Next Article in Journal
The Effects of Brewer’s Spent Yeast (BSY) Inclusion in Dairy Sheep’s Diets on Ruminal Fermentation and Milk Quality Parameters
Previous Article in Journal
A Co-Simulation Virtual Reality Machinery Simulator for Advanced Precision Agriculture Applications
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico

by
Edgar Enriquez-Gómez
1,
Jorge Acosta-Dibarrat
1,*,
Martín Talavera-Rojas
1,
Edgardo Soriano-Vargas
1,
Armando Navarro
2,
Rosario Morales-Espinosa
3,
Valente Velázquez-Ordoñez
1 and
Luis Cal-Pereyra
4
1
Center for Research and Advanced Studies in Animal Health, Faculty of Veterinary Medicine and Zootechnics, Universidad Autónoma del Estado de México, Toluca C.P. 50295, Mexico
2
Department of Public Health, Faculty of Medicine, Universidad Nacional Autónoma de México, Mexico City C.P. 04510, Mexico
3
Laboratory of Bacterial Genomics, Department of Microbiology and Parasitology, Faculty of Medicine, Universidad Nacional Autónoma de México, Mexico City C.P. 04510, Mexico
4
Pathology Department, Veterinary Faculty, Universidad de la República, Montevideo C.P. 1300, Uruguay
*
Author to whom correspondence should be addressed.
Agriculture 2023, 13(8), 1604; https://doi.org/10.3390/agriculture13081604
Submission received: 30 June 2023 / Revised: 2 August 2023 / Accepted: 7 August 2023 / Published: 13 August 2023
(This article belongs to the Section Farm Animal Production)

Abstract

Sheep represent one of the main reservoirs of diarrheagenic Escherichia coli; this microorganism is an etiological agent of food-borne diseases; therefore, this work aimed to identify and characterize the principal pathotypes of diarrheagenic E. coli (DEC) obtained through rectal swabs and carcasses samples from sheep slaughtered in an abattoir at the central region of Mexico. The isolates were subjected to bacteriological identification, serotyping; phylogenetic classification; detection for virulence factors, and antimicrobial sensibility. A total of 90 E. coli isolates were obtained. It was observed through 49 E. coli isolates (54%), 8 of them from carcasses, and 43 from feces was DEC. DEC serotypes with health public relevance were found: O76:H19 (n = 5), O146:H21 (n = 3), O91:H10 (n = 1), O6:NM (n = 1), and O8:NM (n = 1). Regarding the presence of Shiga toxin-producing E.coli (STEC), 43/90 (47.7%) isolates have the stx1 w/o stx2 genes, and therefore were assigned as STEC non-O157; only one isolate expressed stx1 and eae genes and was classified as t-STEC (typical STEC). Additionally, 3/90 (3.3%) harbored only the eae gene and were classified as enteropathogenic E. coli (EPEC), the stp gene was found in 2/90 isolates (2.2%) and were classified as enterotoxigenic E. coli (ETEC); 1/90 (1.1%) isolates harboring the ipaH were classified as enteroinvasive E. coli EIEC. Regarding stx1 genes subtypes, stx1c only was found in 60.5% (26/43), followed by stx1a-stx1c 20.9% (9/43) and stx1a-stx1d 2.3% (1/43). The presence of both, stx1 and stx2 genes was found in 7/43 isolates (16.3%) from rectal swabs; the combination stx1c-stx2g was detected in 3/43 isolates (6.9%), while 4 (9.4%) isolates showed different patterns (stx1a-stx1c-stx2g; stx1c-stx2b-stx2g; stx1c-stx2b and stx1a-stx1c-stx2b-stx2g). STEC isolates showed the major diversity of phylogenetic groups, although phylogroup B1 was predominant in 90.6% (39/43) while there was only one isolate (2.3%) in each remaining phylogroup (A, B2, C, and F). All EPEC, ETEC, and EIEC isolates were clustered in phylogroup B1. We observed that 27.9% (12/43) of STEC isolates carried at least one antibiotic resistance: nine isolates expressed the tetB gene, one isolate the tetA gene, two isolates the sul2 gene, one isolate the sul1 and one isolate the sul1-tetB genes. These results highlight the importance of diarrheagenic E. coli as a potential risk for public health during the slaughtering process.

1. Introduction

Sheep and other ruminants are regular carriers of commensal Escherichia coli; however, they may harbor some pathogenic E. coli and cause either, diarrhea or extraintestinal illness [1]. The relevance of these diarrheagenic E. coli (DEC) isolates as causative agents of food-borne diseases (FBD) was recently studied in Latin America, although there is a lack of information in some countries regarding the main reservoirs and infection routes [2]. Animal products, like sheep and beef meat, are at risk of contamination by poor hygiene practices during the slaughtering process in the abattoirs, hence, the implementation of good production practices (GPP) and good manufacture practices (GMP) are essential to prevent bacterial contamination of carcasses and ensure food safety [3]. Sheep without diarrhea are usually asymptomatic carriers of zoonotic pathogens and reservoirs of DEC, which could enter the production line, especially in the critical control points [4]. The animals that arrive at the slaughterhouse are the principal focus of contamination towards drinking water and animal products, allowing the direct transmission of zoonotic microorganisms to the human population [5].
At least five E. coli pathotypes are related to gastrointestinal illness in humans: Shiga-toxin-producing E. coli (STEC), enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), and enteroaggregative E. coli (EAEC) [6]. These pathotypes are classified according to their virulence factors. The principal virulence factor of STEC is the production of a toxin that inhibits protein synthesis coded by stx1 and stx2 genes and their variants; moreover, other virulence factors like the intimin (encoded by eae gene) or autoagglutinating adhesins can be found [7].
Shiga toxins are classified as stx1 and stx2. The stx1 toxins are a homogeneous group with three subtypes: stx1a, stx1c, and stx1d. On the other hand, stx2 toxins are more heterogeneous with a greater number of subtypes that include stx2a, stx2b, stx2c, stx2d, stx2e, stx2f and stx2g, with stx2c and stx2d being the most strongly associated with hemolytic uremic syndrome (HUS). Other relevant virulence factors include the intimin (encoded by eae gene), a plasmid-carried enterohaemolysin (encoded by ehxA gene), and putative adhesins genes like Tox B, saa, espC, and espP [8,9].
The presence or absence of the eae gene in STEC strains allows classifying them into the typical virulent (t-STEC) or atypical strains of low virulence (a-STEC). STEC strains induce gastroenteritis and further complications such as HUS or hemorrhagic colitis (HC), which can lead to chronic kidney dysfunction, especially in infants and the elderly [6]. EPEC produces the attachment and effacing (A/E) lesions onto intestinal mucosa. This pathotype is divided into two categories based on the presence or absence of the bundle-forming pilus (bfp) gene; strains that contain this gene are classified as typical (t-EPEC), while the ones that lack this gene are atypical (a-EPEC). Curiously, the a-EPEC strains are more common in developing countries; in contrast, t-EPEC causes diarrhea in children from developed countries [10]. The main feature of ETEC is the production of two enterotoxins: the heat labile-toxin (LT) and the heat-stable toxin (ST). The ETEC strains are the leading cause of traveler’s diarrhea and also related to children’s diarrhea [11].
The EIEC group and Shigella spp. are biochemically and genetically related. The pathogenicity mechanism is through the invasion of the colon´s epithelium; several involved proteins like Ipa and others are encoded in the 140 MDa plasmid pInv. Generally, watery diarrhea is observed, but in some cases, inflammatory colitis can occur [12]. Finally, EAEC strains are characterized by aggregative adherence (AA) to Hep-2 cells, wherein bacteria are seen in stacked brick aggregates attaching to cells. Adherence is due to aggregative adherence fimbriae encoded by the aggA gene, especially in variant I (AAF/I) [13].
Several studies have reported DEC in carcasses from slaughterhouses; for example in Burkina Faso, the five pathotypes mentioned in this work were isolated from bovine, poultry, and swine carcasses [14]. France UM et al. (2018) [15] reported the presence of STEC and EPEC in bovines. In Mexico there are few reports about these pathotypes in ruminant carcasses [16]; such information is necessary to assert the risk factors that could affect the safety of sheep carcasses in this country. We investigated the prevalence of DEC isolates obtained from sheep slaughtered in an abattoir in Mexico, and determined the presence of virulence factors, the phylogenetic classification of isolates as well as their antimicrobial resistance profile. Therefore, the main objective of this work is to know which diarrheal pathotypes of E. coli are naturally present in sheep slaughtered in a slaughterhouse in the state of Mexico and to identify if they could represent a risk factor for the consuming population.

2. Materials and Methods

2.1. Sample Collection and Bacteriological Isolation

A convenience sampling was performed in a slaughterhouse with the largest number of slaughtered sheep in the central region of Mexico. The sample size was estimated with a prevalence of 12.3% [17] and a 95% confidence level through sample size determination for finite populations [18]. A non-destructive method employing a swab in 0.1% peptone + NaCl (0.85%), according to the European Union, was used [19]. From a total of 321 samples, 159 rectal swabs were taken before evisceration and 162 swab samples were taken from carcasses after final washing and before refrigeration. Finally, swabs were stored in sterile tubes with 25 mL of peptone water (1%).
Samples were transported to Centro de Investigación y Estudios Avanzados en Salud Animal (CIESA, Universidad Autónoma del Estado de México). Samples were streaked onto MacConkey Agar (MAC, Beckton Dickinson, Franklin Lakes, NJ, USA). After 24 h of incubation at 37 °C, suspected pink colonies were grown in Eosin Methylene Blue Agar (EMB, Dickinson, Franklin Lakes, NJ, USA), and colonies with a green metallic sheen were identified by biochemical tests (triple sugar iron, sulfide indole motility, methyl-red Voges-Proskauer, urea, malonate, phenylalanine, gluconate, citrate, and sorbitol) [20].

2.2. Serotyping

The procedure described by Orskov and Orskov (1984) [21] was employed. Specific rabbit sera against 187 E. coli somatic (O) antigens and 53 flagellar (H) antigens were used (SERUNAM, registered trademark in Mexico, with number 323158/2015).

2.3. Phylogenetic Group Determination

A quadruplex PCR was carried out to identify the phylogenetic groups (A, B1, B2, C, D, E, and F), the chuA, yjaA, arpA, and TspE4.C2 genes were amplified with primers and PCR conditions according to Clermont et al. (2013) [22] (Table 1).

2.4. Virulence Factors

The identification and characterization of diarrheagenic E. coli pathotypes (STEC, EPEC, ETEC, EIEC, and EAEC) were performed by PCR. Fragments of several virulence genes were amplified and assigned to each pathotype employing primers and thermal cycling conditions, as described previously [11,23,24,25,26,27] (Table 1). The reaction products were visualized on 2% agarose containing ethidium bromide.
Table 1. Primers used in phylogenetic group determination and virulence factors identification.
Table 1. Primers used in phylogenetic group determination and virulence factors identification.
Gene or ProbeDescription of TargetOligonucleotide Sequence (5′–3′)PCR Product (pb)Reference
vtx1Verocytotoxin
type 1
GTACGGGGATGCAGATAAATCGC209[27]
AGCAGTCATTACATAAGAACGYCCACT
vtx2Verocytotoxin
type 2
GGCACTGTCTGAAACTGCTCCTGT627[27]
ATTAAACTGCACTTCAGCAAATCC
CGCTGTCTGAGGCATCTCCGCT625
TAAACTTCACCTGGGCAAAGCC
eaeIntiminTCAATGCAGTTCCGTTATCAGTT482[25]
GTAAAGTCCGTTACCCCAACCTG
BfpBundle-forming pilusAATGGTGCTTGCGCTTGCTGC300[23]
GCCGCTTTATCCAACCTGGTA
LTHeat-labile toxinsACGGCGTTACTATCCTCTC273[11]
TGGTCTCGGTCAGATATGTG
STpHeat-stable toxinsTCTTTCCCCTCTTTTAGTCAG166[11]
ACAGGCAGGATTACAACAAAG
ipaHInvasion plasmid antigenTGGAAAAACTCAGTGCCTCT423[26]
CCAGTCCGTAAATTCATTCT
aggRTranscriptional activator of AAFsCTAATTGTACAATCGATGTA308[24]
ATGAAGTAATTCTTGAAT
chuAOuter membrane hemin receptor ChuAATGGTACCGGACGAACCAAC288[22]
TGCCGCCAGTACCAAAGACA
yjaAUncharacterized protein YjaACAAACGTGAAGTGTCAGGAG211[22]
AATGCGTTCCTCAACCTGTG
TspE4.C2Putative gene for
a lipase
CACTATTCGTAAGGTCATCC152[22]
AGTTTATCGCTGCGGGTCGC
arpAAnkyrin repeat
protein A
AACGCTATTCGCCAGCTTGC400[22]
TCTCCCCATACCGTACGCTA

2.5. Detection of Shiga Toxin Subtypes

Identification of stx1 and stx2 subtypes genes (stx1a, stx1c, stx1d, stx2a, stx2b, stx2c stx2d, stx2e, stx2f, and stx2g) was carried out with primers and PCR conditions described by Scheutz et al. (2012) [27]. Amplicons were visualized on a 2% agarose gel with ethidium bromide (Table 2).

2.6. Antimicrobial Susceptibility Testing

Susceptibility to antibiotics was tested using a disk diffusion method according to Clinical and Laboratory Standard Institute guidelines [28]. E. coli ATCC 25922 and ATCC 35218 were used as quality control. Commercial discs of ampicillin 10 μg (AMP), cephalothin 30 μg (CEF), ceftazidime 30 μg (CAZ), amikacin 30 μg (AMK), ciprofloxacin 5 μg (CIP), gentamicin 10 μg (GEN), fosfomycin 50 μg (FOF), netilmicin 30 μg (NET), trimethoprim-sulfamethoxazole 25 μg (SXT), norfloxacin 10 μg (NOR), nitrofurantoin 300 μg (NIT), and tetracycline 30 μg (TET) (BBL™Sensi-Disc™Becton Dickinson, Franklin Lakes, NJ, USA) were used.

2.7. Antimicrobial Resistance Genes

To identify antimicrobial resistance genes against β-lactams, tetracyclines, and sulfonamides, the genes blaTEM, tetA, tetB, sul1, and sul2 were analyzed by the PCR technique using the primers and conditions described by Kerrn et al. 2002 [29], Martí et al. 2006 [30] and Dallenne et al. 2010 [31], respectively (Table 3). The PCR products were visualized by electrophoresis on a 2% agarose gel stained with ethidium bromide.

3. Results

3.1. Bacterial Isolation

Overall, 321 samples were collected: 159 from rectal swabs and 162 from carcasses. A total of 90 E. coli isolates were obtained and confirmed by biochemical test and serotyping, 15 of them from carcasses, and 75 from feces, providing a frequency of 28%. Out of 49 E. coli isolates (54%), 8 of them were from carcasses, and 43 from feces, and these expressed at least one virulence factor included in this study. The remaining 41 isolates (46%) did not express any virulence factor.

3.2. Serotyping

Serotyping results showed that STEC pathotype gathered 23 different O serogroups and 33 serotypes O:H. The most frequent serogroups were O76 and O146 (11.6%), followed by serogroups O176 and O91 (6.9%). The EPEC, ETEC, and EIEC pathotypes were distributed in six different serotypes O:H. DEC serotypes with public health relevance were found: O76:H19 (n = 5), O146:H21 (n = 3), O91:H10 (n = 1), O6:NM (n = 1), and O8:NM (n = 1) (Table 4).

3.3. Virulence Genes and Pathotypes

Regarding the presence of STEC, 43/90 (47.7%) isolates had the stx1 w/o stx2 genes, therefore were assigned as STEC non-O157; only one isolate expressing stx1 and eae genes was classified as t-STEC (typical STEC). Additionally, 3/90 harbored only the eae gene and were classified as EPEC, the stp gene was found in 2/90 isolates (2.2%) and were classified as ETEC, 1/90 (1.1%) isolates harbored the ipaH, and was classified as EIEC, and finally, the absence of a aggr gene revealed that no EAEC isolates were present.

3.4. Shiga Toxin Subtypes

The stx1 and stx2 genes and their subtypes were found in the STEC isolates as follows: in rectal swab (39/43, 90.6%) rather than carcass (4/43, 9.4%), and only one isolate from a rectal swab harbored stx1-eae (2.3%). Regarding stx1 genes, stx1c only was found in 60.5% (26/43), followed by stx1a-stx1c 20.9% (9/43) and stx1a-stx1d 2.3% (1/43) (Table 4). The presence of both, stx1 and stx2 genes was found in 7/43 isolates (16.3%) from rectal swabs, and the combination stx1c-stx2g was detected in 3/43 isolates (6.9%), while 4 (9.4%) isolates showed different patterns (stx1a-stx1c-stx2g; stx1c-stx2b-stx2g; stx1c-stx2b and finally stx1a-stx1c-stx2b-stx2g) (Table 4).

3.5. Phylogroups

STEC isolates showed the major diversity of phylogenetic groups, although phylogroup B1 was predominant in 90.6% (39/43), while there was only one isolate (2.3%) in each remaining phylogroup (A, B2, C, and F). All EPEC, ETEC, and EIEC isolates were clustered in phylogroup B1 (Table 4). Phylogroups D and E were not found in the analyzed isolates.

3.6. Antimicrobial Resistance

The antimicrobial susceptibility profile of STEC, EPEC, ETEC, and EIEC was similar; all isolates expressed an antimicrobial resistance of 100% to NIT, followed by AMP (range of 66% to 100% according to pathotype), TET (30% to 100%), and the lowest for SXT (9% to 33%). Antimicrobial resistance was not observed in the other antibiotics. Almost all STEC, EPEC, ETEC, and EIEC showed multi-drug resistance (MDR) to at least three or four antibiotic classes used in this study (Table 5). We observed that 27.9% (12/43) of STEC isolates carried at least one antibiotic resistance: nine isolates expressed the tetB gene, one isolate the tetA gene, two isolates the sul2 gene, one isolate the sul1 and one isolate the sul1-tetB genes (Table 5).

4. Discussion

Different E. coli pathotypes are related to diarrhea in both human and animal populations with some serotypes capable of causing outbreaks [6,32]. In this work, several serotypes associated with diarrhea in humans in Mexico and other countries were found (O8:NM, O76:H19 and O146:H21) [32,33]. Moreover, serotypes O6:NM, O91:H10, and O104:H2 have been related to HUS. It is important to highlight that serotype O146:H21 was found in sheep from farms and slaughterhouses in Brazil [34,35], while the same serotype can be found in Mexico backyard sheep or adult sheep from Norway [36,37]. Similarly, the serogroup O104 is considered of clinical importance in the European Economic Community; interestingly, this serogroup is disseminated in lambs and sheep from India and lambs in Mexico [38,39,40,41].
According to Monaghan et al. (2011) [42], 40% of putative pathogenic E. coli belongs to pathotype STEC (non-O157) and is the major agent of microbial contaminations in meat products in Europe and USA [43,44]. In this work, STEC was the most frequent pathotype (47.7%) in sheep slaughtered in the abattoir; this finding is similar to that reported in Brazil in sheep abattoirs (11.3%), or slaughter-age sheep from Australia (72%), and with other ruminants like goats in Kenya (50%), Iran (16.4%) or bovines in Burkina Faso (37%) and Mexico (40.7%) [14,16,34,45,46,47].
The most frequent stx subtype gene described worldwide in sheep is stx1c [48,49,50]. The results of our investigation corroborate this statement, however, a small number of isolates carried stx1a and stx1d. The stx1c subtype gene is related to diarrhea without complications in humans [9].
Recent research has shown that stx subtypes have a predilection toward different receptors: the Stx B subunit recognizes Gb3 as its principal receptor and to a lesser extent Gb4. Lee and Tesh 2019 [51] highlighted the relevance of this interaction as a key mechanism in the pathogenicity of STEC. Stx1a interacts strongly with Gb3 on the human glomerular endothelium. On the other hand, the subtype stx2e shows predilection for Gb4 and Gb5 present in the glomerular endothelium of ruminants and pigs.
In this work, the stx2g gene was predominant, followed by stx2b. These subtypes are not associated with HUS and HC development in humans, which could represent a low hazard to establish disease. In contrast, the presence of stx2c and stx2d genes that were not reported in this investigation that boost the development of HUS and HC, were reported in sheep carcasses from Turkey and Switzerland. Amezquita et al. (2014) [36] found stx2c and stx2d genes in backyard sheep in Mexico. Prager et al. (2011) [8] demonstrated that isolates harboring stx2g gene obtained from humans, animals and environmental sources had a close phylogenetic relationship, reinforcing the idea of human infections as a potential zoonotic disease.
Identification of stx subtypes is a priority, as it allows for an early prediction of the virulence potential of each STEC isolate. This observation generated enough evidence to know that stx2a and stx2d genes are crucial determinants in the severity of HUS; furthermore, the mere presence of the stx2a gene is considered an independent risk factor to the developed HUS in multivariate analysis. Therefore, the identification of stx subtypes should be performed routinely in diagnostic laboratories [52].
Pathotype EPEC was the second most frequent (3.3%) and is responsible for neonatal diarrhea in human and animal populations [53], however it also affects adult sheep in Australia and Brazil [34,45]. The isolates in this study did not express the bfp gene, so they were categorized as a-EPEC [6].
ETEC was the third most frequent pathotype (2.2%) and is considered one of the main diarrheagenic pathogens in lambs and calves [54]. In Kenya, it was also reported as the third most frequent DEC (10%) in slaughtered goats, while an investigation in Mexico rated it as the second most frequent in bovines, the same as in Burkina Faso (4%) [14,16,46]. Previous reports about ETEC were described in bovines with/without diarrhea in Brazil, Vietnam (with the same number of isolates as this work), and Burkina Faso [55,56,57]. There is a lack of information regarding this pathotype in slaughtered sheep in Mexico.
The last reported pathotype was EIEC with only 1.1%. This low percentage is also observed by other authors in comparison with other pathotypes in other species; for example, Navarro et al. (2018) [16] only discovered 11.5% of EIEC in bovine feces, while Kagambéga et al. (2012) [14] found 1% of this pathotype in slaughtered poultry in Burkina Faso.
In this work EAEC was not detected, however other investigations report this pathotype along with STEC, EPEC, and ETEC in Mexico, Iran, and Burkina Faso in bovines and goats [14,16,47].
The presence of most of the DEC pathotypes of public health concern can be isolated from sheep, goats, and bovines, which raises the relevance of livestock as a reservoir of these pathogens [58]; precarious hygiene conditions make it possible for DEC to contaminate meat products with feces during different processes in slaughterhouses in Mexico.
The high percentage (~90–100%) of isolates belonged to phylogenetic group B1 (commensal E. coli), which is similar to that reported in other countries in isolates from sheep, goats, and bovines [59,60,61,62].
Antimicrobial resistance (AMR) was observed in STEC isolates against AMP (72%), TET (30%), and SXT (9%); these percentages were lower in comparison to a study carried out in Turkey where a higher frequency of AMR to AMP and TET (100% and 50% respectively) was reported [63]. In Egypt, lower levels of AMR to AMP (66.7%) were reported, but higher levels of SXT (73.3%) were discovered in a goat slaughterhouse [64]. In Mexico, a study detected 92% and 75% of AMR to AMP and TET, respectively, in bovines. This contrasts with our study where both antibiotics showed a lower level of AMR. Another study in this country found AMR to cephalosporins in STEC isolates from bovines. Interestingly, we did not find any AMR to these antibiotics. Despite this, both studies showed AMR to TET and AMP [16,65].
In the case of a-EPEC, a lower resistance rate in comparison with this study was found in adult sheep in Spain with a 1.9%, 0, and 1% for GEN, TET, and SXT, respectively [66]. Conversely, a study from Brazil detected higher rates of resistance against CIP (22%), AMK (4%), GEN (9%) and cephalosporins (72%) in a sheep abattoir [67]. In the particular case of ETEC, we found higher resistance levels for AMP (100%) and TET (50%) in our work compared to Njoroge et al. (2013) [46] with goat isolates in Kenya.
Multi-drug resistance (MDR) was found against three or four antibiotic classes in 11 STEC, 1 EPEC, 1 ETEC and 1 EIEC isolates. The presence of MDR E. coli in the gut microbiota of the analyzed sheep could further disseminate to other microorganisms due to horizontal gene transfer [68].
In the present study, it was possible to detect resistance genes such as tetA, tetB, sul1, sul2 within isolates resistant to tetracycline and trimethoprim-sulfamethoxazole. Research studies around the world also reported finding some of these genes. Portugal [69] informed the presence of tetA, tetB and, in a smaller number, sul2, in sheep samples processed in a slaughterhouse. Medina et al. (2011) [66], working with live sheep in Spain, reported the presence of these same genes with tetA the most frequent. Finally, in France, bovine isolates harbored tetA and sul2 genes [15].

5. Conclusions

We identified several serotypes related to gastrointestinal illness in Mexico, along with some stx subtypes genes that were reported worldwide as low virulent (stx1a, stx1c, stx1d, stx2b, and stx2g). Nevertheless, some serotypes are implicated in diarrhea and MDR isolates could pose a threat for treatment in case of intestinal and extra-intestinal illness in people who consume sheep meat. These findings reflect the potential concern of sheep as a primary reservoir of STEC non-O157 and the possible transmission through the food chain.

Author Contributions

Conceptualization, J.A.-D., M.T.-R., E.S.-V. and E.E.-G.; methodology, J.A.-D., A.N., R.M.-E. and E.E.-G.; validation, J.A.-D., A.N., R.M.-E., M.T.-R., V.V.-O. and E.S.-V.; investigation, J.A.-D., A.N., R.M.-E. and M.T.-R.; resources, J.A.-D., A.N., R.M.-E.; data curation, E.S.-V., A.N. and J.A.-D.; writing—original draft preparation, E.E.-G., J.A.-D., E.S.-V., A.N. and V.V.-O.; writing—review and editing, E.E.-G., J.A.-D., E.S.-V., V.V.-O. and L.C.-P.; project administration, J.A.-D. and M.T.-R. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a grant from Universidad Autónoma del Estado de Mexico (Registration No. 3998/2016R ED) and is part of the Doctor studies in Agricultural Sciences and Natural Resources of Enriquez-Gómez who received CONACyT scholarship (No. 394480).

Institutional Review Board Statement

It does not apply since the investigation was carried out with animals previously slaughtered by the municipal authorities of the slaughterhouse.

Data Availability Statement

Not applicable.

Acknowledgments

We appreciate the help and cooperation of the technical processes laboratory to Luis Antonio León Alamilla, Gabriel Pérez Soto, Delia Licona Moreno, José Luis Méndez Sánchez and Gabriela Delgado Sapien, from Faculty of Medicine (UNAM) and Carlos Martín de la Luz Moreno from Center for Research and Advanced Studies in Animal Health, UAEMEX.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bettelheim, K.A. Role of non-0157 VTEC. J. Appl. Microbiol. 2000, 88, 388–508. [Google Scholar] [CrossRef]
  2. Torres, A.G. Minireview Escherichia coli diseases in Latin America. ‘OneHealth’ multidisciplinary approach. Pathog. Dis. 2017, 75, ftx012. [Google Scholar] [CrossRef]
  3. FAO. Food and Agriculture Organization 2005. Code of Hygienic Practice for Meat. CAC/433 RCP 58–200. Codex Alimentarius, FAO, Rome. Available online: http://www.fao.org/tempref/codex/Circular_Letters/CxCL2013/cl13_11e.pdf (accessed on 10 September 2018).
  4. Reyes-Rodríguez, N.E.; Soriano-Vargas, E.; Barba-León, J.; Navarro, A.; Talavera-Rojas, M.; Sanso, A.M.; Bustamante, A.V. Genetic characterization of Escherichia coli 15 isolated from cattle carcasses and feces in Mexico State. JFP 2015, 78, 796–801. [Google Scholar] [CrossRef] [PubMed]
  5. Blanco, M.; Blanco, J.E.; Mora, A.; Rey, J.; Alonso, J.M.; Hermoso, M.; Alonso, M.P.; Dahbi, G.; González, E.A.; Bernárdez, M.I.; et al. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J. Clin. Microbiol. 2003, 41, 1351–1355. [Google Scholar] [CrossRef]
  6. Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef] [PubMed]
  7. Paton, A.W.; Srimanote, P.; Woodrow, M.C.; Paton, J.C. Characterization of Saa, a novelm autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 2001, 69, 6999–7009. [Google Scholar] [CrossRef]
  8. Prager, R.; Frut, A.; Busch, U.; Tietze, E. Comparative analysis of virulence 548 genes, genetic diversity, and phylogeny of Shiga toxin 2g and heat-stable enterotoxin STla encoding Escherichia coli isolates from humans, animals, and environmental sources. Int. J. Med. Microbiol. 2011, 301, 181–191. [Google Scholar] [CrossRef]
  9. Beutin, L.; Miko, A.; Krause, G.; Pries, K.; Haby, S.; Steege, K.; Albrecht, N. Identification of Human-Pathogenic Strains of Shiga Toxin-Producing Escherichia coli from Food by a Combination of Serotyping and Molecular Typing of Shiga Toxin Genes. Appl. Environ. Microbiol. 2007, 73, 4769–4775. [Google Scholar] [CrossRef]
  10. Trabulsi, L.R.; Keller, R.; Tardelli, G.T.A. Typical and atypical enteropathogenic Escherichia coli. EID 2002, 8, 508–513. [Google Scholar] [CrossRef]
  11. Sjöling, A.; Wiklund, G.; Savarino, S.J.; Cohen, D.I.; Svennerholm, A.M. Comparative analyses of phenotypic and genotypic methods for detection of entero-toxigenic Escherichia coli toxins and colonization factors. J. Clin. Microbiol. 2007, 45, 3295–3301. [Google Scholar] [CrossRef]
  12. Halet, T.; Sansonetti, P.; Schad, P.; Austin, S.; Formal, S.B. Characterization of virulence plasmids and plasmid associated outer membrane proteins in Shigella flexneri, Shigella somnei and Escherichia coli. Infect. Immun. 1983, 40, 340–350. [Google Scholar] [CrossRef] [PubMed]
  13. Nataro, J.P.; Deng, Y.; Maneval, D.R.; German, A.L.; Martin, W.C.; Leviene, M.M. Aggregative adherence fimbriae I of enteroaggregative Escherichia coli mediate adherence to Hep-2 cells and hemagglutination of human eritrocytes. Infec. Immun. 1992, 60, 2297–2304. [Google Scholar] [CrossRef] [PubMed]
  14. Kagambéga, A.; Martikainen, O.; Siitonen, A.; Traore, A.S.; Barro, N.; Haukka, K. Prevalence of diarrheagenic Escherichia coli virulence genes in the feces of slaughtered cattle, chickens, and pigs in Burkina Faso. Microbiol. Open 2012, 1, 276–284. [Google Scholar] [CrossRef]
  15. Um, M.M.; Brugére, H.; Kérouré, M.; Oswald, E.; Bibbal, D. Antimicrobial Resistance Profiles of Enterohemorrhagic and Enteropathogenic Escherichia coli of Serotypes O157:H7, O26:H11, O103:H2, O111:H8, O145:H28 Compared to Escherichia coli Isolated from the Same Adult Cattle. Microb. Drug Resist. 2018, 24, 852–859. [Google Scholar] [CrossRef] [PubMed]
  16. Navarro, A.; Cauich-Sánchez, P.I.; Trejo, A.; Gutiérrez, A.; Díaz, S.P.; Díaz, C.M.; Cravioto, A.; Eslava, C. Characterization of Diarrheagenic Strains of Escherichia coli Isolated from Cattle Raised in Three Regions of Mexico. Front. Microbiol. 2018, 9, 2373. [Google Scholar] [CrossRef] [PubMed]
  17. Etcheverría, A.I.; Padola, N.L.; Sanz, M.E.; Polifroni, R.; Krüger, A.; Passucci, J.; Rodríguez, E.M.; Taraborelli, A.L.; Ballerio, M.; Parma, A.E. Occurrence of Shiga toxin-producing E. coli (STEC) on carcasses and retail beef cuts in the marketing chain of beef in Argentina. Meat Sci. 2010, 86, 418–421. [Google Scholar] [CrossRef]
  18. Daniel, W.W. Bioestadística. Base Para el Análisis de las Ciencias de la Salud, 4th ed.; Limusa, S.A. de C.V.: México DF, México, 2006; p. 928. [Google Scholar]
  19. Official Journal of the European Community L165/48. Laying Down Rules for the Regular Checks on the General Hygiene Carried out by the Operators in Establishments According to Directive 64/433/EEC on Health Conditions for the Production and Marketing of Fresh Meat and Directive 71/118/EEC on Health Problems Affecting the Production and Placing on the Market of Fresh Poultry Meat. European Directive 2001/471/EC. Available online: https://eurlex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2001:165:0048:0053:EN:PDF (accessed on 11 October 2017).
  20. USDA. United States Department of Agriculture Food Safety and Inspection Service MLG 5C.01 Detection, Isolation and Identification of Escherichia coli O157:H7 from Meat Products and Carcass and Environmental Sponges. 2015. Available online: https://www.fsis.usda.gov/sites/default/files/media_file/2021-04/MLG-5C.01.pdf (accessed on 7 May 2019).
  21. Orskov, F.; Orskov, I. Serotyping of Escherichia coli. In Methods in Microbiology; Bergan, T., Ed.; Academic Press Ltd.: London, UK, 1984; Volume 14, pp. 43–112. [Google Scholar] [CrossRef]
  22. Clermont, O.; Christenson, J.K.; Denamu, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef]
  23. Gunzburg, S.T.; Tornieporth, N.G.; Riley, L.W. Identification of Enteropathogenic Escherichia coli by PCR-Based. Detection of the Bundle-Forming Pilus Gene. J. Clin. Microbiol. 1995, 33, 1375–1377. [Google Scholar] [CrossRef]
  24. Czeczulin, J.R.; Whittam, T.S.; Henderson, I.R.; Navarro-Garcia, F.; Nataro, J.P. Phylogenetic analysis of enteroagregative and diffusely adherent Escherichia coli. Infect. Immun. 1999, 67, 2692–2699. [Google Scholar] [CrossRef]
  25. Kong, R.Y.; Lee, S.K.; Law, T.W.; Law, S.H.; Wu, R.S. Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR. Water Res. 2002, 36, 2802–2812. [Google Scholar] [CrossRef]
  26. Li, Y.; Cao, B.; Liu, B.; Liu, D.; Gao, Q.; Peng, X.; Wu, J.; Bastin, D.A.; Feng, L.; Wang, L. Molecular detection of all 34 distinct-antigen forms of Shigella. J. Med. Microbiol. 2009, 58, 69–81. [Google Scholar] [CrossRef] [PubMed]
  27. Scheutz, F.; Teel, L.D.; Beutin, L.; Pierard, D.; Buvens, G.; Karch, H.; Mellmann, A.; Caprioli, A.; Tozzoli, R.; Morabito, S.; et al. Multicenter evaluation of a sequence-based protocol for subtyping shiga toxins and standardizing stx nomenclature. J. Clin. Microbiol. 2012, 50, 2951–2963. [Google Scholar] [CrossRef] [PubMed]
  28. Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing. 27th ed CLSI Supplement M100 (ISBN 1-56238-1-56238-805-3). 2017. Available online: https://clsi.org/media/1469/m100s27_sample.pdf (accessed on 10 September 2017).
  29. Kerrn, M.B.; Klemmensen, T.; Frimodt-Møller, N.; Espersen, F. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteremia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 2002, 50, 513–516. [Google Scholar] [CrossRef]
  30. Martí, S.; Fernández-Cuenca, F.; Pascual, Á.; Ribera, A.; Rodríguez-Baño, J.; Bou, G.; Cisneros, J.M.; Pachón, J.; Martínez-Martínez, L.; Vila, J. Prevalencia de los genes tetA y tetB como mecanismo de resistencia a tetraciclina y minociclina en aislamientos clínicos de Acinetobacterbaumannii. Enferm. Infecc. Microbiol. Clin. 2006, 24, 77–80. [Google Scholar] [CrossRef]
  31. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important b-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed]
  32. Eslava, C.; Mateo, J.; Cravioto, A. Cepas de Escherichia coli relacionadas con la diarrea. In Diagnóstico de Laboratorio de Infecciones Gastrointestinales; Giono, S., Escobar, A., Valdespino, J.L., Eds.; Secretaria de Salud: Mexico City, México, 1994; p. 251. [Google Scholar]
  33. Sheutz, F.; Strockbine, N.A. Bergey’s Manual of Systematics of Archaea and Bacteria, Online © 2015 Bergey’s Manual Trust. In Association with Bergey’s Manual Trust; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2015. [Google Scholar] [CrossRef]
  34. Maluta, R.P.; Fairbrother, J.M.; Stella, A.E.; Rigobelo, E.C.; Martinez, R.F.; de Ávila, A. Potentially pathogenic Escherichia coli in healthy, pasture-raised sheep on farms and at the abattoir in Brazil. Vet. Microbiol. 2014, 169, 89–95. [Google Scholar] [CrossRef] [PubMed]
  35. Vettorato, M.P.; De Castro, A.F.P.; Cergole-Novella, M.C.; Camargo, F.L.L.; Irino, K.; Guth, B.E.C. Shiga toxin-producing Escherichia coli and atypical enteropathogenic Escherichia coli strains isolated from healthy sheep of different populations in Sao Paulo, Brazil. Lett. Appl. Microbiol. 2009, 49, 53–59. [Google Scholar] [CrossRef]
  36. Amézquita-López, B.A.; Quiñones, B.; Lee, B.G.; Chaidez, C. Virulence profiling of Shiga toxin producing Escherichia coli recovered from domestic farm animals in Northwestern Mexico. Front. Cell Infect. Microbiol. 2014, 31, 4–7. [Google Scholar] [CrossRef]
  37. Urdahl, A.M.; Beutin, L.; Skjerve, E.; Zimmermann, S.; Wasteson, Y. Animal host associated differences in Shiga toxin-producing Escherichia coli isolated from sheep and cattle on the same farm. J. Appl. Microbiol. 2003, 95, 92–101. [Google Scholar] [CrossRef]
  38. Wani, S.A.; Bhat, M.A.; Samanta, I.; Nishikawa, Y.; Buchh, A.S. Isolation and characterization of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic Escherichia coli (EPEC) from calves and lambs with diarrhea in India. Lett. Appl. Microbiol. 2003, 37, 121–126. [Google Scholar] [CrossRef]
  39. Bhat, M.A.; Nishikawa, Y.; Wani, S.A. Prevalence and virulence gene profiles of Shiga toxin-producing Escherichia coli and enteropathogenic Escherichia coli from diarrheic and healthy lambs in India. Small Rumin. Res. 2008, 75, 65–70. [Google Scholar] [CrossRef]
  40. Kumar, A.; Taneja, N.; Sharma, M. An epidemiological and environmental study of Shiga toxin producing Escherichia coli in India. Foodborne Pathog. Dis. 2014, 11, 439–446. [Google Scholar] [CrossRef] [PubMed]
  41. Enriquez-Gómez, E.; Talavera-Rojas, M.; Soriano-Vargas, E.; Navarro-Ocaña, A.; Vega-Sanchez, V.; Aguilar-Montes de Oca, S.; Acosta-Dibarrat, J. Serotypes and antimicrobial resistance patterns in Shiga-toxin producing Escherichia coli isolates from healthy lambs in México. Small Rumin. Res. 2007, 153, 41–47. [Google Scholar] [CrossRef]
  42. Monaghan, Á.; Byrne, B.; Fanning, S.; Sweeney, T.; McDowell, D.; Bolton, D.J. Serotypes and virulence profiles of non-O157 Shiga toxin-producing Escherichia coli isolates from bovine farms. Appl. Environ. Microbiol. 2011, 77, 8662–8668. [Google Scholar] [CrossRef] [PubMed]
  43. EFSA CEF Panel. Scientific opinion on VTEC-seropathotype and scientific criteria regarding pathogenicity assessment. EFSA J. 2013, 11, 3138. [Google Scholar] [CrossRef]
  44. USDA-FSIS. Risk Profile for Pathogenic Non-O157 Shiga Toxin-Producing 617 Escherichia Coli (Non-O157 STEC. 2012. Available online: https://www.fsis.usda.gov/shared/PDF/Non_O157_STEC_Risk_Profile_May2012.pdf (accessed on 6 August 2018).
  45. Djordjevic, S.P.; Hornitzky, M.A.; Bailey, G.; Gill, P.; Vanselow, B.; Walker, K.; Bettelheim, K.A. Virulence properties and serotypes of Shiga toxin-producing Escherichia coli from healthy Australian slaughter age sheep. J. Clin. Microbiol. 2001, 39, 2017–2021. [Google Scholar] [CrossRef]
  46. Njoroge, S.; Muigai, A.W.T.; Njiruh, P.N.; Kariuki, S. Molecular 525 Characterization and antimicrobial resistance patterns of Escherichia coli isolates from goats slaughtered in parts of Kenya. East Afr. Med. J. 2013, 90, 72–83. Available online: https://www.ajol.info/index.php/eamj/article/viewFile/103233/93447 (accessed on 15 March 2016).
  47. Jajarmi, M.; Ghanbarpour, R.; Sharifi, R.H.; Golchin, M. Distribution Pattern of EcoR Phylogenetic Groups Among Shiga Toxin-Producing and Enteropathogenic Escherichia coli Isolated from Healthy Goats. Int. J. Enteric Pathog. 2015, 3, e27971. [Google Scholar] [CrossRef]
  48. Brett, K.; Ramachandran, V.; Hornitzky, M.; Bettelheim, K.A.; Walker, M.J.; Djordjevic, S.P. stx1c Is the Most Common Shiga Toxin 1 Subtype among Shiga Toxin-Producing Escherichia coli Isolates from Sheep but Not among Isolates from Cattle. J. Clin. Microbiol. 2003, 41, 926–936. [Google Scholar] [CrossRef]
  49. Kumar, A.; Taneja, N.; Kumar, Y.; Sharma, M. Detection of Shiga toxin variants among Shiga toxin–forming Escherichia coli isolates from animal stool, meat and human stool samples in India. J. Appl. Microbiol. 2012, 113, 1208–1216. [Google Scholar] [CrossRef]
  50. Erol, I.; Goncuoglu, M.; Ayaz, N.D.; Orm, F.S.B. Comparison of prevalence and genetic diversity of Escherichia coli o157:h7 in cattle and sheep. J. Microbiol. Biotechnol. Food Sci. 2016, 6, 808–812. [Google Scholar] [CrossRef]
  51. Lee, M.S.; Tesh, V.L. Review Roles of Shiga Toxins in Immunopathology. Toxins 2019, 11, 212. [Google Scholar] [CrossRef] [PubMed]
  52. Werber, D.; Scheutz, F. The importance of integrating genetic strain information for managing cases of Shiga toxin-producing E. coli infection. Epidemiol. Infect. 2019, 147, e264. [Google Scholar] [CrossRef] [PubMed]
  53. Karmali, M.A.; Mascarenhas, M.; Shen, S.; Ziebell, K.; Johnson, S.; Reid-Smith, R.; Isaac-Renton, J.; Clark, C.; Rahn, K.; Kaper, J.B. Association of genomic O island 122 of Escherichia coli EDL933 with verocytotoxin- producing Escherichia coli seropathotypes that are linked to epidemic and / or serious disease. J. Clin. Microbiol. 2013, 41, 4930–4940. [Google Scholar] [CrossRef]
  54. Troeger, C.; Forouzanfar, M.; Rao, P.C.; Khalil, I.; Brown, A.; Reiner, R.C., Jr.; Fullman, N.; Thompson, R.L.; Abajobir, A.; Ahmed, M. Estimates of global, regional, and national morbidity, mortality, and etiologies of diarrheal diseases: A systematic analysis for the global burden of disease study 2015. Lancet Infect. Dis. 2017, 17, 909–948. [Google Scholar] [CrossRef]
  55. De Moura, C.; Ludovico, M.; Valadares, G.F.; Gatti, M.S.V.; d Leite, D.S. Detection of virulence genes in Escherichia coli strains isolated from diarrheic and healthy feces of dairy calves in Brazil. Arq. Inst. Biol. 2012, 79, 273–276. [Google Scholar] [CrossRef]
  56. Nguyen, T.D.; Vo, T.T.; Vu-Khac, H. Virulence factors in Escherichia coli isolated from calves with diarrhea in Vietnam. J. Vet. Sci. 2011, 12, 159–164. [Google Scholar] [CrossRef] [PubMed]
  57. Bako, E.; Kagambéga, A.; Traore, K.A.; Serge, B.T.; Ibrahim, H.B.; Bouda, S.C.; Bonkoungou, I.J.O.; Kaboré, S.; Zongo, C.; Traore, S.A.; et al. Characterization of Diarrheagenic Escherichia coli Isolated in Organic Waste Products (Cattle Fecal Matter, Manure and, Slurry) from Cattle’s Markets in Ouagadougou, Burkina Faso. IJERPH 2017, 14, 1100. [Google Scholar] [CrossRef]
  58. Mora, A.; Herrera, A.; López, C.; Dahb, G.; Mamani, R.; Pita, J.M.; Alonso, M.P.; Llovo, J.; Bernárdez, M.I.; Blanco, J.E.; et al. Characteristics of the Shiga-toxin-producing enteroaggregative Escherichia coli O104, H4 German outbreak strain and of STEC strains isolated in Spain. Int. Microbiol. 2011, 14, 121–141. [Google Scholar] [CrossRef]
  59. Ghanbarpour, R.; Kiani, M. Characterization of non-O157 shiga toxin-producing Escherichia coli isolates from healthy fat-tailed sheep in southeastern of Iran. Trop. Anim. Health Prod. 2013, 45, 641–648. [Google Scholar] [CrossRef]
  60. Wang, L.; Wakushima, M.; Aota, T.; Yoshida, Y.; Kita, T.; Maehara, T.; Ogasawara, J.; Choi, C.; Kamata, Y.; Hara-Kudo, Y.; et al. Specific Properties of Enteropathogenic Escherichia coli Isolates from Diarrheal Patients and Comparison to Strains from Foods and Fecal Specimens from Cattle, Swine, and Healthy Carriers in Osaka City, Japan. Appl. Environ. Microbiol. 2013, 79, 1232–1240. [Google Scholar] [CrossRef] [PubMed]
  61. Alizade, H.; Ghanbarpour, R.; Nekoubin, M. Phylogenetic of Shiga Toxin-Producing Escherichia coli and a typical Enteropathogenic Escherichia coli Strains Isolated from Human and Cattle in Kerman. Int. J. Enteric Pathog. 2014, 2, e15195. [Google Scholar] [CrossRef]
  62. Carlos, C.; Pires, M.M.; Stoppe, N.C.; Hachich, E.M.; Sato, M.I.Z.; Gomes, T.; Amaral, L.A.; Ottobon, L.M.M. Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC Microbiol. 2010, 10, 161. [Google Scholar] [CrossRef] [PubMed]
  63. Seker, E.; Kus, F.S. The prevalence, virulence factors and antibiotic resistance of Escherichia coli O157 in feces of adult ruminants slaughtered in three provinces of Turkey. Vet. Arh. 2019, 89, 107–121. [Google Scholar] [CrossRef]
  64. Elsayed, M.S.A.E.; Awad, A.; Trabees, R.; Marzouk, A. Virulence repertoire and antimicrobial resistance profile of shiga toxin-producing E. coli isolated from sheep and goat farms from Al-Buhayra Egypt. Pak. Vet. J. 2018, 38, 180–186. [Google Scholar] [CrossRef]
  65. Martínez-Vázquez, A.V.; Rivera-Sánchez, G.; Lira-Méndez, K.; Reyes-López, M.Á.; Bocanegra-García, V. Prevalence, antimicrobial resistance and virulence genes of Escherichia coli isolated from retail meat in Tamaulipas, Mexico. JGAR 2018, 14, 266–272. [Google Scholar] [CrossRef]
  66. Medina, A.; Horcajo, P.; Jurado, S.; De La Fuente, R.; Ruiz-Santa-Quiteria, J.A.; Domínguez-Bernal, O.J. Phenotypic and genotypic characterization of antimicrobial resistance in enterohemorrhagic Escherichia coli and atypical enteropathogenic E. coli strains from ruminants. J. Vet. Diagn. Investig. 2011, 23, 91–95. [Google Scholar] [CrossRef]
  67. Rigobelo, E.C.; Takahashi, L.S.; Nicodemo, D.; de Ávila, F.A.; Maluta, R.P.; dos Santos Ruiz, U.; Stella, A.E. Virulence of Escherichia coli strains isolated from ovine carcasses. Rev. Acadêmica Ciência Anim. 2008, 6, 475–482. [Google Scholar] [CrossRef][Green Version]
  68. Penders, J.; Stobberingh, E.E.; Savelkoul, P.H.; Wolffs, P. The human microbiome as a reservoir of antimicrobial resistance. Front. Microbiol. 2013, 4, 87. [Google Scholar] [CrossRef]
  69. Ramos, S.; Silva, N.; Canic, M.; Capelo-Martinez, J.; Brito, F.; Igrejas, G.; Poeta, P. High prevalence of antimicrobial-resistant Escherichia coli from animals at slaughter: A food safety risk. J. Sci. Food Agric. 2012, 93, 517–526. [Google Scholar] [CrossRef]
Table 2. Primers used in the identification of variants of Shiga toxin.
Table 2. Primers used in the identification of variants of Shiga toxin.
Gene or ProbeOligonucleotide Sequence (5′–3′)PCR Product (pb)Reference
vtx1avtx1a-F1CCTTTCCAGGTACAACAGCGGTT478[27]
vtx1a-R2GGAAACTCATCAGATGCCATTCTGG
vtx1cvtx1c-F1CCTTTCCTGGTACAACTGCGGTT252[27]
vtx1c-R1CAAGTGTTGTACGAAATCCCCTCTGA
vtx1dvtx1d-F1CAGTTAATGCGATTGCTAAGGAGTTTACC203[27]
vtx1d-R1CTCTTCCTCTGGTTCTAACCCCATGATA
vtx2avtx2a-F2GCGATACTGRGBACTGTGGCC349[27]
vtx2a-R3CCGKCAACCTTCACTGTAAATGTG
vtx2bvtx2a-R2GGCCACCTTCACTGTGAATGTG347[27]
vtx2b-F1AAATATGAAGAAGATATTTGTAGCGGC
vtx2b-R1CAGCAAATCCTGAACCTGACG251
vtx2cvtx2c-F1GAAAGTCACAGTTTTTATATACAACGGGTA177[27]
vtx2c-R2CCGGCCACYTTTACTGTGAATGTA
vtx2dvtx2d-F1AAARTCACAGTCTTTATATACAACGGGTG179[27]
vtx2d-R1TTYCCGGCCACTTTTACTGTG
vtx2d-R2GCCTGATGCACAGGTACTGGAC280
vtx2evtx2e-F1CGGAGTATCGGGGAGAGGC411[27]
vtx2e-R2CTTCCTGACACCTTCACAGTAAAGGT
vtx2fvtx2f-F1TGGGCGTCATTCACTGGTTG424[27]
vtx2f-R1TAATGGCCGCCCTGTCTCC
Table 3. Primers used in the identification of resistance genes.
Table 3. Primers used in the identification of resistance genes.
Gene or ProbeDescription of TargetOligonucleotide Sequence (5′–3′)PCR Product (pb)Reference
sul1sul1 FCGG CGT GGG CTA CCT GAA CG 433 pb[29]
sul1 RGCC GAT CGC GTG AAG TTC CG 3
sul2sul2 FGCG CTC AAG GCA GAT GGC ATT 293 pb[29]
sul2 RGCG TTT GAT ACC GGC ACC CGT
tetAtet A FGTA ATT CTG AGC ACT GTC GC950 pb[30]
tet A RCTG CCT GGA CAACAT TGC TT
tet Btet B FGTT AGG GGC AAG TTT TG 650 pb[30]
tet B RGTA ATG GGC CAA TAA CAC CG
BlaTEMMultiTSO-T BlaTEM FCAT TTC CGT GTC GCC CTT ATT C 800 pb[31]
MultiTSO-T BlaTEM RCGT TCA TCC ATA GTT GCC TGA C
Table 4. Association between serotype, phylogenetic group and virulence genes of diarrheagenic E. coli (DEC) isolated from sheep slaughtered in an abattoir.
Table 4. Association between serotype, phylogenetic group and virulence genes of diarrheagenic E. coli (DEC) isolated from sheep slaughtered in an abattoir.
Isolate SerotypeSourceVirulence FactorPG
stx1
Variants
stx2
Variants
eaestpIpah
E44O53:H51rectal 1c A
* Z15‒:H10rectal + B1
C28B‒:H14rectal 1c B1
* D3‒:H34carcass + B1
Z2‒:H34rectal 1c + B1
Z29‒:H16rectal 1a1c B1
V25O100:H21rectal 1c B1
V22O100:H28rectal 1c2g B1
D28O104:H2carcass1c B1
# D15O105 AB:H16carcass + B1
# D15BO120:H16carcass + B1
V13O146:H10rectal 1c B1
C23O146:H21rectal 1c2b–2g B1
Z3O146:H21rectal 1c B1
Z19O146:H21rectal 1c B1
B7O146:H8rectal 1a–1c2g B1
B13CO150:NMcarcass1c B1
Z5O174:H16rectal 1c B1
Z25O174:H16rectal 1a–1c B1
V15O176:NMrectal 1c B1
C24O185:NMrectal 1c2b B1
* D53O28 AC:H21carcass + B1
° E3O28 AC:H21rectal +B1
E15BO32:H27rectal 1c B1
E20O32:H7rectal 1c B1
E30O32:H7rectal 1c B1
D26O34:H14carcass1c B1
Z9O34:O145:H45rectal1c B1
Z16O37:H10rectal1a–1c B1
B1O6:H16rectal 1c B1
Z20O70:H10rectal 1a–1c B1
Z17O76:H19rectal1a–1c B1
Z21O76:H19rectal 1c B1
Z26O76:H19rectal 1c B1
Z32O76:H19rectal 1a–1c B1
Z34O76:H19rectal 1a–1c2b–2g B1
E16O8:NMrectal 1c B1
E18O8:H2rectal 1c–1d B1
C28O84:H14rectal 1c B1
C27O91:H10rectal 1c B1
Z12O91:H28rectal 1a–1c B1
Z13O91:H42rectal 1a–1c B1
Z14O91:H47rectal 1a–1c B1
Z18O91:H47rectal 1c B1
C3O96:H20carcass1c B1
V5O176:H21rectal 1c2g B1
B3O176:NMrectal 1c B2
B15O6:NMrectal 1c C
V11O153:NMrectal 1c2g F
Isolates: unmarked STEC; * EPEC; # ETEC; ° EIEC. PG: Phylogenetic group; rectal: rectal swab; carcass: carcass swab; NM: no mobile; +: gene presence.
Table 5. Antimicrobial resistance profile of diarrheagenic E. coli (DEC) isolated from sheep slaughtered in an abattoir.
Table 5. Antimicrobial resistance profile of diarrheagenic E. coli (DEC) isolated from sheep slaughtered in an abattoir.
Isolate SerotypeSourceSTECEPECETECEIECAntimicrobial Resistance ProfileResistance Gene
tetAtetBsul1sul2
Z3O146:H21rectal + NIT, AMP, TET, SXT +
V15O176:NMrectal + NIT, AMP, TET, SXT
C28O84:H14rectal + NIT, AMP, TET, SXT
V22O100:H28rectal + NIT, AMP, TET
B7O146:H8rectal + NIT, AMP, TET +
V11O153:NMrectal + NIT, AMP, TET
D26O34:H14carcass+ NIT, AMP, TET +
E44O53:H51rectal + NIT, AMP, TET
Z26O76:H19rectal + NIT, AMP, TET
E16O8:NMrectal + NIT, AMP, TET
V25O100:H21rectal + NIT, AMP
D28O104:H2carcass+ NIT, AMP +
C23O146:H21rectal + NIT, AMP
Z5O174:H16rectal + NIT, AMP
Z25O174:H16rectal + NIT, AMP +
B3O176:NMrectal + NIT, AMP
C24O185:NMrectal + NIT, AMP ++
E15BO32:H27rectal + NIT, AMP
E20O32:H7rectal + NIT, AMP
E30O32:H7rectal + NIT, AMP
Z9O34:O145:H45rectal+ NIT, AMP
Z16O37:H10rectal + NIT, AMP
B1O6:H16rectal + NIT, AMP
B15O6:NMrectal + NIT, AMP
Z17O76:H19rectal + NIT, AMP
Z32O76:H19rectal + NIT, AMP +
Z34O76:H19rectal + NIT, AMP
E18O8:H2rectal + NIT, AMP +
C27O91:H10rectal + NIT, AMP+
Z12O91:H28rectal + NIT, AMP
Z13O91:H42rectal + NIT, AMP
Z14O91:H47rectal + NIT, AMP
Z18O91:H47rectal + NIT, AMP
C3O96:H20carcass+ NIT, AMP
V13O146:H10rectal + NIT, TET
V5O176:H21rectal+ NIT, TET +
C28B‒:H14rectal + NIT
Z29‒:H16rectal+ NIT
Z19O146:H21rectal + NIT
B13CO150:NMcarcass+ NIT
Z20O70:H10rectal + NIT
Z21O76:H19rectal + NIT +
Z2‒:H34rectal + NIT, AMP, TET, SXT +
D3‒:H34carcass + NIT, AMP, TET, SXT
Z15‒:H10rectal + NIT, AMP
D53O28 AC:H21carcass + NIT, AMP
D15O105 AB:H16carcass + NIT, AMP, TET
D15BO120:H16carcass + NIT, AMP
E3O28 AC:H21rectal +NIT, AMP, TET
NM: no mobile; NIT: nitrofurantoin; AMP: ampicillin; TET: tetracycline; SXT: trimethoprim-sulfamethoxazole; rectal: rectal swab; carcass: carcass swab.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Enriquez-Gómez, E.; Acosta-Dibarrat, J.; Talavera-Rojas, M.; Soriano-Vargas, E.; Navarro, A.; Morales-Espinosa, R.; Velázquez-Ordoñez, V.; Cal-Pereyra, L. Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico. Agriculture 2023, 13, 1604. https://doi.org/10.3390/agriculture13081604

AMA Style

Enriquez-Gómez E, Acosta-Dibarrat J, Talavera-Rojas M, Soriano-Vargas E, Navarro A, Morales-Espinosa R, Velázquez-Ordoñez V, Cal-Pereyra L. Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico. Agriculture. 2023; 13(8):1604. https://doi.org/10.3390/agriculture13081604

Chicago/Turabian Style

Enriquez-Gómez, Edgar, Jorge Acosta-Dibarrat, Martín Talavera-Rojas, Edgardo Soriano-Vargas, Armando Navarro, Rosario Morales-Espinosa, Valente Velázquez-Ordoñez, and Luis Cal-Pereyra. 2023. "Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico" Agriculture 13, no. 8: 1604. https://doi.org/10.3390/agriculture13081604

APA Style

Enriquez-Gómez, E., Acosta-Dibarrat, J., Talavera-Rojas, M., Soriano-Vargas, E., Navarro, A., Morales-Espinosa, R., Velázquez-Ordoñez, V., & Cal-Pereyra, L. (2023). Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico. Agriculture, 13(8), 1604. https://doi.org/10.3390/agriculture13081604

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop