Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Housing Systems
2.2. Management and Diet
2.3. Carcass Characteristics
2.4. Meat Quality Characteristics
2.5. Muscle Fiber Characteristics
2.6. Enzyme Activity
2.7. Gene Expression
2.8. Statistical Analysis
3. Results
3.1. Body Weight and Carcass Characteristics
3.2. Meat Quality
3.3. Muscle Fiber Characteristics
3.4. IMP and IMF Related Enzyme Activity and Genes Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Singh, M.; Lim, A.J.; Muir, W.I.; Groves, P.J. Comparison of performance and carcass composition of a novel slow-growing crossbred broiler with fast-growing broiler for chicken meat in Australia. Poult. Sci. 2021, 100, 100966. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.Y.; Tang, S.; Chen, Y.; Li, D.L.; Bi, Y.L.; Hua, D.K.; Chen, C.; Luo, Q.Y.; Yang, L.; Chen, J.L. Effects of light regimen and nutrient density on growth performance, carcass traits, meat quality, and health of slow-growing broiler chickens. Livest. Sci. 2017, 198, 201–208. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Ren, W.; Siegel, P.B.; Li, J.; Yin, H.; Liu, Y.; Wang, Y.; Zhang, Y.; Honaker, C.F.; Zhu, Q. Housing systems interacting with sex and genetic line affect broiler growth and carcass traits. Poult. Sci. 2015, 94, 1711–1717. [Google Scholar] [CrossRef] [Scilit]
- Mace, J.L.; Knight, A. The impacts of colony cages on the welfare of chickens farmed for meat. Animals 2022, 12, 2988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, I.; Franks, B.; Hayek, M.N. The ‘sustainability gap’ of US broiler chicken production: Trade-offs between welfare, land use and consumption. R. Soc. Open Sci. 2022, 9, 210478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tolon, B.; Yalcin, S. Bone characteristics and body weight of broilers in different husbandry systems. Br. Poult. Sci. 1997, 38, 132–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sogunle, O.M.; Egbeyale, L.T.; Bajomo, T.T.; Bamigboje, O.V.; Fanimo, A.O. Comparison of the performance, carcass characteristics and haematological parameters of broiler chicks reared in cage and floor. Pak. J. Biol Sci. 2008, 11, 480–483. [Google Scholar] [CrossRef] [Scilit]
- Sekeroglu, A.; Demir, E.; Sarica, M.; Ulutas, Z. Effects of housing systems on growth performance, blood plasma constituents and meat fatty acids in broiler chickens. Pak. J. Biol Sci. 2009, 12, 631–636. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Li, P.; Chen, N.; Liu, Y.; Liu, D.; Guo, Y. Effects of housing systems and glucose oxidase on growth performance and intestinal health of Beijing You Chickens. Poult. Sci. 2021, 100, 100943. [Google Scholar] [CrossRef] [Scilit]
- Simsek, U.G.; Erisir, M.; Ciftci, M.; Seven, P.T. Effects of cage and floor housing systems on fattening performance, oxidative stress and carcass defects in broiler chicken. Kafkas Univ. Vet. Fak. 2014, 20, 727–733. [Google Scholar] [CrossRef] [Scilit]
- Joo, S.T.; Kim, G.D.; Hwang, Y.H.; Ryu, Y.C. Control of fresh meat quality through manipulation of muscle fiber characteristics. Meat. Sci. 2013, 95, 828–836. [Google Scholar] [CrossRef] [Scilit]
- Ismail, I.; Joo, S.T. Poultry meat quality in relation to muscle growth and muscle fiber characteristics. Korean J. Food Sci. Anim. Resour. 2017, 37, 873–883. [Google Scholar] [PubMed]
- Zhang, X.D.; Li, Q.H.; Lou, L.F.; Liu, J.; Chen, X.H.; Zhang, C.X.; Wang, H.H. High-resolution melting curve analysis of the ADSL and LPL genes and their correlation with meat quality and blood parameters in chickens. Genet. Mol. Res. 2015, 14, 2031–2340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.J.; Song, Z.G.; Jiao, H.C.; Lin, H. Dexamethasone facilitates lipid accumulation in chicken skeletal muscle. Stress 2012, 15, 443–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.; Xue, J.; Zheng, J.; Tian, H.; Fang, Y.; Wang, W.; Wang, G.; Hou, D.; Lin, J. Bioinformatic analysis of the gene expression profile in muscle atrophy after spinal cord injury. Sci. Rep. 2021, 11, 21903. [Google Scholar] [CrossRef] [Scilit]
- Ministry of Agriculture. Feeding Standard of Chicken (NY/T33-2004); China Agriculture Press: Beijing, China, 2004; pp. 11–12. [Google Scholar]
- Cunniff, P. Official Methods of Analysis of AOAC International, 17th ed.; Association of the Official Analytical Chemists (AOAC) International: Gaithersburg, MD, USA, 2003. [Google Scholar]
- Chen, J.L.; Zhao, G.P.; Zheng, M.Q.; Wen, J.; Yang, N. Estimation of genetic parameters for contents of intramuscular fat and inosine-5’-monophosphate and carcass traits in Chinese Beijing-You chickens. Poult. Sci. 2008, 87, 1098–1104. [Google Scholar] [CrossRef] [Scilit]
- Müsse, J.; Louton, H.; Spindler, B.; Stracke, J. Sexual dimorphism in bone quality and performance of conventional broilers at different growth phases. Agriculture 2022, 12, 1109. [Google Scholar] [CrossRef] [Scilit]
- Holly, R.G.; Barnett, J.G.; Ashmore, C.R.; Taylor, R.G.; Mole, P.A. Stretch-induced growth in chicken wing muscles: A new model of stretch hypertrophy. Am. J. Physiol. 1980, 238, C62–C71. [Google Scholar] [CrossRef] [Scilit]
- Erdem, E.; Onbailar, E.E.; Kocakaya, A.; Yalcin, S. Effects of brooder machine rearing method in the first week on fattening performance, carcass characteristics, meat quality and some blood parameters of Pekin ducks. Vet. Fak. Dergisi. 2015, 62, 237–242. [Google Scholar] [CrossRef] [Scilit]
- Petracci, M.; Cavani, C. Muscle growth and poultry meat quality issues. Nutrients 2012, 4, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Dransfield, E.; Sosnicki, A.A. Relationship between muscle growth and poultry meat quality. Poult. Sci. 1999, 78, 743–746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pingel, H.; Knust, U. Review on duck meat quality. In Proceedings of the 11th European Symposium on the Quality of Poultry and Poultry Meat, Tours, France, 4–8 October 1993. [Google Scholar]
- Fanatico, A.C.; Cavitt, L.C.; Pillai, P.B.; Emmert, J.L.; Owens, C.M. Evaluation of slower-growing broiler genotypes grown with and without outdoor access: Meat quality. Poult. Sci. 2005, 84, 1785–1790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Husak, R.L.; Sebranek, J.G.; Bregendahl, K. A survey of commercially available broilers marketed as organic, free-range, and conventional broilers for cooked meat yields, meat composition, and relative value. Poult. Sci. 2008, 87, 2367–2376. [Google Scholar] [CrossRef] [Scilit]
- El-Deek, A.; El-Sabrout, K. Behaviour and meat quality of chicken under different housing systems. World’s Poult. Sci. J. 2019, 75, 105–114. [Google Scholar] [CrossRef] [Scilit]
- Debut, M.; Berri, C.; Baeza, E.; Sellier, N.; Arnould, C.; Guemene, D.; Jehl, N.; Boutten, B.; Jego, Y.; Beaumont, C.; et al. Variation of chicken technological meat quality in relation to genotype and preslaughter stress conditions. Poult. Sci. 2003, 82, 1829–1838. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Zheng, Y.; Wang, G.; Li, H. Identification of microRNA and bioinformatics target gene analysis in beef cattle intramuscular fat and subcutaneous fat. Mol. Biosyst. 2013, 9, 2154–2162. [Google Scholar] [CrossRef] [Scilit]
- Schwab, C.R.; Baas, T.J.; Stalder, K.J.; Mabry, J.W. Effect of long-term selection for increased leanness on meat and eating quality traits in Duroc swine. J. Anim. Sci. 2006, 84, 1577–1583. [Google Scholar] [CrossRef] [Scilit]
- Chizzolini, R.; Zanardi, E.; Dorigoni, V.; Ghidini, S. Calorific value and cholesterol content of normal and low-fat meat and meat products. Trends Food Sci. Technol. 1999, 10, 119–128. [Google Scholar] [CrossRef] [Scilit]
- Shimizu, K.; Nishimuta, S.; Fukumura, Y.; Michinaga, S.; Egusa, Y.; Hase, T.; Terada, T.; Sakurai, F.; Mizuguchi, H.; Tomita, K.; et al. Liver-specific overexpression of lipoprotein lipase improves glucose metabolism in high-fat diet-fed mice. PLoS ONE 2022, 17, e0274297. [Google Scholar] [CrossRef] [Scilit]
- Zhao, G.P.; Chen, J.L.; Zheng, M.Q.; Wen, J.; Zhang, Y. Correlated responses to selection for increased intramuscular fat in a Chinese quality chicken line. Poult. Sci. 2007, 86, 2309–2314. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.L.; Siegel, P.B.; Liu, Y.P.; Wang, Y.; Gilbert, E.R.; Zhu, Q.; Zhang, L. Housing system affects broiler characteristics of local Chinese breed reciprocal crosses. Poult. Sci. 2012, 91, 2405–2410. [Google Scholar] [CrossRef] [Scilit]
- Oddy, V.H.; Harper, G.S.; Greenwood, P.L.; Mcdonagh, M.B. Nutritional and developmental effects on the intrinsic properties of muscles as they relate to the eating quality of beef. Asian-Australas J. Anim. Sci. 2001, 41, 921–942. [Google Scholar] [CrossRef] [Scilit]
- Weimer, S.L.; Zuelly, S.; Davis, M.; Karcher, D.M.; Erasmus, M.A. Differences in carcass composition and meat quality of conventional and slow-growing broiler chickens raised at 2 stocking densities. Poult. Sci. 2022, 101, 101833. [Google Scholar] [CrossRef] [Scilit]
- Rudolph, F.B. The biochemistry and physiology of nucleotides. J. Nutr. 1994, 124, 124S–127S. [Google Scholar] [CrossRef] [Scilit]
| Gene Name | Accession Number | Primer Sequence (5′-3′) | Annealing Temperature (°C) | Products Size (bp) |
|---|---|---|---|---|
| H-FABP | AY648562 | F: ACGGCCAATTTCGATGAGTACA R: TCTCTGTGTTCTTGAAGGTGCTAT | 59.78 | 148 |
| HADH-B | XM 420004 | F: GCTACTGGGTCCAACATACGCTA R: GGCTCCAACCTTTGACTTCCT | 60.75 | 181 |
| ACAA2 | NM 001006571 | F: AAGCACAGCCTCACTCCTC R: ACCAAGTCCATGTCCTTCAA | 59.03 | 143 |
| LPL | NM 205282 | F: AGGAGAAGAGGCAGCAATA R: AAGCCAGCAGCAGATAAG | 57.89 | 222 |
| ADSL | AY786590 | F: GCAGCGGAAGAAGAGAAGAA R: GTTGCTCCAAGGTGGATGAT | 59.89 | 104 |
| 18S rRNA | AF173612 | F: TAGATAACCTCGAGCCGATCGCA R: GACTTGCCCTCCAATGGATCCTC | 58.56 | 312 |
| Trait | Female | Male | SEM | Gender | Housing System | p-Value | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Cage | Floor | Cage | Floor | Female | Male | Cage | Floor | Housing System | Gender | Housing System × Gender | ||
| Body weight (kg) | 1.36 | 1.34 | 1.84 | 1.89 | 0.03 | 1.35 b | 1.87 a | 1.60 | 1.62 | 0.51 | <0.001 | 0.38 |
| Carcass weight (kg) | 1.13 | 1.11 | 1.51 | 1.57 | 0.02 | 1.12 b | 1.54 a | 1.32 | 1.34 | 0.37 | <0.0001 | 0.13 |
| Eviscerated weight (kg) | 0.78 | 0.78 | 1.07 | 1.11 | 0.02 | 0.78 b | 1.09 a | 0.92 | 0.94 | 0.23 | <0.0001 | 0.23 |
| Breast muscle weight (g) | 125.35 | 139.99 | 175.28 | 182.45 | 3.80 | 132.67 b | 178.87 a | 150.31 b | 161.22 a | <0.01 | <0.0001 | 0.32 |
| Breast muscle yield (%) | 16.19 | 18.09 | 16.34 | 16.46 | 0.30 | 17.16 a | 16.40 b | 16.26 b | 17.28 a | <0.01 | 0.01 | <0.01 |
| Thigh muscle weight (g) | 184.27 | 197.73 | 267.69 | 285.03 | 6.20 | 191.00 b | 276.36 a | 225.98 b | 241.38 a | 0.01 | <0.0001 | 0.80 |
| Thigh muscle yield (%) | 23.66 | 25.46 | 24.98 | 25.72 | 0.45 | 24.56 | 25.35 | 24.32 b | 25.59 a | <0.01 | 0.08 | 0.23 |
| Abdominal fat weight (g) | 53.39 | 32.39 | 28.43 | 24.28 | 3.56 | 42.35 a | 26.36 b | 40.91 a | 28.27 b | <0.01 | <0.0001 | 0.03 |
| Abdominal fat yield (%) | 6.33 | 3.90 | 2.56 | 2.04 | 0.33 | 5.13 a | 2.30 b | 4.45 a | 2.95 b | <0.0001 | <0.0001 | 0.02 |
| Subcutaneous fat thickness (mm) | 6.28 | 5.91 | 4.89 | 5.64 | 0.30 | 6.12 a | 5.45 b | 5.59 | 5.78 | 0.59 | 0.03 | 0.06 |
| Trait | Female | Male | SEM | Gender | Housing System | p-Value | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Cage | Floor | Cage | Floor | Female | Male | Cage | Floor | Housing System | Gender | Housing System × Gender | ||
| PM muscle | ||||||||||||
| pHi | 6.02 | 5.99 | 6.07 | 6.29 | 0.05 | 6.00 b | 6.18 a | 6.05 | 6.14 | 0.14 | 0.0082 | 0.05 |
| pHu | 6.05 | 6.03 | 6.11 | 6.32 | 0.05 | 6.04 b | 6.22 a | 6.08 | 6.18 | 0.09 | 0.0028 | 0.04 |
| Shear force (N) | 2.68 | 2.24 | 3.10 | 1.91 | 0.35 | 2.46 | 2.51 | 2.89 a | 2.08 b | 0.04 | 0.76 | 0.45 |
| Drip loss (%) | 3.29 | 2.85 | 4.05 | 2.73 | 0.36 | 3.07 | 3.39 | 3.67 a | 2.79 b | 0.05 | 0.87 | 0.76 |
| Meat color (L*) | 37.51 | 37.90 | 39.77 | 34.13 | 0.95 | 37.71 | 36.95 | 38.64 a | 36.02 b | 0.01 | 0.64 | <0.001 |
| Meat color (a*) | 7.76 | 6.45 | 6.83 | 6.81 | 0.34 | 7.11 | 6.82 | 7.30 | 6.63 | 0.11 | 0.60 | 0.12 |
| Meat color (b*) | 5.72 | 6.53 | 5.96 | 4.97 | 0.26 | 6.13 a | 5.47 b | 5.84 | 5.75 | 0.71 | 0.01 | <0.01 |
| IMP (mg/g) | 4.97 | 4.73 | 4.37 | 4.36 | 0.14 | 4.85 | 4.36 | 4.67 | 4.55 | 0.40 | 0.06 | 0.43 |
| IMF (%) | 4.41 | 2.94 | 3.01 | 1.85 | 0.18 | 3.68 a | 2.43 b | 3.71 a | 2.40 b | <0.0001 | <0.0001 | 0.39 |
| BF muscle | ||||||||||||
| pHi | 6.69 | 6.60 | 6.56 | 6.49 | 0.03 | 6.65 a | 6.53 b | 6.63 a | 6.55 b | <0.01 | <0.001 | 0.60 |
| pHu | 6.70 | 6.54 | 6.57 | 6.47 | 0.03 | 6.62 a | 6.52 b | 6.64 a | 6.51 b | <0.001 | <0.001 | 0.22 |
| Shear force (N) | 2.11 | 2.65 | 2.62 | 3.16 | 0.21 | 2.38 b | 2.89 a | 2.37 b | 2.91 a | 0.01 | 0.02 | 0.99 |
| Drip loss (%) | 4.57 | 4.58 | 2.70 | 2.86 | 0.45 | 4.58 a | 2.78 b | 3.64 | 3.72 | 0.15 | <0.001 | 0.05 |
| Meat color (L*) | 33.90 | 35.85 | 31.79 | 31.83 | 0.97 | 34.88 a | 31.81 b | 32.85 | 33.84 | 0.45 | 0.02 | 0.40 |
| Meat color (a*) | 10.88 | 8.78 | 11.94 | 10.62 | 0.47 | 9.83 b | 11.28 a | 11.41 a | 9.70 b | 0.01 | <0.01 | 0.42 |
| Meat color (b*) | 3.68 | 4.45 | 2.90 | 3.08 | 0.34 | 4.07 a | 2.99 b | 3.29 | 3.77 | 0.17 | <0.01 | 0.40 |
| IMP (mg/g) | 3.00 | 3.06 | 3.30 | 3.10 | 0.09 | 3.03 | 3.20 | 3.15 | 3.08 | 0.46 | 0.08 | 0.33 |
| IMF (%) | 10.66 | 7.36 | 9.02 | 7.29 | 0.34 | 9.01 a | 8.16 b | 9.84 a | 7.33 b | <0.0001 | 0.02 | 0.01 |
| Trait | Female | Male | SEM | Gender | Housing System | p-Value | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Cage | Floor | Cage | Floor | Female | Male | Cage | Floor | Housing System | Gender | Housing System × Gender | ||
| White muscle fiber percentage in PM (%) | 96.6 | 82.8 | 94.9 | 87.7 | 0.9 | 89.7 | 91.3 | 95.7 a | 85.3 b | <0.001 | 0.17 | <0.01 |
| White muscle fiber percentage in BF (%) | 13.2 | 5.9 | 9.5 | 4.6 | 1.6 | 9.6 | 7.1 | 11.4 a | 5.3 b | <0.01 | 0.17 | 0.54 |
| Trait | Cage | Floor | SEM | Tissue | Housing System | p-Value | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| PM Muscle | BF Muscle | PM Muscle | BF Muscle | PM Muscle | BF Muscle | Cage | Floor | Housing System | Tissue | Housing System × Tissue | ||
| Adenosinetriphosphatase (Na+ K+-ATPase), (U/mgprot) | 0.33 | 0.16 | 0.32 | 0.20 | 0.03 | 0.33 a | 0.18 b | 0.25 | 0.26 | 0.73 | <0.001 | 0.52 |
| Adenosinetriphosphatase (Ca2+Mg2+-ATPase) (U/mgprot) | 0.45 | 0.26 | 0.41 | 0.30 | 0.04 | 0.43 a | 0.28 b | 0.36 | 0.36 | 0.91 | <0.001 | 0.28 |
| Creatine kinase (U/mgprot) | 0.64 | 1.26 | 0.86 | 1.20 | 0.23 | 0.75 b | 1.23 a | 0.95 | 1.03 | 0.38 | <0.001 | <0.01 |
| Adenosine deaminase (U/L) | 4.27 | 4.20 | 4.11 | 3.97 | 0.04 | 4.16 | 4.09 | 4.2 | 4.04 | 0.65 | 0.76 | 0.93 |
| 5′-nucleotidase (U/L) | 10.82 | 9.36 | 7.19 | 10.39 | 2.23 | 9.01 | 9.88 | 10.09 | 8.79 | 0.36 | 0.60 | 0.09 |
| Gene Name | Cage | Floor | SEM | Tissue | Housing System | p-Value | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| PM Muscle | BF Muscle | PM Muscle | BF Muscle | PM Muscle | BF Muscle | Cage | Floor | Housing System | Tissue | Housing System × Tissue | ||
| H-FABP | 0.0480 | 0.4286 | 0.0283 | 0.4263 | 0.0068 | 0.0382 b | 0.4275 a | 0.2383 | 0.2273 | 0.85 | <0.001 | 0.91 |
| HADH-β | 0.0166 | 0.1825 | 0.0083 | 0.1136 | 0.0251 | 0.0125 b | 0.1481 a | 0.1000 | 0.0610 | 0.33 | <0.001 | 0.38 |
| ACAA2 | 0.0034 | 0.1693 | 0.0013 | 0.1002 | 0.0204 | 0.0024 b | 0.1348 a | 0.0864 | 0.0508 | 0.24 | <0.001 | 0.26 |
| LPL | 0.0006 | 0.0016 | 0.0003 | 0.0008 | 0.0001 | 0.0005 b | 0.0012 a | 0.0011 a | 0.0006 b | 0.02 | <0.001 | 0.40 |
| ADSL | 0.0135 | 0.0013 | 0.0186 | 0.0041 | 0.0010 | 0.0161 a | 0.0027 b | 0.0074 | 0.0113 | 0.62 | 0.02 | 0.25 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, Y.; Liu, C.; Li, Y.; Li, D.; Shi, L.; Chen, J. Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens. Agriculture 2023, 13, 365. https://doi.org/10.3390/agriculture13020365
Sun Y, Liu C, Li Y, Li D, Shi L, Chen J. Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens. Agriculture. 2023; 13(2):365. https://doi.org/10.3390/agriculture13020365
Chicago/Turabian StyleSun, Yanyan, Chen Liu, Yunlei Li, Dongli Li, Lei Shi, and Jilan Chen. 2023. "Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens" Agriculture 13, no. 2: 365. https://doi.org/10.3390/agriculture13020365
APA StyleSun, Y., Liu, C., Li, Y., Li, D., Shi, L., & Chen, J. (2023). Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens. Agriculture, 13(2), 365. https://doi.org/10.3390/agriculture13020365

