Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Bacteriological Isolation
2.2. Serotyping
2.3. Phylogenetic Group Determination
2.4. Virulence Factors
| Gene or Probe | Description of Target | Oligonucleotide Sequence (5′–3′) | PCR Product (pb) | Reference |
|---|---|---|---|---|
| vtx1 | Verocytotoxin type 1 | GTACGGGGATGCAGATAAATCGC | 209 | [27] |
| AGCAGTCATTACATAAGAACGYCCACT | ||||
| vtx2 | Verocytotoxin type 2 | GGCACTGTCTGAAACTGCTCCTGT | 627 | [27] |
| ATTAAACTGCACTTCAGCAAATCC | ||||
| CGCTGTCTGAGGCATCTCCGCT | 625 | |||
| TAAACTTCACCTGGGCAAAGCC | ||||
| eae | Intimin | TCAATGCAGTTCCGTTATCAGTT | 482 | [25] |
| GTAAAGTCCGTTACCCCAACCTG | ||||
| Bfp | Bundle-forming pilus | AATGGTGCTTGCGCTTGCTGC | 300 | [23] |
| GCCGCTTTATCCAACCTGGTA | ||||
| LT | Heat-labile toxins | ACGGCGTTACTATCCTCTC | 273 | [11] |
| TGGTCTCGGTCAGATATGTG | ||||
| STp | Heat-stable toxins | TCTTTCCCCTCTTTTAGTCAG | 166 | [11] |
| ACAGGCAGGATTACAACAAAG | ||||
| ipaH | Invasion plasmid antigen | TGGAAAAACTCAGTGCCTCT | 423 | [26] |
| CCAGTCCGTAAATTCATTCT | ||||
| aggR | Transcriptional activator of AAFs | CTAATTGTACAATCGATGTA | 308 | [24] |
| ATGAAGTAATTCTTGAAT | ||||
| chuA | Outer membrane hemin receptor ChuA | ATGGTACCGGACGAACCAAC | 288 | [22] |
| TGCCGCCAGTACCAAAGACA | ||||
| yjaA | Uncharacterized protein YjaA | CAAACGTGAAGTGTCAGGAG | 211 | [22] |
| AATGCGTTCCTCAACCTGTG | ||||
| TspE4.C2 | Putative gene for a lipase | CACTATTCGTAAGGTCATCC | 152 | [22] |
| AGTTTATCGCTGCGGGTCGC | ||||
| arpA | Ankyrin repeat protein A | AACGCTATTCGCCAGCTTGC | 400 | [22] |
| TCTCCCCATACCGTACGCTA |
2.5. Detection of Shiga Toxin Subtypes
2.6. Antimicrobial Susceptibility Testing
2.7. Antimicrobial Resistance Genes
3. Results
3.1. Bacterial Isolation
3.2. Serotyping
3.3. Virulence Genes and Pathotypes
3.4. Shiga Toxin Subtypes
3.5. Phylogroups
3.6. Antimicrobial Resistance
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bettelheim, K.A. Role of non-0157 VTEC. J. Appl. Microbiol. 2000, 88, 388–508. [Google Scholar] [CrossRef]
- Torres, A.G. Minireview Escherichia coli diseases in Latin America. ‘OneHealth’ multidisciplinary approach. Pathog. Dis. 2017, 75, ftx012. [Google Scholar] [CrossRef]
- FAO. Food and Agriculture Organization 2005. Code of Hygienic Practice for Meat. CAC/433 RCP 58–200. Codex Alimentarius, FAO, Rome. Available online: http://www.fao.org/tempref/codex/Circular_Letters/CxCL2013/cl13_11e.pdf (accessed on 10 September 2018).
- Reyes-Rodríguez, N.E.; Soriano-Vargas, E.; Barba-León, J.; Navarro, A.; Talavera-Rojas, M.; Sanso, A.M.; Bustamante, A.V. Genetic characterization of Escherichia coli 15 isolated from cattle carcasses and feces in Mexico State. JFP 2015, 78, 796–801. [Google Scholar] [CrossRef] [PubMed]
- Blanco, M.; Blanco, J.E.; Mora, A.; Rey, J.; Alonso, J.M.; Hermoso, M.; Alonso, M.P.; Dahbi, G.; González, E.A.; Bernárdez, M.I.; et al. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J. Clin. Microbiol. 2003, 41, 1351–1355. [Google Scholar] [CrossRef]
- Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef] [PubMed]
- Paton, A.W.; Srimanote, P.; Woodrow, M.C.; Paton, J.C. Characterization of Saa, a novelm autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 2001, 69, 6999–7009. [Google Scholar] [CrossRef]
- Prager, R.; Frut, A.; Busch, U.; Tietze, E. Comparative analysis of virulence 548 genes, genetic diversity, and phylogeny of Shiga toxin 2g and heat-stable enterotoxin STla encoding Escherichia coli isolates from humans, animals, and environmental sources. Int. J. Med. Microbiol. 2011, 301, 181–191. [Google Scholar] [CrossRef]
- Beutin, L.; Miko, A.; Krause, G.; Pries, K.; Haby, S.; Steege, K.; Albrecht, N. Identification of Human-Pathogenic Strains of Shiga Toxin-Producing Escherichia coli from Food by a Combination of Serotyping and Molecular Typing of Shiga Toxin Genes. Appl. Environ. Microbiol. 2007, 73, 4769–4775. [Google Scholar] [CrossRef]
- Trabulsi, L.R.; Keller, R.; Tardelli, G.T.A. Typical and atypical enteropathogenic Escherichia coli. EID 2002, 8, 508–513. [Google Scholar] [CrossRef]
- Sjöling, A.; Wiklund, G.; Savarino, S.J.; Cohen, D.I.; Svennerholm, A.M. Comparative analyses of phenotypic and genotypic methods for detection of entero-toxigenic Escherichia coli toxins and colonization factors. J. Clin. Microbiol. 2007, 45, 3295–3301. [Google Scholar] [CrossRef]
- Halet, T.; Sansonetti, P.; Schad, P.; Austin, S.; Formal, S.B. Characterization of virulence plasmids and plasmid associated outer membrane proteins in Shigella flexneri, Shigella somnei and Escherichia coli. Infect. Immun. 1983, 40, 340–350. [Google Scholar] [CrossRef] [PubMed]
- Nataro, J.P.; Deng, Y.; Maneval, D.R.; German, A.L.; Martin, W.C.; Leviene, M.M. Aggregative adherence fimbriae I of enteroaggregative Escherichia coli mediate adherence to Hep-2 cells and hemagglutination of human eritrocytes. Infec. Immun. 1992, 60, 2297–2304. [Google Scholar] [CrossRef] [PubMed]
- Kagambéga, A.; Martikainen, O.; Siitonen, A.; Traore, A.S.; Barro, N.; Haukka, K. Prevalence of diarrheagenic Escherichia coli virulence genes in the feces of slaughtered cattle, chickens, and pigs in Burkina Faso. Microbiol. Open 2012, 1, 276–284. [Google Scholar] [CrossRef]
- Um, M.M.; Brugére, H.; Kérouré, M.; Oswald, E.; Bibbal, D. Antimicrobial Resistance Profiles of Enterohemorrhagic and Enteropathogenic Escherichia coli of Serotypes O157:H7, O26:H11, O103:H2, O111:H8, O145:H28 Compared to Escherichia coli Isolated from the Same Adult Cattle. Microb. Drug Resist. 2018, 24, 852–859. [Google Scholar] [CrossRef] [PubMed]
- Navarro, A.; Cauich-Sánchez, P.I.; Trejo, A.; Gutiérrez, A.; Díaz, S.P.; Díaz, C.M.; Cravioto, A.; Eslava, C. Characterization of Diarrheagenic Strains of Escherichia coli Isolated from Cattle Raised in Three Regions of Mexico. Front. Microbiol. 2018, 9, 2373. [Google Scholar] [CrossRef] [PubMed]
- Etcheverría, A.I.; Padola, N.L.; Sanz, M.E.; Polifroni, R.; Krüger, A.; Passucci, J.; Rodríguez, E.M.; Taraborelli, A.L.; Ballerio, M.; Parma, A.E. Occurrence of Shiga toxin-producing E. coli (STEC) on carcasses and retail beef cuts in the marketing chain of beef in Argentina. Meat Sci. 2010, 86, 418–421. [Google Scholar] [CrossRef]
- Daniel, W.W. Bioestadística. Base Para el Análisis de las Ciencias de la Salud, 4th ed.; Limusa, S.A. de C.V.: México DF, México, 2006; p. 928. [Google Scholar]
- Official Journal of the European Community L165/48. Laying Down Rules for the Regular Checks on the General Hygiene Carried out by the Operators in Establishments According to Directive 64/433/EEC on Health Conditions for the Production and Marketing of Fresh Meat and Directive 71/118/EEC on Health Problems Affecting the Production and Placing on the Market of Fresh Poultry Meat. European Directive 2001/471/EC. Available online: https://eurlex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2001:165:0048:0053:EN:PDF (accessed on 11 October 2017).
- USDA. United States Department of Agriculture Food Safety and Inspection Service MLG 5C.01 Detection, Isolation and Identification of Escherichia coli O157:H7 from Meat Products and Carcass and Environmental Sponges. 2015. Available online: https://www.fsis.usda.gov/sites/default/files/media_file/2021-04/MLG-5C.01.pdf (accessed on 7 May 2019).
- Orskov, F.; Orskov, I. Serotyping of Escherichia coli. In Methods in Microbiology; Bergan, T., Ed.; Academic Press Ltd.: London, UK, 1984; Volume 14, pp. 43–112. [Google Scholar] [CrossRef]
- Clermont, O.; Christenson, J.K.; Denamu, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef]
- Gunzburg, S.T.; Tornieporth, N.G.; Riley, L.W. Identification of Enteropathogenic Escherichia coli by PCR-Based. Detection of the Bundle-Forming Pilus Gene. J. Clin. Microbiol. 1995, 33, 1375–1377. [Google Scholar] [CrossRef]
- Czeczulin, J.R.; Whittam, T.S.; Henderson, I.R.; Navarro-Garcia, F.; Nataro, J.P. Phylogenetic analysis of enteroagregative and diffusely adherent Escherichia coli. Infect. Immun. 1999, 67, 2692–2699. [Google Scholar] [CrossRef]
- Kong, R.Y.; Lee, S.K.; Law, T.W.; Law, S.H.; Wu, R.S. Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR. Water Res. 2002, 36, 2802–2812. [Google Scholar] [CrossRef]
- Li, Y.; Cao, B.; Liu, B.; Liu, D.; Gao, Q.; Peng, X.; Wu, J.; Bastin, D.A.; Feng, L.; Wang, L. Molecular detection of all 34 distinct-antigen forms of Shigella. J. Med. Microbiol. 2009, 58, 69–81. [Google Scholar] [CrossRef] [PubMed]
- Scheutz, F.; Teel, L.D.; Beutin, L.; Pierard, D.; Buvens, G.; Karch, H.; Mellmann, A.; Caprioli, A.; Tozzoli, R.; Morabito, S.; et al. Multicenter evaluation of a sequence-based protocol for subtyping shiga toxins and standardizing stx nomenclature. J. Clin. Microbiol. 2012, 50, 2951–2963. [Google Scholar] [CrossRef] [PubMed]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing. 27th ed CLSI Supplement M100 (ISBN 1-56238-1-56238-805-3). 2017. Available online: https://clsi.org/media/1469/m100s27_sample.pdf (accessed on 10 September 2017).
- Kerrn, M.B.; Klemmensen, T.; Frimodt-Møller, N.; Espersen, F. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteremia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 2002, 50, 513–516. [Google Scholar] [CrossRef]
- Martí, S.; Fernández-Cuenca, F.; Pascual, Á.; Ribera, A.; Rodríguez-Baño, J.; Bou, G.; Cisneros, J.M.; Pachón, J.; Martínez-Martínez, L.; Vila, J. Prevalencia de los genes tetA y tetB como mecanismo de resistencia a tetraciclina y minociclina en aislamientos clínicos de Acinetobacterbaumannii. Enferm. Infecc. Microbiol. Clin. 2006, 24, 77–80. [Google Scholar] [CrossRef]
- Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important b-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed]
- Eslava, C.; Mateo, J.; Cravioto, A. Cepas de Escherichia coli relacionadas con la diarrea. In Diagnóstico de Laboratorio de Infecciones Gastrointestinales; Giono, S., Escobar, A., Valdespino, J.L., Eds.; Secretaria de Salud: Mexico City, México, 1994; p. 251. [Google Scholar]
- Sheutz, F.; Strockbine, N.A. Bergey’s Manual of Systematics of Archaea and Bacteria, Online © 2015 Bergey’s Manual Trust. In Association with Bergey’s Manual Trust; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2015. [Google Scholar] [CrossRef]
- Maluta, R.P.; Fairbrother, J.M.; Stella, A.E.; Rigobelo, E.C.; Martinez, R.F.; de Ávila, A. Potentially pathogenic Escherichia coli in healthy, pasture-raised sheep on farms and at the abattoir in Brazil. Vet. Microbiol. 2014, 169, 89–95. [Google Scholar] [CrossRef] [PubMed]
- Vettorato, M.P.; De Castro, A.F.P.; Cergole-Novella, M.C.; Camargo, F.L.L.; Irino, K.; Guth, B.E.C. Shiga toxin-producing Escherichia coli and atypical enteropathogenic Escherichia coli strains isolated from healthy sheep of different populations in Sao Paulo, Brazil. Lett. Appl. Microbiol. 2009, 49, 53–59. [Google Scholar] [CrossRef]
- Amézquita-López, B.A.; Quiñones, B.; Lee, B.G.; Chaidez, C. Virulence profiling of Shiga toxin producing Escherichia coli recovered from domestic farm animals in Northwestern Mexico. Front. Cell Infect. Microbiol. 2014, 31, 4–7. [Google Scholar] [CrossRef]
- Urdahl, A.M.; Beutin, L.; Skjerve, E.; Zimmermann, S.; Wasteson, Y. Animal host associated differences in Shiga toxin-producing Escherichia coli isolated from sheep and cattle on the same farm. J. Appl. Microbiol. 2003, 95, 92–101. [Google Scholar] [CrossRef]
- Wani, S.A.; Bhat, M.A.; Samanta, I.; Nishikawa, Y.; Buchh, A.S. Isolation and characterization of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic Escherichia coli (EPEC) from calves and lambs with diarrhea in India. Lett. Appl. Microbiol. 2003, 37, 121–126. [Google Scholar] [CrossRef]
- Bhat, M.A.; Nishikawa, Y.; Wani, S.A. Prevalence and virulence gene profiles of Shiga toxin-producing Escherichia coli and enteropathogenic Escherichia coli from diarrheic and healthy lambs in India. Small Rumin. Res. 2008, 75, 65–70. [Google Scholar] [CrossRef]
- Kumar, A.; Taneja, N.; Sharma, M. An epidemiological and environmental study of Shiga toxin producing Escherichia coli in India. Foodborne Pathog. Dis. 2014, 11, 439–446. [Google Scholar] [CrossRef] [PubMed]
- Enriquez-Gómez, E.; Talavera-Rojas, M.; Soriano-Vargas, E.; Navarro-Ocaña, A.; Vega-Sanchez, V.; Aguilar-Montes de Oca, S.; Acosta-Dibarrat, J. Serotypes and antimicrobial resistance patterns in Shiga-toxin producing Escherichia coli isolates from healthy lambs in México. Small Rumin. Res. 2007, 153, 41–47. [Google Scholar] [CrossRef]
- Monaghan, Á.; Byrne, B.; Fanning, S.; Sweeney, T.; McDowell, D.; Bolton, D.J. Serotypes and virulence profiles of non-O157 Shiga toxin-producing Escherichia coli isolates from bovine farms. Appl. Environ. Microbiol. 2011, 77, 8662–8668. [Google Scholar] [CrossRef] [PubMed]
- EFSA CEF Panel. Scientific opinion on VTEC-seropathotype and scientific criteria regarding pathogenicity assessment. EFSA J. 2013, 11, 3138. [Google Scholar] [CrossRef]
- USDA-FSIS. Risk Profile for Pathogenic Non-O157 Shiga Toxin-Producing 617 Escherichia Coli (Non-O157 STEC. 2012. Available online: https://www.fsis.usda.gov/shared/PDF/Non_O157_STEC_Risk_Profile_May2012.pdf (accessed on 6 August 2018).
- Djordjevic, S.P.; Hornitzky, M.A.; Bailey, G.; Gill, P.; Vanselow, B.; Walker, K.; Bettelheim, K.A. Virulence properties and serotypes of Shiga toxin-producing Escherichia coli from healthy Australian slaughter age sheep. J. Clin. Microbiol. 2001, 39, 2017–2021. [Google Scholar] [CrossRef]
- Njoroge, S.; Muigai, A.W.T.; Njiruh, P.N.; Kariuki, S. Molecular 525 Characterization and antimicrobial resistance patterns of Escherichia coli isolates from goats slaughtered in parts of Kenya. East Afr. Med. J. 2013, 90, 72–83. Available online: https://www.ajol.info/index.php/eamj/article/viewFile/103233/93447 (accessed on 15 March 2016).
- Jajarmi, M.; Ghanbarpour, R.; Sharifi, R.H.; Golchin, M. Distribution Pattern of EcoR Phylogenetic Groups Among Shiga Toxin-Producing and Enteropathogenic Escherichia coli Isolated from Healthy Goats. Int. J. Enteric Pathog. 2015, 3, e27971. [Google Scholar] [CrossRef]
- Brett, K.; Ramachandran, V.; Hornitzky, M.; Bettelheim, K.A.; Walker, M.J.; Djordjevic, S.P. stx1c Is the Most Common Shiga Toxin 1 Subtype among Shiga Toxin-Producing Escherichia coli Isolates from Sheep but Not among Isolates from Cattle. J. Clin. Microbiol. 2003, 41, 926–936. [Google Scholar] [CrossRef]
- Kumar, A.; Taneja, N.; Kumar, Y.; Sharma, M. Detection of Shiga toxin variants among Shiga toxin–forming Escherichia coli isolates from animal stool, meat and human stool samples in India. J. Appl. Microbiol. 2012, 113, 1208–1216. [Google Scholar] [CrossRef]
- Erol, I.; Goncuoglu, M.; Ayaz, N.D.; Orm, F.S.B. Comparison of prevalence and genetic diversity of Escherichia coli o157:h7 in cattle and sheep. J. Microbiol. Biotechnol. Food Sci. 2016, 6, 808–812. [Google Scholar] [CrossRef]
- Lee, M.S.; Tesh, V.L. Review Roles of Shiga Toxins in Immunopathology. Toxins 2019, 11, 212. [Google Scholar] [CrossRef] [PubMed]
- Werber, D.; Scheutz, F. The importance of integrating genetic strain information for managing cases of Shiga toxin-producing E. coli infection. Epidemiol. Infect. 2019, 147, e264. [Google Scholar] [CrossRef] [PubMed]
- Karmali, M.A.; Mascarenhas, M.; Shen, S.; Ziebell, K.; Johnson, S.; Reid-Smith, R.; Isaac-Renton, J.; Clark, C.; Rahn, K.; Kaper, J.B. Association of genomic O island 122 of Escherichia coli EDL933 with verocytotoxin- producing Escherichia coli seropathotypes that are linked to epidemic and / or serious disease. J. Clin. Microbiol. 2013, 41, 4930–4940. [Google Scholar] [CrossRef]
- Troeger, C.; Forouzanfar, M.; Rao, P.C.; Khalil, I.; Brown, A.; Reiner, R.C., Jr.; Fullman, N.; Thompson, R.L.; Abajobir, A.; Ahmed, M. Estimates of global, regional, and national morbidity, mortality, and etiologies of diarrheal diseases: A systematic analysis for the global burden of disease study 2015. Lancet Infect. Dis. 2017, 17, 909–948. [Google Scholar] [CrossRef]
- De Moura, C.; Ludovico, M.; Valadares, G.F.; Gatti, M.S.V.; d Leite, D.S. Detection of virulence genes in Escherichia coli strains isolated from diarrheic and healthy feces of dairy calves in Brazil. Arq. Inst. Biol. 2012, 79, 273–276. [Google Scholar] [CrossRef]
- Nguyen, T.D.; Vo, T.T.; Vu-Khac, H. Virulence factors in Escherichia coli isolated from calves with diarrhea in Vietnam. J. Vet. Sci. 2011, 12, 159–164. [Google Scholar] [CrossRef] [PubMed]
- Bako, E.; Kagambéga, A.; Traore, K.A.; Serge, B.T.; Ibrahim, H.B.; Bouda, S.C.; Bonkoungou, I.J.O.; Kaboré, S.; Zongo, C.; Traore, S.A.; et al. Characterization of Diarrheagenic Escherichia coli Isolated in Organic Waste Products (Cattle Fecal Matter, Manure and, Slurry) from Cattle’s Markets in Ouagadougou, Burkina Faso. IJERPH 2017, 14, 1100. [Google Scholar] [CrossRef]
- Mora, A.; Herrera, A.; López, C.; Dahb, G.; Mamani, R.; Pita, J.M.; Alonso, M.P.; Llovo, J.; Bernárdez, M.I.; Blanco, J.E.; et al. Characteristics of the Shiga-toxin-producing enteroaggregative Escherichia coli O104, H4 German outbreak strain and of STEC strains isolated in Spain. Int. Microbiol. 2011, 14, 121–141. [Google Scholar] [CrossRef]
- Ghanbarpour, R.; Kiani, M. Characterization of non-O157 shiga toxin-producing Escherichia coli isolates from healthy fat-tailed sheep in southeastern of Iran. Trop. Anim. Health Prod. 2013, 45, 641–648. [Google Scholar] [CrossRef]
- Wang, L.; Wakushima, M.; Aota, T.; Yoshida, Y.; Kita, T.; Maehara, T.; Ogasawara, J.; Choi, C.; Kamata, Y.; Hara-Kudo, Y.; et al. Specific Properties of Enteropathogenic Escherichia coli Isolates from Diarrheal Patients and Comparison to Strains from Foods and Fecal Specimens from Cattle, Swine, and Healthy Carriers in Osaka City, Japan. Appl. Environ. Microbiol. 2013, 79, 1232–1240. [Google Scholar] [CrossRef] [PubMed]
- Alizade, H.; Ghanbarpour, R.; Nekoubin, M. Phylogenetic of Shiga Toxin-Producing Escherichia coli and a typical Enteropathogenic Escherichia coli Strains Isolated from Human and Cattle in Kerman. Int. J. Enteric Pathog. 2014, 2, e15195. [Google Scholar] [CrossRef]
- Carlos, C.; Pires, M.M.; Stoppe, N.C.; Hachich, E.M.; Sato, M.I.Z.; Gomes, T.; Amaral, L.A.; Ottobon, L.M.M. Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC Microbiol. 2010, 10, 161. [Google Scholar] [CrossRef] [PubMed]
- Seker, E.; Kus, F.S. The prevalence, virulence factors and antibiotic resistance of Escherichia coli O157 in feces of adult ruminants slaughtered in three provinces of Turkey. Vet. Arh. 2019, 89, 107–121. [Google Scholar] [CrossRef]
- Elsayed, M.S.A.E.; Awad, A.; Trabees, R.; Marzouk, A. Virulence repertoire and antimicrobial resistance profile of shiga toxin-producing E. coli isolated from sheep and goat farms from Al-Buhayra Egypt. Pak. Vet. J. 2018, 38, 180–186. [Google Scholar] [CrossRef]
- Martínez-Vázquez, A.V.; Rivera-Sánchez, G.; Lira-Méndez, K.; Reyes-López, M.Á.; Bocanegra-García, V. Prevalence, antimicrobial resistance and virulence genes of Escherichia coli isolated from retail meat in Tamaulipas, Mexico. JGAR 2018, 14, 266–272. [Google Scholar] [CrossRef]
- Medina, A.; Horcajo, P.; Jurado, S.; De La Fuente, R.; Ruiz-Santa-Quiteria, J.A.; Domínguez-Bernal, O.J. Phenotypic and genotypic characterization of antimicrobial resistance in enterohemorrhagic Escherichia coli and atypical enteropathogenic E. coli strains from ruminants. J. Vet. Diagn. Investig. 2011, 23, 91–95. [Google Scholar] [CrossRef]
- Rigobelo, E.C.; Takahashi, L.S.; Nicodemo, D.; de Ávila, F.A.; Maluta, R.P.; dos Santos Ruiz, U.; Stella, A.E. Virulence of Escherichia coli strains isolated from ovine carcasses. Rev. Acadêmica Ciência Anim. 2008, 6, 475–482. [Google Scholar] [CrossRef][Green Version]
- Penders, J.; Stobberingh, E.E.; Savelkoul, P.H.; Wolffs, P. The human microbiome as a reservoir of antimicrobial resistance. Front. Microbiol. 2013, 4, 87. [Google Scholar] [CrossRef]
- Ramos, S.; Silva, N.; Canic, M.; Capelo-Martinez, J.; Brito, F.; Igrejas, G.; Poeta, P. High prevalence of antimicrobial-resistant Escherichia coli from animals at slaughter: A food safety risk. J. Sci. Food Agric. 2012, 93, 517–526. [Google Scholar] [CrossRef]
| Gene or Probe | Oligonucleotide Sequence (5′–3′) | PCR Product (pb) | Reference | |
|---|---|---|---|---|
| vtx1a | vtx1a-F1 | CCTTTCCAGGTACAACAGCGGTT | 478 | [27] |
| vtx1a-R2 | GGAAACTCATCAGATGCCATTCTGG | |||
| vtx1c | vtx1c-F1 | CCTTTCCTGGTACAACTGCGGTT | 252 | [27] |
| vtx1c-R1 | CAAGTGTTGTACGAAATCCCCTCTGA | |||
| vtx1d | vtx1d-F1 | CAGTTAATGCGATTGCTAAGGAGTTTACC | 203 | [27] |
| vtx1d-R1 | CTCTTCCTCTGGTTCTAACCCCATGATA | |||
| vtx2a | vtx2a-F2 | GCGATACTGRGBACTGTGGCC | 349 | [27] |
| vtx2a-R3 | CCGKCAACCTTCACTGTAAATGTG | |||
| vtx2b | vtx2a-R2 | GGCCACCTTCACTGTGAATGTG | 347 | [27] |
| vtx2b-F1 | AAATATGAAGAAGATATTTGTAGCGGC | |||
| vtx2b-R1 | CAGCAAATCCTGAACCTGACG | 251 | ||
| vtx2c | vtx2c-F1 | GAAAGTCACAGTTTTTATATACAACGGGTA | 177 | [27] |
| vtx2c-R2 | CCGGCCACYTTTACTGTGAATGTA | |||
| vtx2d | vtx2d-F1 | AAARTCACAGTCTTTATATACAACGGGTG | 179 | [27] |
| vtx2d-R1 | TTYCCGGCCACTTTTACTGTG | |||
| vtx2d-R2 | GCCTGATGCACAGGTACTGGAC | 280 | ||
| vtx2e | vtx2e-F1 | CGGAGTATCGGGGAGAGGC | 411 | [27] |
| vtx2e-R2 | CTTCCTGACACCTTCACAGTAAAGGT | |||
| vtx2f | vtx2f-F1 | TGGGCGTCATTCACTGGTTG | 424 | [27] |
| vtx2f-R1 | TAATGGCCGCCCTGTCTCC | |||
| Gene or Probe | Description of Target | Oligonucleotide Sequence (5′–3′) | PCR Product (pb) | Reference |
|---|---|---|---|---|
| sul1 | sul1 F | CGG CGT GGG CTA CCT GAA CG | 433 pb | [29] |
| sul1 R | GCC GAT CGC GTG AAG TTC CG 3 | |||
| sul2 | sul2 F | GCG CTC AAG GCA GAT GGC ATT | 293 pb | [29] |
| sul2 R | GCG TTT GAT ACC GGC ACC CGT | |||
| tetA | tet A F | GTA ATT CTG AGC ACT GTC GC | 950 pb | [30] |
| tet A R | CTG CCT GGA CAACAT TGC TT | |||
| tet B | tet B F | GTT AGG GGC AAG TTT TG | 650 pb | [30] |
| tet B R | GTA ATG GGC CAA TAA CAC CG | |||
| BlaTEM | MultiTSO-T BlaTEM F | CAT TTC CGT GTC GCC CTT ATT C | 800 pb | [31] |
| MultiTSO-T BlaTEM R | CGT TCA TCC ATA GTT GCC TGA C |
| Isolate | Serotype | Source | Virulence Factor | PG | ||||
|---|---|---|---|---|---|---|---|---|
| stx1 Variants | stx2 Variants | eae | stp | Ipah | ||||
| E44 | O53:H51 | rectal | 1c | A | ||||
| * Z15 | ‒:H10 | rectal | + | B1 | ||||
| C28B | ‒:H14 | rectal | 1c | B1 | ||||
| * D3 | ‒:H34 | carcass | + | B1 | ||||
| Z2 | ‒:H34 | rectal | 1c | + | B1 | |||
| Z29 | ‒:H16 | rectal | 1a1c | B1 | ||||
| V25 | O100:H21 | rectal | 1c | B1 | ||||
| V22 | O100:H28 | rectal | 1c | 2g | B1 | |||
| D28 | O104:H2 | carcass | 1c | B1 | ||||
| # D15 | O105 AB:H16 | carcass | + | B1 | ||||
| # D15B | O120:H16 | carcass | + | B1 | ||||
| V13 | O146:H10 | rectal | 1c | B1 | ||||
| C23 | O146:H21 | rectal | 1c | 2b–2g | B1 | |||
| Z3 | O146:H21 | rectal | 1c | B1 | ||||
| Z19 | O146:H21 | rectal | 1c | B1 | ||||
| B7 | O146:H8 | rectal | 1a–1c | 2g | B1 | |||
| B13C | O150:NM | carcass | 1c | B1 | ||||
| Z5 | O174:H16 | rectal | 1c | B1 | ||||
| Z25 | O174:H16 | rectal | 1a–1c | B1 | ||||
| V15 | O176:NM | rectal | 1c | B1 | ||||
| C24 | O185:NM | rectal | 1c | 2b | B1 | |||
| * D53 | O28 AC:H21 | carcass | + | B1 | ||||
| ° E3 | O28 AC:H21 | rectal | + | B1 | ||||
| E15B | O32:H27 | rectal | 1c | B1 | ||||
| E20 | O32:H7 | rectal | 1c | B1 | ||||
| E30 | O32:H7 | rectal | 1c | B1 | ||||
| D26 | O34:H14 | carcass | 1c | B1 | ||||
| Z9 | O34:O145:H45 | rectal | 1c | B1 | ||||
| Z16 | O37:H10 | rectal | 1a–1c | B1 | ||||
| B1 | O6:H16 | rectal | 1c | B1 | ||||
| Z20 | O70:H10 | rectal | 1a–1c | B1 | ||||
| Z17 | O76:H19 | rectal | 1a–1c | B1 | ||||
| Z21 | O76:H19 | rectal | 1c | B1 | ||||
| Z26 | O76:H19 | rectal | 1c | B1 | ||||
| Z32 | O76:H19 | rectal | 1a–1c | B1 | ||||
| Z34 | O76:H19 | rectal | 1a–1c | 2b–2g | B1 | |||
| E16 | O8:NM | rectal | 1c | B1 | ||||
| E18 | O8:H2 | rectal | 1c–1d | B1 | ||||
| C28 | O84:H14 | rectal | 1c | B1 | ||||
| C27 | O91:H10 | rectal | 1c | B1 | ||||
| Z12 | O91:H28 | rectal | 1a–1c | B1 | ||||
| Z13 | O91:H42 | rectal | 1a–1c | B1 | ||||
| Z14 | O91:H47 | rectal | 1a–1c | B1 | ||||
| Z18 | O91:H47 | rectal | 1c | B1 | ||||
| C3 | O96:H20 | carcass | 1c | B1 | ||||
| V5 | O176:H21 | rectal | 1c | 2g | B1 | |||
| B3 | O176:NM | rectal | 1c | B2 | ||||
| B15 | O6:NM | rectal | 1c | C | ||||
| V11 | O153:NM | rectal | 1c | 2g | F | |||
| Isolate | Serotype | Source | STEC | EPEC | ETEC | EIEC | Antimicrobial Resistance Profile | Resistance Gene | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| tetA | tetB | sul1 | sul2 | ||||||||
| Z3 | O146:H21 | rectal | + | NIT, AMP, TET, SXT | + | ||||||
| V15 | O176:NM | rectal | + | NIT, AMP, TET, SXT | |||||||
| C28 | O84:H14 | rectal | + | NIT, AMP, TET, SXT | |||||||
| V22 | O100:H28 | rectal | + | NIT, AMP, TET | |||||||
| B7 | O146:H8 | rectal | + | NIT, AMP, TET | + | ||||||
| V11 | O153:NM | rectal | + | NIT, AMP, TET | |||||||
| D26 | O34:H14 | carcass | + | NIT, AMP, TET | + | ||||||
| E44 | O53:H51 | rectal | + | NIT, AMP, TET | |||||||
| Z26 | O76:H19 | rectal | + | NIT, AMP, TET | |||||||
| E16 | O8:NM | rectal | + | NIT, AMP, TET | |||||||
| V25 | O100:H21 | rectal | + | NIT, AMP | |||||||
| D28 | O104:H2 | carcass | + | NIT, AMP | + | ||||||
| C23 | O146:H21 | rectal | + | NIT, AMP | |||||||
| Z5 | O174:H16 | rectal | + | NIT, AMP | |||||||
| Z25 | O174:H16 | rectal | + | NIT, AMP | + | ||||||
| B3 | O176:NM | rectal | + | NIT, AMP | |||||||
| C24 | O185:NM | rectal | + | NIT, AMP | + | + | |||||
| E15B | O32:H27 | rectal | + | NIT, AMP | |||||||
| E20 | O32:H7 | rectal | + | NIT, AMP | |||||||
| E30 | O32:H7 | rectal | + | NIT, AMP | |||||||
| Z9 | O34:O145:H45 | rectal | + | NIT, AMP | |||||||
| Z16 | O37:H10 | rectal | + | NIT, AMP | |||||||
| B1 | O6:H16 | rectal | + | NIT, AMP | |||||||
| B15 | O6:NM | rectal | + | NIT, AMP | |||||||
| Z17 | O76:H19 | rectal | + | NIT, AMP | |||||||
| Z32 | O76:H19 | rectal | + | NIT, AMP | + | ||||||
| Z34 | O76:H19 | rectal | + | NIT, AMP | |||||||
| E18 | O8:H2 | rectal | + | NIT, AMP | + | ||||||
| C27 | O91:H10 | rectal | + | NIT, AMP | + | ||||||
| Z12 | O91:H28 | rectal | + | NIT, AMP | |||||||
| Z13 | O91:H42 | rectal | + | NIT, AMP | |||||||
| Z14 | O91:H47 | rectal | + | NIT, AMP | |||||||
| Z18 | O91:H47 | rectal | + | NIT, AMP | |||||||
| C3 | O96:H20 | carcass | + | NIT, AMP | |||||||
| V13 | O146:H10 | rectal | + | NIT, TET | |||||||
| V5 | O176:H21 | rectal | + | NIT, TET | + | ||||||
| C28B | ‒:H14 | rectal | + | NIT | |||||||
| Z29 | ‒:H16 | rectal | + | NIT | |||||||
| Z19 | O146:H21 | rectal | + | NIT | |||||||
| B13C | O150:NM | carcass | + | NIT | |||||||
| Z20 | O70:H10 | rectal | + | NIT | |||||||
| Z21 | O76:H19 | rectal | + | NIT | + | ||||||
| Z2 | ‒:H34 | rectal | + | NIT, AMP, TET, SXT | + | ||||||
| D3 | ‒:H34 | carcass | + | NIT, AMP, TET, SXT | |||||||
| Z15 | ‒:H10 | rectal | + | NIT, AMP | |||||||
| D53 | O28 AC:H21 | carcass | + | NIT, AMP | |||||||
| D15 | O105 AB:H16 | carcass | + | NIT, AMP, TET | |||||||
| D15B | O120:H16 | carcass | + | NIT, AMP | |||||||
| E3 | O28 AC:H21 | rectal | + | NIT, AMP, TET | |||||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Enriquez-Gómez, E.; Acosta-Dibarrat, J.; Talavera-Rojas, M.; Soriano-Vargas, E.; Navarro, A.; Morales-Espinosa, R.; Velázquez-Ordoñez, V.; Cal-Pereyra, L. Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico. Agriculture 2023, 13, 1604. https://doi.org/10.3390/agriculture13081604
Enriquez-Gómez E, Acosta-Dibarrat J, Talavera-Rojas M, Soriano-Vargas E, Navarro A, Morales-Espinosa R, Velázquez-Ordoñez V, Cal-Pereyra L. Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico. Agriculture. 2023; 13(8):1604. https://doi.org/10.3390/agriculture13081604
Chicago/Turabian StyleEnriquez-Gómez, Edgar, Jorge Acosta-Dibarrat, Martín Talavera-Rojas, Edgardo Soriano-Vargas, Armando Navarro, Rosario Morales-Espinosa, Valente Velázquez-Ordoñez, and Luis Cal-Pereyra. 2023. "Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico" Agriculture 13, no. 8: 1604. https://doi.org/10.3390/agriculture13081604
APA StyleEnriquez-Gómez, E., Acosta-Dibarrat, J., Talavera-Rojas, M., Soriano-Vargas, E., Navarro, A., Morales-Espinosa, R., Velázquez-Ordoñez, V., & Cal-Pereyra, L. (2023). Serotypes, Pathotypes, Shiga Toxin Variants and Antimicrobial Resistance in Diarrheagenic Escherichia coli Isolated from Rectal Swabs and Sheep Carcasses in an Abattoir in Mexico. Agriculture, 13(8), 1604. https://doi.org/10.3390/agriculture13081604

