Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Development of KASP Markers
2.3. DNA Isolation and KASP Genotyping
2.4. Experiment Field Management and Investigation of Agronomic Characteristics and Rice Quality
2.5. Data Statistical Analysis
3. Results
3.1. Molecular Marker-Assisted Selection of Restorer Line Zhehuizhi810
3.2. Breeding of Indica–Japonica Hybrid Rice Zheyou810
3.3. Production Performance and Agronomic Traits of Zheyou810
3.4. Rice Quality of Zheyou810
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ikehashi, H.; Araki, H. Screening and genetic analysis of wide-compatibility in F1 hybrids of distant crosses in rice, Oryza sativa L. Tech. Bull. Trop. Agric. Res. Cent. 1987, 2, 231–241. [Google Scholar]
- Chen, J.; Ding, J.; Ouyang, Y.; Du, H.; Yang, J.; Cheng, K.; Zhao, J.; Qiu, S.; Zhang, X.; Yao, J.; et al. A triallelic system of S5 is a major regulator of the reproductive barrier and compatibility of indica–japonica hybrids in rice. Proc. Natl. Acad. Sci. USA 2008, 105, 11436–11441. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Zhao, X.; Cheng, K.; Du, H.; Ouyang, Y.; Chen, J.; Qiu, S.; Huang, J.; Jiang, Y.; Jiang, L. A killer-protector system regulates both hybrid sterility and segregation distortion in rice. Science 2012, 337, 1336–1340. [Google Scholar] [CrossRef]
- Wang, C.; Wang, J.; Lu, J.; Xiong, Y.; Zhao, Z.; Yu, X.; Zheng, X.; Li, J.; Lin, Q.; Ren, Y.; et al. A natural gene drive system confers reproductive isolation in rice. Cell 2023, 186, 3577–3592.e18. [Google Scholar] [CrossRef]
- Sano, Y. Differential regulation of waxy gene expression in rice endosperm. Theor. Appl. Genet. 1984, 68, 467–473. [Google Scholar] [CrossRef]
- Cai, X.L.; Wang, Z.Y.; Xing, Y.Y.; Zhang, J.L.; Hong, M.M. Aberrant splicing of intron 1 leads to the heterogeneous 5′ UTR and decreased expression of waxy gene in rice cultivars of intermediate amylose content. Plant J. 1998, 14, 459–465. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zhang, D.; Wang, M.; Sun, J.; Qi, Y.; Li, J.; Wei, X.; Han, L.; Qiu, Z.; Tang, S.; et al. A core collection and mini core collection of Oryza sativa L. in China. Theor. Appl. Genet. 2011, 122, 49–61. [Google Scholar] [CrossRef]
- Fujita, N.; Yoshida, M.; Kondo, T.; Saito, K.; Utsumi, Y.; Tokunaga, T.; Nishi, A.; Satoh, H.; Park, J.-H.; Jane, J.-L.; et al. Characterization of SSIIIa-Deficient Mutants of Rice: The Function of SSIIIa and Pleiotropic Effects by SSIIIa Deficiency in the Rice Endosperm. Plant Physiol. 2007, 144, 2009–2023. [Google Scholar] [CrossRef]
- Zhou, L.; Chen, S.; Yang, G.; Zha, W.; Cai, H.; Li, S.; Chen, Z.; Liu, K.; Xu, H.; You, A. A perfect functional marker for the gene of intermediate amylose content Wx-in in rice (Oryza sativa L.). Crop. Breed. Appl. Biotechnol. 2018, 18, 103–109. [Google Scholar] [CrossRef]
- Jin, L.; Lu, Y.; Shao, Y.; Zhang, G.; Xiao, P.; Shen, S.; Corke, H.; Bao, J. Molecular marker assisted selection for improvement of the eating, cooking and sensory quality of rice (Oryza sativa L.). J. Cereal Sci. 2010, 51, 159–164. [Google Scholar] [CrossRef]
- Liu, Q.-Q.; Li, Q.-F.; Cai, X.-L.; Wang, H.-M.; Tang, S.-Z.; Yu, H.-X.; Wang, Z.-Y.; Gu, M.-H. Molecular Marker-Assisted Selection for Improved Cooking and Eating Quality of Two Elite Parents of Hybrid Rice. Crop. Sci. 2006, 46, 2354–2360. [Google Scholar] [CrossRef]
- Isshiki, M.; Morino, K.; Nakajima, M.; Okagaki, R.J.; Wessler, S.R.; Izawa, T.; Shimamoto, K. A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5′ splice site of the first intron. Plant J. 1998, 15, 133–138. [Google Scholar] [CrossRef]
- Jie, M. Research on rice quality and high quality attainment rate of Chinese hybrid japonica rice. Hybrid Rice 2007, 22, 1. [Google Scholar]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Varshney, R.K.; Terauchi, R.; McCouch, S.R. Harvesting the Promising Fruits of Genomics: Applying Genome Sequencing Technologies to Crop Breeding. PLoS Biol. 2014, 12, e1001883. [Google Scholar] [CrossRef]
- Rasheed, A.; Wen, W.; Gao, F.; Zhai, S.; Jin, H.; Liu, J.; Guo, Q.; Zhang, Y.; Dreisigacker, S.; Xia, X.; et al. Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theor. Appl. Genet. 2016, 129, 1843–1860. [Google Scholar] [CrossRef] [PubMed]
- Jagtap, A.B.; Vikal, Y.; Johal, G.S. Genome-wide development and validation of cost-effective KASP marker assays for genetic dissection of heat stress tolerance in maize. Int. J. Mol. Sci. 2020, 21, 7386. [Google Scholar] [CrossRef] [PubMed]
- Rosso, M.L.; Shang, C.; Song, Q.; Escamilla, D.; Gillenwater, J.; Zhang, B. Development of Breeder-Friendly KASP Markers for Low Concentration of Kunitz Trypsin Inhibitor in Soybean Seeds. Int. J. Mol. Sci. 2021, 22, 2675. [Google Scholar] [CrossRef]
- Zhao, Y.; Chen, W.; Cui, Y.; Sang, X.; Lu, J.; Jing, H.; Wang, W.; Zhao, P.; Wang, H. Detection of candidate genes and development of KASP markers for Verticillium wilt resistance by combining genome-wide association study, QTL-seq and transcriptome sequencing in cotton. Theor. Appl. Genet. 2021, 134, 1063–1081. [Google Scholar] [CrossRef]
- Tian, D.; Guo, X.; Zhang, Z.; Wang, M.; Wang, F. Improving blast resistance of the rice restorer line, Hui 316, by introducing Pi9 or Pi2 with marker-assisted selection. Biotechnol. Biotechnol. Equip. 2019, 33, 1195–1203. [Google Scholar] [CrossRef]
- Wei, Y.; Li, X.; He, X.; Chen, H.; Chen, Y.; Huang, K.; Lu, D.; Guo, S. Development and evaluation of rice blast resistance gene (Pi9) SNP molecular markers based on KASP technology. Southwest China J. Agric. Sci. 2019, 32, 1216–1222. [Google Scholar]
- Liu, Y.; Wang, F.; Zhang, A.; Kong, D.; Liu, G.; Luo, L.; Yu, X. Development and validation of functional markers (tetra-primer ARMS and KASP) for the bacterial blight resistance gene xa5 in rice. Australas. Plant Pathol. 2021, 50, 323–327. [Google Scholar] [CrossRef]
- Cheon, K.-S.; Jeong, Y.-M.; Lee, Y.-Y.; Oh, J.; Kang, D.-Y.; Oh, H.; Kim, S.L.; Kim, N.; Lee, E.; Baek, J. Kompetitive allele-specific PCR marker development and quantitative trait locus mapping for bakanae disease resistance in Korean japonica rice varieties. Plant Breed. Biotechnol. 2019, 7, 208–219. [Google Scholar] [CrossRef]
- Lee, S.-M.; Kwon, Y.-H.; Kang, J.-W.; Lee, J.-Y.; Jo, S.; Shin, D.; Cha, J.-K.; Park, D.-S.; Cho, J.-H.; Lee, J.-H. Classification of Korean Rice Cultivars through Amylose Content Using Molecular Markers Targeting the Waxy Locus. Korean Soc. Breed. Sci. 2021, 53, 361–372. [Google Scholar] [CrossRef]
- Kim, M.-S.; Yang, J.-Y.; Yu, J.-K.; Lee, Y.; Park, Y.-J.; Kang, K.-K.; Cho, Y.-G. Breeding of high cooking and eating quality in rice by Marker-Assisted Backcrossing (MABc) using KASP markers. Plants 2021, 10, 804. [Google Scholar] [CrossRef]
- Adeva, C.C.; Lee, H.-S.; Kim, S.-H.; Jeon, Y.-A.; Shim, K.-C.; Luong, N.H.; Kang, J.-W.; Kim, C.-S.; Cho, J.-H.; Ahn, S.-N. Two complementary genes, SBE3 and GBSS1 contribute to high amylose content in japonica cultivar Dodamssal. Plant Breed. Biotechnol. 2020, 8, 354–367. [Google Scholar] [CrossRef]
- Yang, G.; Chen, S.; Chen, L.; Gao, W.; Huang, Y.; Huang, C.; Zhou, D.; Wang, J.; Liu, Y.; Huang, M. Development and utilization of functional KASP markers to improve rice eating and cooking quality through MAS breeding. Euphytica 2019, 215, 66. [Google Scholar] [CrossRef]
- Addison, C.K.; Angira, B.; Kongchum, M.; Harrell, D.L.; Baisakh, N.; Linscombe, S.D.; Famoso, A.N. Characterization of haplotype diversity in the BADH2 aroma gene and development of a KASP SNP assay for predicting aroma in US rice. Rice 2020, 13, 47. [Google Scholar] [CrossRef] [PubMed]
- Steele, K.; Tulloch, M.Q.; Burns, M.; Nader, W. Developing KASP markers for identification of basmati rice varieties. Food Anal. Methods 2021, 14, 663–673. [Google Scholar] [CrossRef]
- Luong, N.H.; Jeon, Y.-A.; Shim, K.-C.; Kim, S.; Lee, H.-S.; Adeva, C.; Ahn, S.-N. Characterization of the Spikelet Number per Panicle QTL qSPP7 Using a Nearly Isogenic Line Derived from an Interspecific Cross in Rice. Plant Breed. Biotechnol. 2019, 7, 245–256. [Google Scholar] [CrossRef]
- Li, C.; Tang, H.; Luo, W.; Zhang, X.; Mu, Y.; Deng, M.; Liu, Y.; Jiang, Q.; Chen, G.; Wang, J. A novel, validated, and plant height-independent QTL for spike extension length is associated with yield-related traits in wheat. Theor. Appl. Genet. 2020, 133, 3381–3393. [Google Scholar] [CrossRef]
- Shin, Y.; Won, Y.J.; Lee, C.; Cheon, K.-S.; Oh, H.; Lee, G.-S.; Baek, J.; Yoon, I.S.; Kim, S.L.; Cha, Y.-S. Identification of grain size-related QTLs in Korean japonica rice using genome resequencing and high-throughput image analysis. Agriculture 2022, 12, 51. [Google Scholar] [CrossRef]
- Wang, Z.; Yan, L.; Chen, Y.; Wang, X.; Huai, D.; Kang, Y.; Jiang, H.; Liu, K.; Lei, Y.; Liao, B. Detection of a major QTL and development of KASP markers for seed weight by combining QTL-seq, QTL-mapping and RNA-seq in peanut. Theor. Appl. Genet. 2022, 135, 1779–1795. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Wang, J.; Cao, Q.; Chen, Z.; Zhong, W. Development of functional markers for the rice wide compatibility gene S5-n and its application. Acta Agron. Sin. 2009, 35, 7. [Google Scholar] [CrossRef]
- Lin, J.; Song, X.; Wu, M.; Cheng, S. Breeding technology innovation of indica-japonica super hybrid rice and varietal breeding. Sci. Agric. Sin 2016, 49, 207–218. [Google Scholar]
- Chen, M.L.; Shen, Y.M.; Luo, S.Y.; Xiong, H.J.; Wu, X.Y.; Hu, L.X. Molecular marker-assisted selection for high-quality early indica rice cultivar ‘Ganzao You57’. Mol. Plant Breed. 2021, 19, 5. [Google Scholar]
- Wang, Z.Y.; Zheng, F.Q.; Shen, G.Z.; Gao, J.P.; Snustad, D.P.; Li, M.G.; Zhang, J.L.; Hong, M.M. The amylose content in rice endosperm is related to the post-transcriptional regulation of the waxy gene. Plant J. 1995, 7, 613–622. [Google Scholar] [CrossRef] [PubMed]
- Zeng, D.; Tian, Z.; Rao, Y.; Dong, G.; Yang, Y.; Huang, L.; Leng, Y.; Xu, J.; Sun, C.; Zhang, G. Rational design of high-yield and superior-quality rice. Nat. Plants 2017, 3, 17031. [Google Scholar] [CrossRef]
- Yi, M.; Nwe, K.T.; Vanavichit, A.; Chai-arree, W.; Toojinda, T. Marker assisted backcross breeding to improve cooking quality traits in Myanmar rice cultivar Manawthukha. Field Crop. Res. 2009, 113, 178–186. [Google Scholar] [CrossRef]
- Ni, D.; Zhang, S.; Chen, S.; Xu, Y.; Li, L.; Li, H.; Wang, Z.; Cai, X.; Li, Z.; Yang, J. Improving cooking and eating quality of Xieyou57, an elite indica hybrid rice, by marker-assisted selection of the Wx locus. Euphytica 2011, 179, 355–362. [Google Scholar] [CrossRef]




| Line/Variety | Subspecies | S5 Locus | Wx Locus |
|---|---|---|---|
| F1317 | indica | S5-n | Wxa |
| H702 | indica | S5-i | Wxb |
| Zhehuizhi810 | indica | S5-n | Wxb |
| Zhe08A | japonica | S5-j | Wxb |
| Zheyou810 | indica–japonica | S5-n/S5-j | Wxb |
| Gene | Primer | Primer Sequence (5′-3′) * |
|---|---|---|
| Wx | Kwxa-F1 | GAAGGTGACCAAGTTCATGCTAGGAAGAACATCTGCAAGG |
| Kwxb-F2 | GAAGGTCGGAGTCAACGGATTAGGAAGAACATCTGCAAGT | |
| Kwx-R | TTAATTAATTAATTTCCAGCCC | |
| S5 | KS5i-F1 | GAAGGTGACCAAGTTCATGCTAAGAAGGGATTAAATTTGCTCGCT |
| KS5n-F2 | GAAGGTCGGAGTCAACGGATTAAGAAGGGATTAAATTTGCTCGCG | |
| KS5-R | CATACTGTGCTTTGCTACTTACCG |
| Var | Year | GP | EP | PH | PL | NFGP | SS | TGW |
|---|---|---|---|---|---|---|---|---|
| ZY | 2019 | 151.5 ± 9.3 | 244.5 ± 49.5 | 126.6 ± 5.1 | 22.1 ± 0.8 | 244.8 ± 51.4 | 85.1 ± 3.6 | 25.3 ± 1.6 |
| JY | 2019 | 147.5 ± 8.6 | 248.8 ± 33.6 | 109.7 ± 4.6 | 19.1 ± 1.1 | 168.0 ± 41.2 | 85.8 ± 2.1 | 29.1 ± 1.1 |
| ZY | 2020 | 154.9 ± 7.2 | 241.5 ± 37.5 | 124.4 ± 4.3 | 21.9 ± 1.8 | 215.0 ± 40.9 | 79.3 ± 7.7 | 24.0 ± 0.9 |
| JY | 2020 | 150.1 ± 6.4 | 246.2 ± 41.2 | 109.3 ± 3.5 | 19.7 ± 0.9 | 176.6 ± 39.8 | 86.4 ± 5.4 | 28.7 ± 1.2 |
| ZY | Mean | 153.2 ± 8.3 | 243.0 ± 87.0 | 125.5 ± 4.7 | 22.0 ± 2.6 | 229.9 ± 46.2 | 82.2 ± 5.7 | 24.7 ± 1.3 |
| JY | Mean | 148.8 ± 6.6 | 247.5 ± 54.2 | 109.5 ± 5.3 | 19.4 ± 1.9 | 172.3 ± 63.4 | 86.1 ± 6.8 | 28.9 ± 1.0 |
| Index | 2019 | 2020 | Grade |
|---|---|---|---|
| Amylose content (%) | 16.6 | 15.7 | 1 |
| Gel consistency (mm) | 61 | 77 | 3 |
| Alkali dissipation value | 6.2 | 6.1 | 3 |
| Head rice rate (%) | 72.1 | 72.2 | 1 |
| Chalkiness degree (%) | 3.6 | 4.6 | 3 |
| Transparency | 1 | 1 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, J.; Cui, Y.; Fan, H.; Tang, L.; Wang, J. Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield. Agriculture 2023, 13, 1807. https://doi.org/10.3390/agriculture13091807
Song J, Cui Y, Fan H, Tang L, Wang J. Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield. Agriculture. 2023; 13(9):1807. https://doi.org/10.3390/agriculture13091807
Chicago/Turabian StyleSong, Jian, Yongtao Cui, Honghuan Fan, Liqun Tang, and Jianjun Wang. 2023. "Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield" Agriculture 13, no. 9: 1807. https://doi.org/10.3390/agriculture13091807
APA StyleSong, J., Cui, Y., Fan, H., Tang, L., & Wang, J. (2023). Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield. Agriculture, 13(9), 1807. https://doi.org/10.3390/agriculture13091807
