Next Article in Journal
Properties of Nano-Amendments and Their Effect on Some Soil Properties and Root-Knot Nematode and Yield Attributes of Tomato Plant
Previous Article in Journal
Research on Multi-Scale Pest Detection and Identification Method in Granary Based on Improved YOLOv5
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens

1
Key Laboratory of Animal (Poultry) Genetics Breeding and Reproduction, Ministry of Agriculture and Rural Affairs, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, China
2
Beijing Bainianliyuan Ecological Agriculture Co., Ltd., Beijing 101599, China
*
Author to whom correspondence should be addressed.
Agriculture 2023, 13(2), 365; https://doi.org/10.3390/agriculture13020365
Submission received: 21 December 2022 / Revised: 29 January 2023 / Accepted: 1 February 2023 / Published: 2 February 2023
(This article belongs to the Section Agricultural Systems and Management)

Abstract

This study compared floor (FS) with cage systems (CS) for slow-growing meat-type chickens in terms of muscle fiber characteristics, carcass characteristics, and meat quality. Following the design of a factorial arrangement of 2 housing systems × 2 genders, 180 male and 180 female Beijing You chickens of 8 weeks old were allocated to FS and CS. At the end of 17 weeks, five males and five females from each replicate were selected for measurement. No difference was observed in body, carcass, or eviscerated weight (p > 0.05). FS birds showed higher muscle yield and lower abdominal fat composition (p < 0.05). Inosine-5′-monophosphate (IMP) content was not affected by housing system or gender (p > 0.05). On the contrary, intramuscular fat (IMF) content was affected by both in a way that CS birds and females had higher IMF content (p < 0.05). FS birds had a higher percentage of white muscle fibers (p < 0.05). In conclusion, carcass characteristics, meat quality, and muscle fiber type of slowing-growing broilers are influenced: rearing on the floor may improve muscle development and reduce fat deposition without impairing marketing weight and rearing in cages may improve IMF content.

1. Introduction

Although the substantial growth of fast-growing meat chickens provides cost-effective animal proteins, consumer interest in meat products from slow-growing chicken genotypes with additional attributes such as meat quality are growing in many countries. For example, the slow-growing breeds make up around 40%, 24%, and 39% of broilers in the Netherlands, France, and China, respectively [1]. Because of this rising trend in consumption and production volume, the slow-growing broilers are also reared quite extensively in intensified production systems [2]. The housing systems of chickens are dependent on local climate and policy, land availability, breed preference, and other resources essential for production [3]. Most broiler production has relied on litter-floor barns. Multi-tier cages were recently well-developed by some industry suppliers [4]. There is also interest in housing chickens with outdoor access and pasture management in view of the growing animal welfare concerns in Europe [5]. Studies have focused on the effects of housing systems on the growth performance, bone characteristics, and carcass performance of broilers [6,7,8,9]. Reduced labor cost, increased uniformity, improved feed efficiency, and minimum incidence of coccidiosis have been reported by these studies as the advantage of caged broilers. Although cages have been banned in broilers and layers in the EU, cage production seems quite attractive and has been quickly growing in recent years in Russia, the Middle East, Africa, and several Asian countries including China [10].
Meat quality is especially important for slow-growing broilers. Muscle fiber is the basic unit of skeletal muscle. Muscle mass and meat quality are basically closely associated with muscle fiber characteristics including density and muscle fiber type composition [11,12]. Different housing systems may vary in the space for the birds’ locomotion and threfore induce the difference in muscle fiber size and composition. Due to different metabolic characteristics, the energy substances and enzyme systems of the two types of muscle fibers are also different. Red muscle fiber usually contains more fat. The activities of aerobic metabolic enzymes such as succinate dehydrogenase (SDH) are very high, while the activities of ATPase and phosphorylase necessary for the initial degradation of glycogen are very low. In contrast, white muscle fibers contain high glycogen, high ATPase, and phosphorylase activities. These enzyme activities could be associated with the inosine-5′-monophosphate (IMP) and intramuscular fat (IMF). Additionally, the housing system may affect the expression of key genes involved in lipid metabolism also by altering the amount of motion. This may further induce the IMF content difference between the birds from different housing systems. These genes may include the lipoprotein lipase (LPL) mediating triglyceride hydrolysis, heart fatty acid-binding protein (H-FABP) promoting β-oxidation of fatty acid, hydroxyacyl-coenzyme a dehydrogenase-β (HADH-β) and acetyl-coenzyme A acyltransferase 2 (ACAA2), encoding enzymes of fatty acid oxidation pathway, and adenylosuccinate lyase (ADSL) [13,14,15].
The housing systems may manipulate the meat quality by altering the muscle fiber characteristics and the associated enzyme and gene expression. However, there is still a lack of information on the specific effects of cage and floor housing systems in commercial slow-growing broiler flocks. Therefore, this study aimed to compare simultaneously the floor housing system with the cage housing system used in slow-growing broiler production, in terms of carcass characteristics traits and meat quality of Beijing You chickens, which is a typical quality broiler breed in China.

2. Materials and Methods

2.1. Animals and Housing Systems

The experiment was designed as a factorial arrangement of 2 housing systems × 2 genders. Two types of housing systems, the conventional litter floor bedded with wood shaving (floor system), and the non-litter battery cages (cage system) were installed in an experimental facility of the experimental farm of IAS-CAAS. The cages were bedded with plastic mesh with hole diameter of 1.2 cm. A total of 180 male and 180 female Beijing You chickens of 8 weeks of age of similar body weight were selected and allocated to floor system and cage system averagely and randomly. They were hatched contemporarily and brooded in the same conditions before 8 weeks of age. The floor system had three replicates (pen) for males and three replicates for females, with thirty birds in each pen. The dimension of the pen is 2.0 m × 3.5 m. The cage system had three replicates (row of battery cage) for males and three replicates for females. There were ten cages in each row, with three birds in each cage. The dimension of the cage was 65 cm × 30 cm × 30 cm.

2.2. Management and Diet

The house was power ventilated. Standard brooding temperatures were used. Feeds were formulated to meet established standards [16]. Chicks were fed on a commercial diet with 12.6 Mcal/kg ME and 21.5% protein from hatch to 8 weeks and a finisher diet with 13.2 Mcal/kg ME and 18.0% protein from 9 to 17 weeks. The birds had free access to feed and water throughout the study. The chicks were provided with 24L:0D light of 20-lx for 1–3 d and 23L:1D light of 20-lx light intensity for 4–7 d of the first wk. From the 2nd week, the 16L:8D light of 10-lux (dark from 20:00 h to 04:00 h) was provided until the end of the study. Light intensity was measured using a light meter (DT-1301, CEM Co., Ltd., Shenzhen, China).

2.3. Carcass Characteristics

Body weight was measured at the end of 17 weeks of age, which is a typical slaughtering age in China for the high-quality slow-growing Beijing You chickens. After fasting for 12 h, a number of 5 males or 5 females were randomly selected from each replicate of both housing systems, weighed, and slaughtered in a poultry processing plant using the electrical stunning method. The de-feathered carcass weight, eviscerated weight, breast muscle weight, thigh muscle weight, and abdominal fat pad weight including leaf fat surrounding the cloaca and gizzard were recorded. Yields were calculated as the percentages of body weight. Subcutaneous fat thickness was measured at the intersection of the front end of the coccyx and the dorsal midline using the vernier caliper.

2.4. Meat Quality Characteristics

The muscle samples from all the slaughtered birds were also collected for meat quality estimation. Intramuscular fat (IMF) and inosine-5′-monophosphate (IMP) content of pectoralis major (PM) muscle and biceps femoris (BF) muscle was determined according to the AOAC-approved methods [17] and our previous work [18]. In short, IMF was measured by Soxhlet extraction with anhydrous diethyl ether for 20 g of the right fillet after the removal of visible fat, fascia, and blood vessel. IMF was expressed as a percentage of muscle dry matter. IMP content was measured using the lipid chromatogram.
The color parameters (Commission Internationale d’Eclairage lightness (L*), redness (a*), and yellowness (b*)) were measured on the central portion of right PM and BF using a tristimulus analyzer (WSC-S, Shenguang, Shanghai, China). The measurement was the result of three averaged readings. At 24 h postmortem, the PM and BF muscle samples were weighed (final weight). The difference between final and initial weight was calculated and drip loss was expressed as a percentage of the difference to the initial muscle weight. The meat pH after 1 h of slaughter (pHi) and after 24 h of storage at 4 °C (pHu) was measured in the middle of PM and BF muscle using a digital pH meter with an occipital electrode (IQ150, IQ Scientific Instruments, Carlsbad, CA, USA). Shear force was evaluated on the cooked PM and BF muscles. In short, the muscle was heated in the electro-thermostatic water bath set at 80 °C until the core temperature of the muscle reached 70 °C. The meat was cooled to 4 °C thereafter. Three columns (3 cm × 1 cm × 1 cm) were vertically taken from the muscle fibers of cooked meat. Each was sheared perpendicularly to the longitudinal orientation of the surface muscle fibers using a shear tool. Maximum shear force (N) of each cutting was recorded.

2.5. Muscle Fiber Characteristics

PM muscle and BF muscle samples from all the slaughtered birds (0.5 cm × 0.5 cm × 1.0 cm) were collected for making the frozen transverse section and enzyme succinate dehydrogenase (SDH, EC 1.3.99.1) staining. In short, the samples were collected, snap-frozen in liquid nitrogen, and stored at −80 °C until process. After the embedding with optimal cutting temperature compound, serial cryosections (6 μm) were cut from the muscle tissue using a freezing cryostat microtome (KD-2508-VI, Jinhua Kedi Equipment Co., Ltd., Jinhua, Zhejiang, China), which was set at −25 °C. Serial cryosections were collected on gelatin-coated slides. The SDH staining was subsequently performed. In short, serial cryosections were incubated for 60 min at 37 °C in SDH incubation solution (100 mg sodium succinate, 10 mg nitro blue tetrazolium (NBT), 0.3 mg phenazine dimethyl sulfate, 30 mL 0.1 M Tris buffer, pH 7.2). The slides were incubated stepwisely in 60%, 90%, and 60% acetone to remove the unbound NBT. The slides were washed with deionized water for 30 s, dehydrated stepwisely in 70%, 90%, and 100% ethanol solutions, fixed in 10% neutral formaldehyde for 10 min, and washed with deionized water for another 30 s and dried. The slides were cleared in xylene and finally mounted with the glycerol jelly mounting medium. During the observation, muscle fibers were identified as white muscle fibers or red muscle fibers. White muscle fiber percentage was calculated. The analyses were measured on five random microscopic fields of each section under light microscopy (Olympus, Tokyo, Japan) at 40× magnification.

2.6. Enzyme Activity

About 2 g of the PM and BF muscle of the slaughtered male birds were collected, snap-frozen in liquid nitrogen, and stored at −80 °C for the IMF and IMP-related enzyme activity estimation. In short, a total of 0.5 g muscles were separated from the samples and minced in the 20 mL tube on ice. A mount of 4.5 mL homogenization medium (0.01 mol/L Tris-HCl, 0.0001 mol/L EDTA-2Na, 0.01 mol/L sucrose, 0.8% NaCl solution, pH 7.4) was added. The homogenate was made by the hand-held homogenizer (Fluko-F8, FLUKO Science and Technology Development Co., Ltd., Shanghai, China) at 10,000–15,000 r/min and centrifuged at 2000 r/min for 10–15 min. The homogenate for ATPase was centrifuged at 1000 r/min for 5 min. The supernatant was separated and stored at −80 °C for process. The activity of enzymes including adenosinetriphosphatase (ATPase, EC 3.6.1.3), creatine kinase (CK, EC 2.7.3.2), adenosine deaminase (ADA, EC 3.5.4.37), and 5′-nucleotidase (5′-NT, EC 3.1.3.5) was determined by the commercial kits following the methodology recommended by the manufacturer (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

2.7. Gene Expression

The PM and BF muscle samples were collected from all the male birds sacrificed during the study and frozen in liquid nitrogen temporarily and stored at −80 °C until further manipulation. The expression of five previously reported fat metabolism-related genes, namely H-FABP, HADH-β, ACAA2, LPL, and ADSL, were estimated in these samples. Total RNA was isolated using the Trizol reagent (Tiangen, Beijing, China) from each amount of 100 mg PM or BF muscle samples. The RNA concentration was estimated using the NanoDrop 2000 (Thermo, Waltham, MA, USA) and RNA integrity was estimated using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), respectively, and stored at −80 °C until further use. Total RNA was reverse transcribed into cDNA using PrimeScript RT Reagent Kit (TaKaRa, Kusatsu, Japan) and following the manufacturer’s instruction. Real-time quantitative PCR (q-PCR) of the five genes was performed using the ABI 7500 Real-time Detection System (Applied Biosystems, Waltham, MA, USA) and PrimeScript One Step RT-PCR Kit (TaKaRa, Japan). Each 20.0 μL PCR mixture contained 10 μL of SYBR Premix Ex Taq™ II, 0.4 μL (10 pM) of each primer, 0.4 μL ROX Reference Dye II (50×), 2.0 μL cDNA (100 ng), and 6.8 μL ddH2O. After an initial denaturing at 95 °C for 3 min, the 40 cycles of amplification (95 °C for 3 s and 60 °C for 32 s), and thermal denaturing (95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s) followed. 18S rRNA was amplified in the same plates as an endogenous control. The primers (Table 1) were designed by Primer Premier 5.0 and confirmed by Oligo 6.0. Samples were assayed in triplicate. The amplification efficiency of transcripts of interest genes and the endogenous control 18S rRNA was consistent. Dissociation curves further verified that amplification was specific. The relative abundance of transcripts was calculated from 2−ΔΔCT.

2.8. Statistical Analysis

The data were analyzed using the GLM procedure of SAS (SAS User’s Guide, 2001, Version 8 ed., SAS Institute Inc., Cary, NC, USA). The body weight, carcass characteristics, meat quality, and muscle fiber characteristics were subjected to 2-way ANOVA in a 2 × 2 factorial arrangement to analyze the main effects of housing systems and gender and their interaction. The enzyme activity and gene expression data were subjected to 2-way ANOVA in a 2 × 2 factorial arrangement to analyze the main effects of housing systems and tissue and their interaction. The significance was designated as p < 0.05. The Pearson correlation coefficient between carcass characteristics, between meat quality traits were estimated.

3. Results

3.1. Body Weight and Carcass Characteristics

The influence of housing systems and gender on body weight and carcass characteristics of Beijing You chickens are presented in Table 2. In general, males and females differed in body weight and all carcass characteristics traits (p < 0.05), except for thigh muscle yield (p = 0.09). The housing system did not affect the body weight, carcass weight, or eviscerated weight (p > 0.05), but affected the breast muscle, thigh muscle, and abdominal fat weight and yield (p < 0.05). The caged birds had less breast and thigh muscle weight and yield, and higher abdominal fat weight and yield (p < 0.05) as compared to the floored ones. The Pearson correlation coefficients of carcass characteristics of Beijing You chickens at 17 weeks of age were presented in Supplementary Table S1.

3.2. Meat Quality

The influence of housing systems and gender on the meat quality of Beijing You chickens is presented in Table 3. The caged birds have a higher pH value of BF muscle (p < 0.05), while this difference was not observed for the PM muscle. The floored birds had higher shear force for BF muscle but lower for PM muscle (p < 0.05). For the meat color, the caged birds had higher L* for the PM muscle and higher a* for the BF muscle (p < 0.05). The IMP content was not affected by the housing system or gender (p > 0.05). On the contrary, the IMF content of PM and BF muscle were affected by both the housing systems and the gender, in a way that the caged birds and the females have higher IMF content (p < 0.05). The Pearson correlation coefficients of meat quality of Beijing You chickens at 17 weeks of age were presented in Supplementary Table S2.

3.3. Muscle Fiber Characteristics

The influence of housing systems on muscle fiber characteristics of PM and BF muscles of Beijing You chickens is presented in Table 4. PM muscle of the birds from the cage system was composed of more white muscle fibers than those of the floor system (p < 0.05).

3.4. IMP and IMF Related Enzyme Activity and Genes Expression

The enzyme activity of ATPase, CK, ADA, and 5′-NT were determined for the PM and BF muscle of the male birds from the cage and floor systems. The results in Table 5 showed that the housing system did not affect their enzyme activity in the muscles (p > 0.05). The ATPase of PM muscle was higher than the BF muscle, while the CK was lower in the PM muscle (p < 0.001).
The expression of five fat metabolism-related genes including H-FABP, HADH-β, ACAA2, LPL, and ADSL was estimated in the PM and BF muscle samples of the birds in two housing systems. As shown in Table 6, the expression of LPL of the caged birds was higher than the ones of the floor system (p = 0.02). The expression of H-FABP, HADH-β, ACAA2, and LPL was higher in the BF muscle (p < 0.001), while the expression of ADSL was higher in the PM muscle (p = 0.02).

4. Discussion

Factors that impact the chickens’ carcass characteristics and meat quality include genetic background, age, gender, diet, and management such as housing systems mentioned here. With the aim to provide information on proper housing systems to be used for slow-growing broilers, this study evaluated the indoor floor and cage system and gender on muscle fiber characteristics, carcass, and meat quality.
The gender dimorphism in growth is strongly pronounced [19]. As expected, the body weight, carcass weight, breast, and muscle weight of males were higher than those of females. Concerning the housing system, the caged birds had less breast and thigh muscle weight and yield, and higher abdominal fat weight and yield than those in floor systems. The stretching of wings was reported to promote the breast muscle to grow in proportion [20]. It is therefore speculated that the floor system provided the birds with more space for regular movement, promoting the better development and growth of the muscles and reducing fat deposition. This result is in accordance with the finding reported previously [21]. In addition to the meat mass, the housing system also affects the muscle fiber types which may potentially further affect the meat quality as reported previously [12,22,23]. The observation in this study that the birds in cages had a higher percentage of white muscle fibers than the floor ones agrees with a previous study showing that ducks kept intensively had fewer red fibers than those kept on pasture [24]. This may be because the potentially greater movement on the ground allows the conversion of fibers of an anaerobic metabolic profile to intermediate or even oxidative fibers. This speculation needs further gathering of data on the activity of the chicks in the ethogram of diurnal behavior.
The water-holding capacity and color are important meat quality characteristics that affect consumer preferences [25] and are reported to be influenced by the rearing conditions [26,27]. In this study, the drip loss of PM muscle of caged birds was also higher than those of the floor ones. For the boneless product from the traditional fast-growing broilers, meat color is almost the first conspicuous characteristic noted by customers [25]. The slow-growing broiler chickens are normally sold as a whole carcass, and the meat color is also an important clue for the judgment of the age and flavor. In general, slow-growing birds are redder than fast-growing genotypes [28]. This is a favorite because the redness is a symbol of a longer growing period and more flavor ingredients deposition, in the eyes of consumers. The higher L* for the PM muscle and higher a* for the BF muscle of the caged birds exert the advantage of the cage system in this aspect.
Fat in the meat especially the IMF may be beneficial in a gourmet market, and it increases as chickens age [25]. The flavor and taste of meat from slow-growing broiler chickens are superior partially because they are marketed when approaching their sexual maturity [2], and the amount of flavor-enhancing compounds such as IMF and subcutaneous fat deposition is high by that stage [2]. IMF is shown to contribute to the sensory perception of meat delicacy and is therefore an important attribute of meat quality [29]. Previous investigations have shown that IMF is related to tenderness [30], juiciness, and flavor [31]. The expression of five fat metabolism-related genes including H-FABP, HADH-β, ACAA2, LPL, and ADSL was estimated in the PM and BF muscle samples of the birds in two housing systems. LPL is a key enzyme expressed mainly in the adipose tissue and muscle to regulate lipid metabolism via the hydrolysis of triglyceride in chylomicrons and very low-density lipoproteins [32]. Its high expression in the BF muscle and in the caged birds agreed with the observation of higher IMF contents. In contrast to IMF, abdominal fat deposition is an undesired carcass composition. IMF and abdominal fat deposition may be genetically related. A high genetic correlation coefficient of 0.66 was found between IMF and abdominal fat [18]. Selection for increased IMF in Beijing You chickens also resulted in more abdominal fat [33]. In the present study, both the abdominal fat of caged females and PM muscle IMF content of the caged males and females were higher than the ones housed in the floor system. The observation here is in a similar way with the study using a different slow-growing breed [34]. The positive and medium correlation between IMF and abdominal fat was also observed in the present study. Therefore, it could be speculated that it is difficult to have a housing system that can increase the IMF and decrease abdominal fat deposition simultaneously. The IMF content was also shown to be related to the tenderness of meat [35]. The shear force is a direct measure of texture, which is associated with consumer satisfaction in the eating quality of poultry meat products [36]. However, in the present study, the shear force of the PM muscle from caged birds with higher IMF content was higher than the ones in the floor system. This indicated that there should be other factors affecting the tenderness of the PM muscle. The IMP in muscle tissue is produced by ATP degradation under a series of enzymatic reactions after animal death [37]. Therefore, the enzymes that affect ATP degradation and IMP degradation are crucial for the IMP content.
It is known that red muscle fiber usually contains more fat. The activities of ATPase and phosphorylase are low. In contrast, white muscle fibers contain high ATPase. The results here also showed that the PM muscle which is composed of a higher percentage of white muscle fibers showed higher enzyme activities of ATPase. Although it was observed that the white muscle fiber percentage of caged birds was higher than those from the floor system, the housing system did not affect their enzyme activity in the muscles. Maybe the difference in the former is not enough to arise the difference in the latter. This may also explain the result that the IMP content did not differ between the birds of the two systems.

5. Conclusions

The slow-growing broilers may become the future mainstream of the chicken meat market. The proper housing condition is crucial for maintaining their meat quality. This study indicated that rearing slow-growing meat-type chickens in floor pens may improve breast muscle development, increase the red muscle fiber proportion, and reduce fat deposition without impairing the final marketing body weight, while rearing slow-growing meat chickens in cage systems may improve IMF content. These findings provide a further understanding of different indoor housing systems on muscle development and meat quality and might help the producers in designing proper facilities and ensuring yield and quality. Furthermore, in the future, it is necessary to include the animal welfare and production efficiency (e.g., feed conservation ratio) aspects to present a comprehensive evaluation of the cage-rearing technology of slow-growing broilers.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture13020365/s1, Table S1: The Pearson correlation coefficient of carcass characteristics of Beijing You chickens at 17 weeks of age; Table S2: The Pearson correlation coefficient of meat quality of Beijing You chickens at 17 weeks of age.

Author Contributions

Conceptualization, J.C.; methodology, Y.S.; software, Y.S.; validation, L.S. and Y.L.; formal analysis, Y.S.; investigation, C.L.; resources, D.L.; data curation, Y.S. and Y.L.; writing—original draft preparation, Y.S.; writing—review and editing, Y.S., C.L. and J.C.; visualization, Y.S.; supervision, J.C.; project administration, Y.S. and J.C.; funding acquisition, J.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Beijing Featured Livestock and Poultry Genetic Resources Preservation Project, grant number 202203310002, China Agriculture Research System of MOF and MARA, grant number CARS-40, and the Agricultural Science and Technology Innovation Program, grant number ASTIP-IAS04.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of Institute of Animal Science, Chinese Academy of Agricultural Sciences. (Protocol code 2021-16, 28 June 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

None of the data or models were deposited in an official repository, but they are available from the corresponding author upon request.

Acknowledgments

Adama Mani Isa is acknowledged for his careful proof reading of this manuscript.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Singh, M.; Lim, A.J.; Muir, W.I.; Groves, P.J. Comparison of performance and carcass composition of a novel slow-growing crossbred broiler with fast-growing broiler for chicken meat in Australia. Poult. Sci. 2021, 100, 100966. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Sun, Y.Y.; Tang, S.; Chen, Y.; Li, D.L.; Bi, Y.L.; Hua, D.K.; Chen, C.; Luo, Q.Y.; Yang, L.; Chen, J.L. Effects of light regimen and nutrient density on growth performance, carcass traits, meat quality, and health of slow-growing broiler chickens. Livest. Sci. 2017, 198, 201–208. [Google Scholar] [CrossRef] [Scilit]
  3. Zhao, X.; Ren, W.; Siegel, P.B.; Li, J.; Yin, H.; Liu, Y.; Wang, Y.; Zhang, Y.; Honaker, C.F.; Zhu, Q. Housing systems interacting with sex and genetic line affect broiler growth and carcass traits. Poult. Sci. 2015, 94, 1711–1717. [Google Scholar] [CrossRef] [Scilit]
  4. Mace, J.L.; Knight, A. The impacts of colony cages on the welfare of chickens farmed for meat. Animals 2022, 12, 2988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Chan, I.; Franks, B.; Hayek, M.N. The ‘sustainability gap’ of US broiler chicken production: Trade-offs between welfare, land use and consumption. R. Soc. Open Sci. 2022, 9, 210478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Tolon, B.; Yalcin, S. Bone characteristics and body weight of broilers in different husbandry systems. Br. Poult. Sci. 1997, 38, 132–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Sogunle, O.M.; Egbeyale, L.T.; Bajomo, T.T.; Bamigboje, O.V.; Fanimo, A.O. Comparison of the performance, carcass characteristics and haematological parameters of broiler chicks reared in cage and floor. Pak. J. Biol Sci. 2008, 11, 480–483. [Google Scholar] [CrossRef] [Scilit]
  8. Sekeroglu, A.; Demir, E.; Sarica, M.; Ulutas, Z. Effects of housing systems on growth performance, blood plasma constituents and meat fatty acids in broiler chickens. Pak. J. Biol Sci. 2009, 12, 631–636. [Google Scholar] [CrossRef] [Scilit]
  9. Zhao, Y.; Li, P.; Chen, N.; Liu, Y.; Liu, D.; Guo, Y. Effects of housing systems and glucose oxidase on growth performance and intestinal health of Beijing You Chickens. Poult. Sci. 2021, 100, 100943. [Google Scholar] [CrossRef] [Scilit]
  10. Simsek, U.G.; Erisir, M.; Ciftci, M.; Seven, P.T. Effects of cage and floor housing systems on fattening performance, oxidative stress and carcass defects in broiler chicken. Kafkas Univ. Vet. Fak. 2014, 20, 727–733. [Google Scholar] [CrossRef] [Scilit]
  11. Joo, S.T.; Kim, G.D.; Hwang, Y.H.; Ryu, Y.C. Control of fresh meat quality through manipulation of muscle fiber characteristics. Meat. Sci. 2013, 95, 828–836. [Google Scholar] [CrossRef] [Scilit]
  12. Ismail, I.; Joo, S.T. Poultry meat quality in relation to muscle growth and muscle fiber characteristics. Korean J. Food Sci. Anim. Resour. 2017, 37, 873–883. [Google Scholar] [PubMed]
  13. Zhang, X.D.; Li, Q.H.; Lou, L.F.; Liu, J.; Chen, X.H.; Zhang, C.X.; Wang, H.H. High-resolution melting curve analysis of the ADSL and LPL genes and their correlation with meat quality and blood parameters in chickens. Genet. Mol. Res. 2015, 14, 2031–2340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Wang, X.J.; Song, Z.G.; Jiao, H.C.; Lin, H. Dexamethasone facilitates lipid accumulation in chicken skeletal muscle. Stress 2012, 15, 443–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Huang, H.; Xue, J.; Zheng, J.; Tian, H.; Fang, Y.; Wang, W.; Wang, G.; Hou, D.; Lin, J. Bioinformatic analysis of the gene expression profile in muscle atrophy after spinal cord injury. Sci. Rep. 2021, 11, 21903. [Google Scholar] [CrossRef] [Scilit]
  16. Ministry of Agriculture. Feeding Standard of Chicken (NY/T33-2004); China Agriculture Press: Beijing, China, 2004; pp. 11–12. [Google Scholar]
  17. Cunniff, P. Official Methods of Analysis of AOAC International, 17th ed.; Association of the Official Analytical Chemists (AOAC) International: Gaithersburg, MD, USA, 2003. [Google Scholar]
  18. Chen, J.L.; Zhao, G.P.; Zheng, M.Q.; Wen, J.; Yang, N. Estimation of genetic parameters for contents of intramuscular fat and inosine-5’-monophosphate and carcass traits in Chinese Beijing-You chickens. Poult. Sci. 2008, 87, 1098–1104. [Google Scholar] [CrossRef] [Scilit]
  19. Müsse, J.; Louton, H.; Spindler, B.; Stracke, J. Sexual dimorphism in bone quality and performance of conventional broilers at different growth phases. Agriculture 2022, 12, 1109. [Google Scholar] [CrossRef] [Scilit]
  20. Holly, R.G.; Barnett, J.G.; Ashmore, C.R.; Taylor, R.G.; Mole, P.A. Stretch-induced growth in chicken wing muscles: A new model of stretch hypertrophy. Am. J. Physiol. 1980, 238, C62–C71. [Google Scholar] [CrossRef] [Scilit]
  21. Erdem, E.; Onbailar, E.E.; Kocakaya, A.; Yalcin, S. Effects of brooder machine rearing method in the first week on fattening performance, carcass characteristics, meat quality and some blood parameters of Pekin ducks. Vet. Fak. Dergisi. 2015, 62, 237–242. [Google Scholar] [CrossRef] [Scilit]
  22. Petracci, M.; Cavani, C. Muscle growth and poultry meat quality issues. Nutrients 2012, 4, 1–12. [Google Scholar] [CrossRef] [Scilit]
  23. Dransfield, E.; Sosnicki, A.A. Relationship between muscle growth and poultry meat quality. Poult. Sci. 1999, 78, 743–746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Pingel, H.; Knust, U. Review on duck meat quality. In Proceedings of the 11th European Symposium on the Quality of Poultry and Poultry Meat, Tours, France, 4–8 October 1993. [Google Scholar]
  25. Fanatico, A.C.; Cavitt, L.C.; Pillai, P.B.; Emmert, J.L.; Owens, C.M. Evaluation of slower-growing broiler genotypes grown with and without outdoor access: Meat quality. Poult. Sci. 2005, 84, 1785–1790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Husak, R.L.; Sebranek, J.G.; Bregendahl, K. A survey of commercially available broilers marketed as organic, free-range, and conventional broilers for cooked meat yields, meat composition, and relative value. Poult. Sci. 2008, 87, 2367–2376. [Google Scholar] [CrossRef] [Scilit]
  27. El-Deek, A.; El-Sabrout, K. Behaviour and meat quality of chicken under different housing systems. World’s Poult. Sci. J. 2019, 75, 105–114. [Google Scholar] [CrossRef] [Scilit]
  28. Debut, M.; Berri, C.; Baeza, E.; Sellier, N.; Arnould, C.; Guemene, D.; Jehl, N.; Boutten, B.; Jego, Y.; Beaumont, C.; et al. Variation of chicken technological meat quality in relation to genotype and preslaughter stress conditions. Poult. Sci. 2003, 82, 1829–1838. [Google Scholar] [CrossRef] [Scilit]
  29. Wang, H.; Zheng, Y.; Wang, G.; Li, H. Identification of microRNA and bioinformatics target gene analysis in beef cattle intramuscular fat and subcutaneous fat. Mol. Biosyst. 2013, 9, 2154–2162. [Google Scholar] [CrossRef] [Scilit]
  30. Schwab, C.R.; Baas, T.J.; Stalder, K.J.; Mabry, J.W. Effect of long-term selection for increased leanness on meat and eating quality traits in Duroc swine. J. Anim. Sci. 2006, 84, 1577–1583. [Google Scholar] [CrossRef] [Scilit]
  31. Chizzolini, R.; Zanardi, E.; Dorigoni, V.; Ghidini, S. Calorific value and cholesterol content of normal and low-fat meat and meat products. Trends Food Sci. Technol. 1999, 10, 119–128. [Google Scholar] [CrossRef] [Scilit]
  32. Shimizu, K.; Nishimuta, S.; Fukumura, Y.; Michinaga, S.; Egusa, Y.; Hase, T.; Terada, T.; Sakurai, F.; Mizuguchi, H.; Tomita, K.; et al. Liver-specific overexpression of lipoprotein lipase improves glucose metabolism in high-fat diet-fed mice. PLoS ONE 2022, 17, e0274297. [Google Scholar] [CrossRef] [Scilit]
  33. Zhao, G.P.; Chen, J.L.; Zheng, M.Q.; Wen, J.; Zhang, Y. Correlated responses to selection for increased intramuscular fat in a Chinese quality chicken line. Poult. Sci. 2007, 86, 2309–2314. [Google Scholar] [CrossRef] [Scilit]
  34. Zhao, X.L.; Siegel, P.B.; Liu, Y.P.; Wang, Y.; Gilbert, E.R.; Zhu, Q.; Zhang, L. Housing system affects broiler characteristics of local Chinese breed reciprocal crosses. Poult. Sci. 2012, 91, 2405–2410. [Google Scholar] [CrossRef] [Scilit]
  35. Oddy, V.H.; Harper, G.S.; Greenwood, P.L.; Mcdonagh, M.B. Nutritional and developmental effects on the intrinsic properties of muscles as they relate to the eating quality of beef. Asian-Australas J. Anim. Sci. 2001, 41, 921–942. [Google Scholar] [CrossRef] [Scilit]
  36. Weimer, S.L.; Zuelly, S.; Davis, M.; Karcher, D.M.; Erasmus, M.A. Differences in carcass composition and meat quality of conventional and slow-growing broiler chickens raised at 2 stocking densities. Poult. Sci. 2022, 101, 101833. [Google Scholar] [CrossRef] [Scilit]
  37. Rudolph, F.B. The biochemistry and physiology of nucleotides. J. Nutr. 1994, 124, 124S–127S. [Google Scholar] [CrossRef] [Scilit]
Table 1. Primer information of genes used in q-PCR.
Table 1. Primer information of genes used in q-PCR.
Gene NameAccession NumberPrimer Sequence (5′-3′)Annealing Temperature (°C)Products Size (bp)
H-FABPAY648562F:
ACGGCCAATTTCGATGAGTACA
R:
TCTCTGTGTTCTTGAAGGTGCTAT
59.78148
HADH-BXM 420004F:
GCTACTGGGTCCAACATACGCTA
R: GGCTCCAACCTTTGACTTCCT
60.75181
ACAA2NM 001006571F: AAGCACAGCCTCACTCCTC
R: ACCAAGTCCATGTCCTTCAA
59.03143
LPLNM 205282F: AGGAGAAGAGGCAGCAATA
R: AAGCCAGCAGCAGATAAG
57.89222
ADSLAY786590F:
GCAGCGGAAGAAGAGAAGAA
R: GTTGCTCCAAGGTGGATGAT
59.89104
18S rRNAAF173612F:
TAGATAACCTCGAGCCGATCGCA
R:
GACTTGCCCTCCAATGGATCCTC
58.56312
H-FABP: heart fatty acid-binding protein, HADH-β: hydroxyacyl-coenzyme a dehydrogenase β, ACAA2: acetyl-coenzyme A acyltransferase2, LPL: lipoprotein lipase, ADSL: adenylosuccinate lyase.
Table 2. The effect of housing systems and genders on body weight and carcass characteristics of Beijing You chickens at 17 weeks of age.
Table 2. The effect of housing systems and genders on body weight and carcass characteristics of Beijing You chickens at 17 weeks of age.
TraitFemaleMale SEMGenderHousing
System
p-Value
CageFloorCageFloorFemaleMaleCageFloorHousing SystemGenderHousing System × Gender
Body weight
(kg)
1.361.341.841.890.031.35 b1.87 a1.601.620.51<0.0010.38
Carcass weight (kg)1.131.111.511.570.021.12 b1.54 a1.321.340.37<0.00010.13
Eviscerated weight (kg)0.780.781.071.110.020.78 b1.09 a0.920.940.23<0.00010.23
Breast muscle weight (g)125.35139.99175.28182.453.80132.67 b178.87 a150.31 b161.22 a<0.01<0.00010.32
Breast muscle yield (%)16.1918.0916.3416.460.3017.16 a16.40 b16.26 b17.28 a<0.010.01<0.01
Thigh muscle weight (g)184.27197.73267.69285.036.20191.00 b276.36 a225.98 b241.38 a0.01<0.00010.80
Thigh muscle yield (%)23.6625.4624.9825.720.4524.5625.3524.32 b25.59 a<0.010.080.23
Abdominal fat weight (g)53.3932.3928.4324.283.5642.35 a26.36 b40.91 a28.27 b<0.01<0.00010.03
Abdominal fat yield (%)6.333.902.562.040.335.13 a2.30 b4.45 a2.95 b<0.0001<0.00010.02
Subcutaneous fat thickness (mm)6.285.914.895.640.306.12 a 5.45 b5.595.780.590.030.06
a, b: the numbers in a row under the same main effect with different superscripts differed at p < 0.05; The average coefficient of determination (R2) for the traits in this table is 0.68.
Table 3. The effect of housing systems and genders on meat quality of Beijing You chickens at 17 weeks of age.
Table 3. The effect of housing systems and genders on meat quality of Beijing You chickens at 17 weeks of age.
TraitFemaleMale SEMGenderHousing
System
p-Value
CageFloorCageFloorFemaleMaleCageFloorHousing SystemGenderHousing System × Gender
PM muscle
pHi6.025.996.076.290.056.00 b6.18 a6.05 6.14 0.140.00820.05
pHu6.056.036.116.320.056.04 b6.22 a6.08 6.18 0.090.00280.04
Shear force (N)2.682.243.101.910.352.462.512.89 a 2.08 b 0.040.760.45
Drip loss (%)3.292.854.052.730.363.073.393.67 a 2.79 b 0.050.870.76
Meat color (L*)37.5137.9039.7734.130.9537.7136.9538.64 a 36.02 b 0.010.64<0.001
Meat color (a*)7.766.456.836.810.347.116.827.30 6.63 0.110.600.12
Meat color (b*)5.726.535.964.970.266.13 a5.47 b5.84 5.75 0.710.01<0.01
IMP (mg/g)4.974.734.374.360.144.854.364.67 4.55 0.400.060.43
IMF (%)4.412.943.011.850.183.68 a2.43 b3.71 a 2.40 b <0.0001<0.00010.39
BF muscle
pHi6.696.606.566.490.036.65 a 6.53 b 6.63 a 6.55 b <0.01 <0.0010.60
pHu6.706.546.576.470.036.62 a6.52 b6.64 a 6.51 b <0.001 <0.0010.22
Shear force (N)2.112.652.623.160.212.38 b2.89 a 2.37 b 2.91 a 0.010.020.99
Drip loss (%)4.574.582.702.860.454.58 a2.78 b 3.64 3.72 0.15<0.0010.05
Meat color (L*)33.9035.8531.7931.830.9734.88 a31.81 b32.85 33.84 0.450.020.40
Meat color (a*)10.888.7811.9410.620.479.83 b 11.28 a11.41 a 9.70 b 0.01<0.010.42
Meat color (b*)3.684.452.903.080.344.07 a2.99 b3.29 3.77 0.17<0.01 0.40
IMP (mg/g)3.003.063.303.100.093.033.203.15 3.08 0.460.080.33
IMF (%)10.667.369.027.290.349.01 a8.16 b9.84 a7.33 b <0.00010.020.01
PM: pectoralis major muscle; BF: biceps femoris muscle; pHi: the pH value of BF muscle measured 1 h after the slaughter; pHu: the pH value of PM muscle measured 24 h after the slaughter; a, b: the numbers in a row under the same main effect with different superscripts differed at p < 0.05; the average coefficient of determination (R2) for the traits in this table is 0.48; The meat color parameters L* for lightness, a* for redness, and b* for yellowness.
Table 4. The effect of housing systems and genders on PM muscle fiber composition of Beijing You chickens at 17 weeks of age.
Table 4. The effect of housing systems and genders on PM muscle fiber composition of Beijing You chickens at 17 weeks of age.
TraitFemaleMale SEMGenderHousing Systemp-Value
CageFloorCageFloorFemaleMaleCageFloorHousing SystemGenderHousing System × Gender
White muscle fiber
percentage in PM (%)
96.682.894.987.70.989.791.395.7 a85.3 b<0.0010.17<0.01
White muscle fiber
percentage in BF (%)
13.25.99.54.61.69.67.111.4 a5.3 b<0.010.170.54
PM: pectoralis major muscle; BF: biceps femoris muscle; a, b: the numbers in a row under the main effect with different superscripts differed at p < 0.05.
Table 5. The effect of housing systems and tissues on enzymes activity of male Beijing You chickens at 17 weeks of age.
Table 5. The effect of housing systems and tissues on enzymes activity of male Beijing You chickens at 17 weeks of age.
TraitCageFloor SEMTissueHousing
System
p-Value
PM
Muscle
BF
Muscle
PM
Muscle
BF
Muscle
PM
Muscle
BF
Muscle
CageFloorHousing SystemTissueHousing System × Tissue
Adenosinetriphosphatase (Na+ K+-ATPase), (U/mgprot)0.330.160.320.200.030.33 a0.18 b0.250.260.73<0.0010.52
Adenosinetriphosphatase (Ca2+Mg2+-ATPase) (U/mgprot)0.450.260.410.300.040.43 a0.28 b0.360.360.91<0.0010.28
Creatine kinase (U/mgprot)0.641.260.861.200.230.75 b1.23 a0.951.030.38<0.001<0.01
Adenosine deaminase (U/L)4.274.204.113.970.044.164.094.24.040.650.760.93
5′-nucleotidase
(U/L)
10.829.367.1910.392.239.019.8810.098.790.360.600.09
PM: pectoralis major muscle; BF: biceps femoris muscle; a, b: the numbers in a row under the same main effect with different superscripts differed at p-value < 0.05; the average coefficient of determination (R2) for the traits in this table is 0.40.
Table 6. The effect of housing systems and tissues on gene expression of male Beijing You chickens at 17 weeks of age.
Table 6. The effect of housing systems and tissues on gene expression of male Beijing You chickens at 17 weeks of age.
Gene
Name
CageFloor SEMTissueHousing
System
p-Value
PM
Muscle
BF
Muscle
PM
Muscle
BF
Muscle
PM
Muscle
BF
Muscle
CageFloorHousing SystemTissueHousing System × Tissue
H-FABP0.04800.42860.02830.42630.00680.0382 b0.4275 a 0.2383 0.2273 0.85<0.0010.91
HADH-β0.01660.18250.00830.11360.02510.0125 b 0.1481 a 0.1000 0.0610 0.33<0.0010.38
ACAA20.00340.16930.00130.10020.02040.0024 b 0.1348 a 0.0864 0.0508 0.24<0.0010.26
LPL0.00060.00160.00030.00080.00010.0005 b 0.0012 a 0.0011 a 0.0006 b 0.02<0.0010.40
ADSL0.01350.00130.01860.00410.00100.0161 a 0.0027 b 0.0074 0.0113 0.620.020.25
H-FABP: heart fatty acid-binding protein, HADH-β: hydroxyacyl-coenzyme a dehydrogenase β, ACAA2: acetyl-coenzyme A acyltransferase2, LPL: lipoprotein lipase, ADSL: adenylosuccinate lyase; PM: pectoralis major muscle; BF: biceps femoris muscle; a, b: the numbers in a row under the same main effect with different superscripts differed at p < 0.05; the average coefficient of determination (R2) for the traits in this table is 0.35.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, Y.; Liu, C.; Li, Y.; Li, D.; Shi, L.; Chen, J. Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens. Agriculture 2023, 13, 365. https://doi.org/10.3390/agriculture13020365

AMA Style

Sun Y, Liu C, Li Y, Li D, Shi L, Chen J. Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens. Agriculture. 2023; 13(2):365. https://doi.org/10.3390/agriculture13020365

Chicago/Turabian Style

Sun, Yanyan, Chen Liu, Yunlei Li, Dongli Li, Lei Shi, and Jilan Chen. 2023. "Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens" Agriculture 13, no. 2: 365. https://doi.org/10.3390/agriculture13020365

APA Style

Sun, Y., Liu, C., Li, Y., Li, D., Shi, L., & Chen, J. (2023). Effect of Cage and Floor Housing Systems on Muscle Fiber Characteristics, Carcass Characteristics, and Meat Quality of Slow-Growing Meat-Type Chickens. Agriculture, 13(2), 365. https://doi.org/10.3390/agriculture13020365

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop