---|---|---|
| Fusarium verticillioides FQD-1 | 69.2 ± 4.5 | 2489.2 ± 27.3 | nd |
| Fusarium verticillioides FQD-2 | 147.2 ± 13.2 | 336.5 ± 21.0 | 2.8 ± 0.1 |
| Fusarium verticillioides FQD-3 | 108.2 ± 4.6 | nd | nd |
| Fusarium verticillioides FQD-9 | 77.1 ± 8.6 | nd | nd |
| Fusarium verticillioides FQD-10 | 161.0 ± 4.0 | nd | nd |
| Fusarium verticillioides FQD-11 | 27.7 ± 0.9 | 379.6 ± 21.0 | nd |
| Fusarium verticillioides FQD-12 | 54.1 ± 2.4 | 106.0 ± 1.7 | nd |
| Fusarium verticillioides FQD-13 | 192.0 ± 9.9 | 1044.6 ± 45.1 | nd |
| Fusarium verticillioides FQD-16 | 104.6 ± 12.7 | 173.9 ± 3.9 | nd |
| Fusarium verticillioides FQD-17 | 67.7 ± 5.2 | 1895.5± 23.7 | nd |
| Fusarium verticillioides FQD-18 | 133.3 ± 2.6 | 229.6 ± 60.9 | nd |
| Fusarium verticillioides FQD-20 | 96.7 ± 11.8 | 2408.1 ± 32.9 | 9.2 ± 0.0 |
| Fusarium verticillioides FQD-21 | 31.1 ± 0.7 | 137.8 ± 42.3 | nd |
| Fusarium verticillioides FQD-22 | 25.6 ± 0.4 | 49.7 ± 5.1 | nd |
| Fusarium verticillioides FQD-23 | 29.4 ± 0.9 | 101.4 ± 1.0 | nd |
| Fusarium verticillioides FQD-24 | 149.0 ± 15.9 | 92.1 ± 13.2 | nd |
| Fusarium sp. FOFMC-26 | 188.3 ± 23.6 | nd | 2.5 ± 0.1 |
| Fusarium sp. FOFMC -27 | 68.5 ± 1.4 | nd | nd |
| Fusarium thapsinum FQD-4 | 213.0 ± 9.8 | nd | nd |
| Control | nd * | nd | nd |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Rashdi, F.K.H.; Al-Sadi, A.M.; Waly, M.I.; Hussain, S.; Velazhahan, R. Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman. Agriculture 2024, 14, 2225. https://doi.org/10.3390/agriculture14122225
Al-Rashdi FKH, Al-Sadi AM, Waly MI, Hussain S, Velazhahan R. Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman. Agriculture. 2024; 14(12):2225. https://doi.org/10.3390/agriculture14122225
Chicago/Turabian StyleAl-Rashdi, Fatma Khuseib Hamed, Abdullah Mohammed Al-Sadi, Mostafa Ibrahim Waly, Shah Hussain, and Rethinasamy Velazhahan. 2024. "Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman" Agriculture 14, no. 12: 2225. https://doi.org/10.3390/agriculture14122225
APA StyleAl-Rashdi, F. K. H., Al-Sadi, A. M., Waly, M. I., Hussain, S., & Velazhahan, R. (2024). Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman. Agriculture, 14(12), 2225. https://doi.org/10.3390/agriculture14122225

