Next Article in Journal
Virtual Fencing Technology for Cattle Management in the Pasture Feeding System—A Review
Next Article in Special Issue
DDIT3 Governs Milk Production Traits by Targeting IL-6 to Induce Apoptosis in Dairy Cattle
Previous Article in Journal
Relevance of Pyrolysis Products Derived from Sewage Sludge for Soil Applications
Previous Article in Special Issue
Progress of m6A Methylation in Lipid Metabolism in Humans and Animals
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China

1
Joint International Research Laboratory of Agriculture and Agri-Product Safety, Ministry of Education of China, Yangzhou University, Yangzhou 225009, China
2
International Joint Research Laboratory in Universities of Jiangsu Province of China for Domestic Animal Germplasm Resources and Genetic Improvement, Yangzhou University, Yangzhou 225009, China
3
College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China
*
Author to whom correspondence should be addressed.
Agriculture 2023, 13(1), 90; https://doi.org/10.3390/agriculture13010090
Submission received: 19 December 2022 / Revised: 25 December 2022 / Accepted: 27 December 2022 / Published: 29 December 2022
(This article belongs to the Special Issue Breeding, Genetics and Safety Production of Dairy Cattle)

Abstract

Bovine mastitis is often taken as one of the most common diseases in dairy farms, which its pathophysiology leads to a reduction of milk production and its quality. The penetration of pathogenic bacteria into the mammary gland, through either a contagious or environmental approach, has been determined the way of infection. The mastitis derived bacteria have become a challenge in practice, since the increasing exposure of antimicrobial. In order to identify characteristics of the epidemiological regulation and drug resistance of the pathogenic bacteria of bovine mastitis in northern Jiangsu, 156 clinical mastitis milk samples were collected from 3 large-scale farms for the epidemiological investigation and analysis of the drug resistance of E. coli. The bacteria were positively isolated in a total of 143 milk samples. The results showed that 78 strains of E. coli were detected, with a prevalence rate of 26.99%, followed by 67 strains of K. pneumoniae, with a prevalence of 23.19%, and 38 strains of Staphylococcus, with a prevalence of spp. 13.15%. In addition, 78 strains of E. coli isolated from bovine mastitis were tested for susceptibility to 8 kinds of antibiotics. It was shown that gentamicin and tetracycline were the most effective against E. coli, with the susceptibility rate of 83.3%, followed by streptomycin and ciprofloxacin, with 73.1% and 71.8% respectively. However, β-lactams including penicillin, cefothiophene, and amoxicillin showed serious resistance to E. coli isolates. There were 12 drug resistance genes detected by PCR, including β-lactam (blaTEM, blaCTX-M, and blaSHV), aminoglycoside (armA and armB), tetracycline (tetA, tetB, and tetC), and quinolone (qnrS, qepA, oqxA, and oqxB) related genes. Notably, all E. coli isolates carried blaTEM gene (100%). The detection rate of blaCTX-M was 53.8%, followed by the detection of blaSHV (20.5%), armA (9.0%), tetA (26.9%), tetB (2.6%), tetC (20.5%), qnrS (29.5%), oqxA (37.2%) and oqxB (1.3%). The present study provides crucial information on the distribution of bovine mastitis derived bacterial pathogens in Jiangsu province, as well as highlighting the antimicrobial resistance which might help to improve the efficiency of antibiotics treatment on bovine mastitis.

1. Introduction

Bovine mastitis is one of the diseases that cause great economic losses in the dairy industry [1,2]. It can lead to a decreased milk production, lowered milk quality, reproductive barriers, and a higher elimination rate [3]. The occurrence and development of mastitis over the past years appears to have changed, due to differences in the scales and management of the dairy farming industry, in China [4]. The pathogenic microorganisms that induce mastitis in dairy cows include bacteria, fungi, viruses, and mycoplasma, among which bacteria are the most important pathogens [4]. Mastitis derived pathogens can be divided into contagious pathogens and environmental pathogens [5]. The contagious pathogens include coagulase-negative Staphylococci, Streptococcus agalactiae, and Streptococcus dysgalactiae, which can be further spread among dairy cows through milking equipment and other means [6]. The environmental pathogens include Escherichia coli (E. coli), Streptococcus uberis, Klebsiella pneumoniae, and coagulase-negative Staphylococcus, which mainly exist in habitats such as soil, feces, and beds, and are transmitted mainly through udder contact [7].
Studies have shown that E. coli infection is usually characterized with persistence and a higher possibility of causing recurrent infections [5]. Moreover, the cases of cow mastitis caused by E. coli have shown an increasing trend in recent years [8]. As E. coli is an opportunistic pathogen widely present in the environment, it can cause human and animal infections with zoonotic diseases [9]. Currently, antibiotics are usually used to treat E. coli infected mastitis with better efficiency in animal husbandry and veterinary clinics. However, studies have shown that E. coli capable of developing broad-spectrum resistance to commonly used antibiotics, along with rapid variation [10]. For a long time, under selective pressure, the antibiotic resistance of E. coli continues to rise, which brings great challenges to the prevention and treatment of clinical upper colibacillosis [11]. Therefore, it is of great significance for the prevention and control of colibacillosis and public health to carry out the detection of pathogenic bacteria of bovine mastitis and the systematic detection of antibiotic resistance of E. coli from mastitis, as well as the resistance genes carried [12].
Although studies have recently focused on tackling antimicrobial resistance by designing alternative treatment regimens to antimicrobial, the discussion of issues and the emergence of resistance are still encouraged [13]. Among the factors involved in antimicrobial resistance, the bacterial status, including susceptibility and resistance, tolerance, persistence, and biofilm formation, are the main drivers of resistance outcome [14,15]. E. coli has many accessory genomes of plasmids and chromosome gene loci. In Beijing, China, 87.1% of the 70 E. coli isolates obtained from bovine mastitis cases were resistant to streptomycin, kanamycin, and ampicillin [16]. With the phenotypes of antibiotic resistance, the E. coli isolates are known as efficient reservoirs for resistant genes and are capable of transfering the genes among pathogenic bacteria [17]. The common harbored resistance genes for E. coli in America, mentioned in previous reports, are blaCTX-M, bla-TEM, ampC, tetA, tetB, sulI, and sulII [18,19]. Moreover, 5.3% of the isolates from bovine mastitis cases in Ningxia, China, were found to be carrying rmtB, bla-TEM1, and bla-CTX-M-15 which are related to β-lactams resistance [20]. More recently, we have characterized the phenotypic resistance of Klebsiella pneumonia isolated from clinical bovine mastitis in some parts of Jiangsu province [21]. As a result, isolates were found resistant to β-lactams including penicillin and amoxicillin, with the rates of 85.3% and 67.6%, respectively [21]. However, the phenotypic resistance of E. coli in northern Jiangsu province is rarely investigated. The objective of the current study is to underscore the prevalence of E. coli derived from bovine clinical mastitis, as well as investigate the phenotypes of the multi-drug resistant E. coli isolates, in Jiangsu province, China.

2. Materials and Methods

2.1. Isolation and Identification

A total of 156 samples were collected from the milk of dairy cows with clinical mastitis during July to October, in 2021. All strains isolated from the selected farms were in three regions (Xinyi, Sihong, and Huai’an) of Jiangsu Province in China. The milk samples were obtained from cows with clinical mastitis, diagnosed by using visible symptoms and testing with the California Mastitis Test (CMT), as officially recommended [22,23]. A volume of 100 μL of collected milk samples was plated onto a cultivation with blood agar (made with 5% freshly prepared whole blood, collected from sheep, and aerobically incubated at 37 °C for 24 h). By checking the morphology of the colonies, a single colony with identical morphology from each milk sample was then re-cultured by streaking on MacConkey (MC) agar, for purification. The sub-cultured bacteria were picked and amplified in Luria-Bertani (LB) broth at 37 °C for 24 h. The suspected isolates were further confirmed by PCR verification (Vazyme, Nanjing, China) with extracted genomic DNA from bacteria (Tiangen, Beijing, China), following 16S rDNA pyrosequencing (Tsingke., Ltd., Beijing, China), and sequences were proofread with SnapGene software (GSL Biotech, Chicago, IL, USA) [24]. Finally, the obtained sequences from the PCR products were analyzed using a BLAST sequence search, used for species identification, on the NCBI database. The confirmed isolates were stored in tubes containing 15% glycerol at −80 °C. The antimicrobial susceptibility of E. coli isolates was then determined using the Kirby–Bauer test and resistance gene detection.

2.2. Determination of Antimicrobial Susceptibility

The antimicrobial susceptibility was tested on a plate with Mueller–Hinton agar (MHA) by Kirby–Bauer (K-B) disk diffusion [25]. The 8 disks (Hangzhou Microbial Reagent Co., Hangzhou, China) used in the experiment were incubated with the following antibiotics: ciprofloxacin (CIP, 5 μg), streptomycin (STR, 10 μg), gentamycin (CN, 10 μg), tetracycline (TCY, 30 μg), cephalothin (KF, 30 μg), penicillin (PEN, 10 μg), amoxicillin (AML, 20 μg), and lincomycin (MY, 2 μg). The E. coli ATCC 25,922 strain was taken as the reference. The results of zone diameter for each disk were recorded as susceptible, intermedium, or resistant, on the basis of the interpretative standards of the Clinical and Laboratory Standards Institute [26]. When the recommended values for the antimicrobial disks were not available, following the manufacturer’s instructions was advised.

2.3. Resistance Gene Detection

The detection of 12 resistance genes positively carried in E. coli was determined using PCR assays on 78 isolated E. coli isolates used in this study, including blaTEM, blaCTX-M, blaSHV, armA, armB, tetA, tetB, tetC, qnrS, qepA, oqxA, and oqxB [27,28]. Primers used in the current study has been listed in Table 1. The PCR was performed as follows: denaturing at 94 °C for 5 min; then 35 cycles, at 94 °C for 30 s, corresponding to extension and annealing, for 30 s and 72 °C for 1 min, along with an additional elongation at 72 °C for 10 min. The reference strains of ATCC 25,922 were taken for PCRs as well. PCR amplicons were then verified by running gels with 1% agar and performing DNA sequencing (Tsingke, Beijing, China). Visualization of bands on the gel images was used to identify the presence of each targeted gene.

3. Results

3.1. Isolation of Bacterial from Bovine Clinical Mastitis

Among the 156 milk samples, 12 species of bacteria were identified. However, 13 milk samples showed no bacterial detection, due to the non-visible growth of colonies on the cultured plates. The detectable rate of bacterial pathogens from clinical mastitis was 91.67% (Table 2). The infected quarters of bovine mammary glands are usually contaminated with various pathogens and the incidence is becoming more complicated to manage. As shown in Table 3, out of 143 samples that were culture-positive, the infected patterns from those samples showed 1 species of bacteria in 44 samples (30.77%), 2 species of bacteria in 52 samples (36.36%), and 3 species of bacteria in 47 samples (32.87%). Of the 289 strains of bacteria isolated, 8 species with 220 strains were closely related to mastitis, with a total detection rate of 76.12%. Among 289 isolated strains, E. coli was the most frequently isolated (78 strains, 26.99%), followed by 67 strains of Klebsiella spp. (23.19%), 38 strains of Staphylococcus spp. (13.15%), 8 strains of Streptococcus agalactis (2.77%), 4 strains of Streptococcus uberis (1.38%), 3 strains of Streptococcus dysgalactiae (1.04%), and 2 strains of Pseudomonas aeruginosa (0.69%) (Figure 1).

3.2. Phenotypic Resistance of E. coli Isolated from Bovine Clinical Mastitis

As shown in Figure 2, E. coli strains isolated from cow mastitis in northern Jiangsu have developed resistance to the eight antibiotics used, to varying degrees, with the resistance rate ranging from 11.6–66.7%. The resistance of E. coli isolates to lincomycin was the most serious, with the resistance rate of 66.7%, followed by the resistance to β-lactams including penicillin, cefothiophene, and amoxicillin, with rates of 60.2%, 57.7% and 55.1%, respectively. In contrast, E. coli isolates were more sensitive to gentamicin, tetracycline, streptomycin, and ciprofloxacin than others tested, and the resistance rates were 16.7%, 11.6%, 26.9% and 26.9%, respectively.
E. coli isolates were found to be multi-drug resistant in farms of northern Jiangsu province. As shown in Figure 3, 22 strains were the most resistant to 5 antibiotics, accounting for 28.2%. Similarly, 16 strains resistant to an amount of 6 antibiotics, followed by 11 and 7 strains resistant to 1 and 2 antibiotics, respectively. However, only 2 strains appeared to be resistant to 4 or 7 antibiotics. Notably, major resistance to β-lactam drugs indicate that the isolated E. coli strains from bovine mastitis in northern Jiangsu are dominated by lactam drugs and are becoming relatively serious.

3.3. Genotypic Analysis of Antimicrobial-Resistance in Isolated E. coli Strains

According to the resistance phenotype of isolated E. coli to various antibiotics in this study, and the clinical use of antibiotics in the farms, 12 drug resistance genes related to four types of antibiotics were detected. The results are shown in Figure 4. For β-Lactams: 78 strains of E. coli have the detected blaTEM gene (100%). Moreover, nearly half of the E. coli carried the blaCTX-M gene, and had a detection rate of 53.8%. A total of 16 strains of E. coli had the detectable blaSHV gene, accounting for 20.5% of the total. For aminoglycoside: only 7 strains had the detectable armA gene: however, no armB gene was detected. For tetracyclines: The detection rates of tetA and tetC genes were 26.9% and 20.5% of the total isolates, respectively, and only two strains were detected with tetB gene. For quinolone: The detection rates of oqxA and qnrS genes were 37.2% and 29.5%, respectively. Only one E. coli strain was detected with the oqxB gene, but no strain carried the qepA gene. The detection rate of each drug resistance gene was not significantly different from the corresponding antibiotic resistance rate.

4. Discussion

In this study, 156 clinical mastitis milk samples collected from three dairy farms in Xinyi, Suqian, and Xuyi in northern Jiangsu were isolated and identified. The results showed that the pathogenic bacteria were mainly dominated by E. coli, Klebsiella spp., Staphylococcus spp., Staphylococcus aureus, Streptococcus agalactis, Streptococcus dysgalactiae, Streptococcus uberis, and Pseudomonas aeruginosa, and the detection rate of gram-negative bacteria was high. However, it has been reported in an earlier publication that the isolated bacteria from farms in Ningxia, China displayed different distributions of pathogens as compared to the current study [29]. The reason for the difference may be attributed to the sampling time and region, since the patterns of the infection for bovine mastitis are region specific. The sampling time in this study was from July to October, which was hot and humid. Cows are prone to heat stress, which will cause the decline of cow resistance, accelerate the growth and reproduction of bacteria, and impact mammary tissue. Therefore, this period is associated with a high incidence of clinical mastitis in cows. During the sampling and investigation, it was also found that although these farms are large-scale between each other, the environmental sanitation, milking methods, and other feeding management aspects of these farms in northern Jiangsu still need to be improved. This is indicative that external factors such as farm management have an important impact on the induction of cow mastitis and its infection types. In addition, of 143 milk samples shown to be bacteria positive, 99 had mixed infection, accounting for 69.23% of the total samples. The variety of bacterial pathogens isolated further indicates that the environmental sanitation and feeding management of these dairy farms need to be improved. Attention should be paid to the timely cleaning of urine and feces during the rainy season, and the regular disinfection of the environment, to prohibit the growth of environmentally derived pathogens such as E. coli.
E. coli is one of the main pathogens that cause bovine mastitis. However, due to the increased incidence of antibiotic resistant bacterial infections, the effect of antibiotic treatment is becoming limited. By comparing and analyzing the drug susceptibility of 78 E. coli strains from bovine mastitis, we found that at present, coliform bacteria from bovine mastitis in northern Jiangsu Province is highly resistant to β- Lactam antibiotics. However, the susceptibility of the coliforms to tetracycline and gentamicin are still maintained. By referring to relevant data, we found that E. coli from bovine mastitis in some regions of China, maintained high resistance to β-Lactam antibiotics, which is consistent to the current research. As reported in a previous study, the main pathogenic bacteria isolated from three farms in Jiangsu Province was tested for drug susceptibility, where almost all isolates of E. coli were shown to be resistant to penicillin, ampicillin, and lincomycin, but sensitive to gentamycin, ciprofloxacin, and streptomycin [30]. It has been reported that E. coli from dairy cows in Henan Province showed the highest drug resistance rate of β-lactam antibiotics, followed by the resistance of ampicillin sodium, cefotaxime, and ceftiofur, which exceeded 60%. In contrast, a more comprehensive study revealed that 75 (22.9%) out of 328 E. coli isolates were confirmed as quinolone-resistant, in a nationwide sampling investigation [8]. However, E. coli from bovine mastitis in Tianjin and Ningxia areas has low sensitivity to streptomycin, which is inconsistent with the current study [31]. During the sampling, we noticed that lincomycin, penicillin, and cephalosporin are routine drugs used in farms, which also explains why E. coli from bovine mastitis in northern Jiangsu province is highly resistant to these antibiotics. In addition, 26.9% of the 78 strains of E. coli isolated in the present study were resistant to quinolone (ciprofloxacin), which was much higher than the data collected from developed countries. The prevalence of quinolone resistant E. coli in bovine mastitis cases reported by Finland, Canada, and the United States were 0.7% and 0.0%, respectively [32,33]. It is speculated that the widespread addition of quinolones in the animal feeding diet is related to the high drug resistance rate of quinolones in China [34].
The resistance genes can be horizontally transferred by inserting sequence, plasmids, transposons, integrons, bacteriophages, and other movable genetic elements [35]. Extended-Spectrum β-Lactamases (ESBLs) producing enzymes are important factors for the resistance of E. coli to cephalosporins, of which blaCTX-M has the highest prevalent gene in ESBL pathogens. It has been evidenced that more than half of the 70 E. coli strains were found to be blaCTX-M positive in four regions of China’s farms, which was consistent with the results of this study [10]. The efflux pump is determined as the main drug resistance mechanism of tetracyclines [36]. The predominant genes tetA and tetB are in charge of the resistance of E. coli to tetracyclines, in which the current study detected tetA (26.9%) and tetB (2.6%) in tetracycline-resistant strains, which further proved the conclusion. Quinolones are effective antibacterial agents for the treatment of various infections caused by E. coli. Unfortunately, due to the widespread use of quinolone drugs, the number of quinolone resistant E. coli, derived from animals produced for food in China has increased [36,37,38]. Multiple mutations that cause amino acid changes in the targeted enzyme related to the quinolone resistance determining region (QRDR) is the most common mechanism of high-level resistance of clinical strains to quinolones [38]. In addition, the common resistance of β-lactam and quinolone drugs is a common phenomenon, due to the presence of β-lactamases and the substitution mutations in QRDR, regardless of whether the plasmid mediated quinolone resistance (PMQR) gene is present [39]. In this study, 21 ciprofloxacin resistant strains were all resistant to β-lactam, including penicillin, amoxicillin, and cefothiophene, which further confirmed this theory.
Collectively, the dominant pathogens causing bovine mastitis in 3 dairy farms in northern Jiangsu are E. coli and K. pneumoniae, which provides an experimental basis for the prevention and treatment of bovine mastitis and clinical medication. Among them, the resistance of isolated E. coli to β-lactams was the most serious in the selected farms. The detection rate of resistance genes blaTEM (100%) and blaCTX-M (53.8%) was high, which was consistent with the β-lactam drug resistance phenotype. Our study highlights the distribution and characteristics of pathogenic E. coli derived from bovine mastitis, and provides reference of antimicrobial selection for the treatment.

Author Contributions

Z.Y. and T.X. performed study concept and design; W.C., Y.H. and T.X. performed experiment and writing, review of the paper; T.X., J.Z. and X.W. provided acquisition and interpretation of data; Z.Y. and W.C. provided material. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (32102731). the Open Project Program of Joint International Research Laboratory of Agriculture and Agri-Product Safety, the Ministry of Education of China, Yangzhou University (JILAR-KF202204). The Open Project Program of International Joint Research Laboratory in Universities of Jiangsu Province Of China for Domestic Animal Germplasm Resources and Genetic Improvement: (IJRLD-KF202214).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

We appreciate the support of the milk sample provisions from the dairy farms located in the 3 correlated farms.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bar, D.; Tauer, L.W.; Bennett, G.; González, R.; Hertl, J.A.; Schukken, Y.H.; Schulte, H.F.; Welcome, F.L.; Gröhn, Y.T. The cost of generic clinical mastitis in dairy cows as estimated by using dynamic programming. J. Dairy Sci. 2008, 91, 2205–2214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Hertl, J.A.; Groehn, Y.T.; Leach, J.; Bar, D.; Bennett, G.J.; Gonzalez, R.N.; Rauch, B.J.; Welcome, F.L.; Tauer, L.W.; Schukken, Y.H. Effects of clinical mastitis caused by gram-positive and gram-negative bacteria and other organisms on the probability of conception in New York State Holstein dairy cows. J. Dairy Sci. 2010, 93, 1551–1560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Gao, J.; Barkema, H.W.; Zhang, L.; Liu, G.; Deng, Z.; Cai, L.; Shan, R.; Zhang, S.; Zou, J.; Kastelic, J.P. Incidence of clinical mastitis and distribution of pathogens on large Chinese dairy farms. J. Dairy Sci. 2017, 100, 4797–4806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. He, W.; Ma, S.; Lei, L.; He, J.; Li, X.; Tao, J.; Wang, X.; Song, S.; Wang, Y.; Wu, C.; et al. Prevalence, etiology, and economic impact of clinical mastitis on large dairy farms in China—ScienceDirect. Vet. Microbiol. 2020, 242, 108570. [Google Scholar] [CrossRef] [Scilit]
  5. Zhao, X.; Lacasse, P. Mammary tissue damage during mastitis: Causes and controls. J. Dairy Sci. 2005, 88, 2. [Google Scholar]
  6. Esener, N.; Green, M.J.; Emes, R.D.; Jowett, B.; Davies, P.L.; Bradley, A.J.; Dottorini, T. Discrimination of contagious and environmental strains of Streptococcus uberis in dairy herds by means of mass spectrometry and machine-learning. Sci. Rep. 2018, 8, 17517. [Google Scholar] [CrossRef] [Scilit]
  7. White, D.G.; Zhao, S.; Simjee, S.; Wagner, D.D.; McDermott, P.F. Antimicrobial resistance of foodborne pathogens. Microbes Infect. 2002, 4, 405–412. [Google Scholar] [CrossRef] [Scilit]
  8. Yang, F.; Zhang, S.; Shang, X.; Wang, L.; Li, H.; Wang, X. Characteristics of quinolone-resistant Escherichia coli isolated from bovine mastitis in China. J. Dairy Sci. 2018, 101, 6244–6252. [Google Scholar] [CrossRef] [Scilit]
  9. Blanco, M.; Blanco, J.E.; Mora, A.; Dahbi, G.; Bernárdez, M. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae-xi). J. Clin. Microbiol. 2004, 42, 645. [Google Scholar] [CrossRef] [Scilit]
  10. Yu, Z.N.; Wang, J.; Ho, H.; Wang, Y.T.; Huang, S.N.; Han, R.W. Prevalence and antimicrobial-resistance phenotypes and genotypes of Escherichia coli isolated from raw milk samples from mastitis cases in four regions of China. J. Glob. Antimicrob. Resist. 2020, 22, 94–101. [Google Scholar] [CrossRef] [Scilit]
  11. Bradley, A.J.; Green, M.J. Adaptation of Escherichia coli to the Bovine Mammary Gland. J. Clin. Microbiol. 2001, 39, 1845–1849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Li, J.; Xie, S.; Ahmed, S.; Wang, F.; Gu, Y.; Zhang, C.; Chai, X.; Wu, Y.; Cai, J.; Cheng, G. Antimicrobial Activity and Resistance: Influencing Factors. Front. Pharmacol. 2017, 8, 364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Xu, T.; Zhu, H.; Liu, R.; Wu, X.; Chang, G.; Yang, Y.; Yang, Z. The protective role of caffeic acid on bovine mammary epithelial cells and the inhibition of growth and biofilm formation of Gram-negative bacteria isolated from clinical mastitis milk. Front. Immunol. 2022, 13, 1005430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Tyerman, J.G.; Ponciano, J.M.; Joyce, P.; Forney, L.J.; Harmon, L.J. The evolution of antibiotic susceptibility and resistance during the formation of Escherichia colibiofilms in the absence of antibiotics. BMC Evol. Biol. 2013, 13, 22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Gędas, A.; Olszewska, M.A. Chapter 1—Biofilm formation and resistance. In Recent Trends in Biofilm Science and Technology; Simoes, M., Borges, A., Chaves Simoes, L., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 1–21. [Google Scholar]
  16. Liu, Y.; Liu, G.; Liu, W.; Liu, Y.; Ali, T.; Chen, W.; Yin, J.; Han, B. Phylogenetic group, virulence factors and antimicrobial resistance of Escherichia coli associated with bovine mastitis. Res. Microbiol. 2014, 165, 273–277. [Google Scholar] [CrossRef] [Scilit]
  17. Hayer, S.S.; Lim, S.; Hong, S.L.; Elnekave, E.; Alvarez, J. Genetic determinants of extended spectrum cephalosporin and fluoroquinolone resistance in Escherichia coli isolated from diseased pigs in the U.S.A. mSphere 2020, 5, 920–990. [Google Scholar] [CrossRef] [Scilit]
  18. Srinivasan, V.; Gillespie, B.E.; Lewis, M.J.; Nguyen, L.T.; Headrick, S.I.; Schukken, Y.H.; Oliver, S.P. Phenotypic and genotypic antimicrobial resistance patterns of Escherichia coli isolated from dairy cows with mastitis. Vet. Microbiol. 2007, 124, 319–328. [Google Scholar] [CrossRef] [Scilit]
  19. López Meza, J.E.; Higuera Ramos, J.E.; Ochoa Zarzosa, A.; Chassin Noria, O.; Valdez Alarcón, J.J.; Bravo Patiño, A.; Baizabal Aguirre, V.M. Molecular characterization of Staphylococcus spp. isolates associated with bovine mastitis in Tarímbaro, Michoacán, Mexico. Técnica Pecu. México 2006, 44, 91–106. [Google Scholar]
  20. Yu, T.; He, T.; Yao, H.; Zhang, J.B.; Wang, G.Q. Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China. Foodborne Pathog. Dis. 2015, 12, 770–777. [Google Scholar] [CrossRef] [Scilit]
  21. Xu, T.; Wu, X.; Cao, H.; Pei, T.; Zhou, Y.; Yang, Y.; Yang, Z. The Characteristics of Multilocus Sequence Typing, Virulence Genes and Drug Resistance of Klebsiella pneumoniae Isolated from Cattle in Northern Jiangsu, China. Animals 2022, 12, 2627. [Google Scholar] [CrossRef] [Scilit]
  22. Hogan, J.S.; Gonzalez, R.N.; Harmon, R.J.; Nickerson, S.C.; Smith, K.L. Laboratory Handbook on Bovine Mastitis; National Mastitis Council: Madison, WI, USA, 1999. [Google Scholar]
  23. Blum, S.; Heller, E.D.; Krifucks, O.; Sela, S.; Hammer-Muntz, O.; Leitner, G. Identification of a bovine mastitis Escherichia coli subset. Vet. Microbiol. 2008, 132, 135–148. [Google Scholar] [CrossRef] [Scilit]
  24. Frank, J.A.; Reich, C.I.; Sharma, S.; Weisbaum, J.S.; Wilson, B.A.; Olsen, G.J. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 2008, 74, 2461–2470. [Google Scholar] [CrossRef] [Scilit]
  25. Ceriotti, F.; Zakowski, J.; Sine, H.; Altaie, S.; Horowitz, G.; Pesce, A.J.; Boyd, J.; Horn, P.; Gard, U.; Horowitz, G. Clinical and Laboratory Standards Institute (CLSI). 2012. Available online: https://www.scienceopen.com/document?vid=1d021ccc-8583-4e6b-a47c-8735734df154 (accessed on 1 December 2022).
  26. CLSI. Performance Standards for Antimicrobial Susceptibility Testing, M100, 31st ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2021. [Google Scholar]
  27. Turton, J.F.; Perry, C.; Elgohari, S.; Hampton, C.V. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J. Med. Microbiol. 2010, 59, 541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Yu, W.L.; Ko, W.C.; Cheng, K.C.; Lee, C.C.; Lai, C.C.; Chuang, Y.C. Comparison of prevalence of virulence factors for Klebsiella pneumoniae liver abscesses between isolates with capsular K1/K2 and non-K1/K2 serotypes. Diagn. Microbiol. Infect. Dis. 2008, 62, 1–6. [Google Scholar] [CrossRef] [Scilit]
  29. Dong, W.; Fawan, L.; Xuqing, W.; Jianbo, W.; Jianming, P.; Linjun, D.; Junhong, L.; Dengqiang, H. Isolation and identification of mastitis pathogens in dairy cows from some areas of Ningxia. Prograss Vet. Med. Chin. 2012, 33, 4. [Google Scholar] [CrossRef]
  30. Dan, W.; Feng, Y.; Xinpu, L.; Jinyin, L.; Longhai, L.; Zhe, Z.; Yaru, Z.; Hongsheng, L. Isolation, identification and drug resistance detection of the pathogenic bacteria causing dairy cow mastitis in Suzhou and capsular polysaccharide typing test of the pathogens. Chin. J. Prev. Vet. Med. 2018, 40, 7. [Google Scholar] [CrossRef]
  31. Qian, S.; Juyun, D.; Yina, L.; Jinlian, S.; Zongshuai, L.; Xingxu, Z.; Yong, Z. Isolation, Identification and Drug Resistance Analysis of Main Pathogens ofDairy Cow Clinical Mastitis in Wuzhong Area of Ningxia. Prog. Veterianry Med. Chin. 2022, 43, 6. [Google Scholar]
  32. Saini, V.; Mcclure, J.T.; Léger, D.; Keefe, G.P.; Scholl, D.T.; Morck, D.W.; Barkema, H.W. Antimicrobial resistance profiles of common mastitis pathogens on Canadian dairy farms. J. Dairy Sci. 2012, 95, 4319–4332. [Google Scholar] [CrossRef] [Scilit]
  33. Metzger, S.A.; Hogan, J.S. Short communication: Antimicrobial susceptibility and frequency of resistance genes in Escherichia coli isolated from bovine mastitis. J. Dairy Sci. 2013, 96, 3044–3049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Xiao, Y.H.; Giske, C.G.; Wei, Z.Q.; Shen, P.; Heddini, A.; Li, L.J. Epidemiology and characteristics of antimicrobial resistance in China. Drug Resist. Updates 2011, 14, 236–250. [Google Scholar] [CrossRef] [Scilit]
  35. Zhang, S.; Abbas, M.; Rehman, M.U.; Wang, M.; Jia, R.; Chen, S.; Liu, M.; Zhu, D.; Zhao, X.; Gao, Q.; et al. Updates on the global dissemination of colistin-resistant Escherichia coli: An emerging threat to public health. Sci. Total Environ. 2021, 799, 149280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Neela, F.A.; Nonaka, L.; Rahman, M.H.; Suzuki, S. Transfer of the chromosomally encoded tetracycline resistance gene tet(M) from marine bacteria to Escherichia coli and Enterococcus faecalis. World J. Microbiol. Biotechnol. 2009, 25, 1095–1101. [Google Scholar] [CrossRef] [Scilit]
  37. Wang, G.Q.; Wu, C.M.; Du, X.D.; Shen, Z.Q.; Song, L.H.; Chen, X.; Shen, J.Z. Characterization of integrons-mediated antimicrobial resistance among Escherichia coli strains isolated from bovine mastitis. Vet. Microbiol. 2008, 127, 73–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Zhao, H.X.; Zhao, J.L.; Shen, J.Z.; Fan, H.L.; Guan, H.; An, X.P.; Li, P.F. Prevalence and molecular characterization of fluoroquinolone resistance in Escherichia coli isolates from dairy cattle with endometritis in China. Microb. Drug Resist. 2014, 20, 162–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Bajaj, P.; Kanaujia, P.K.; Singh, N.S.; Sharma, S.; Kumar, S.; Virdi, J.S. Quinolone co-resistance in ESBL- or AmpC-producing Escherichia coli from an Indian urban aquatic environment and their public health implications. Environ. Sci. Pollut. Res. Int. 2016, 23, 1954–1959. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Analysis of 289 strains of pathogenic bacteria of bovine mastitis. All isolates were obtained and identified through bacterial isolation, purification, and 16S rDNA identification.
Figure 1. Analysis of 289 strains of pathogenic bacteria of bovine mastitis. All isolates were obtained and identified through bacterial isolation, purification, and 16S rDNA identification.
Agriculture 13 00090 g001
Figure 2. Phenotypic drug-resistance proportions of E. coli. All the 78 isolates of E. coli were analyzed with 8 antimicrobial agents. The bars in green, yellow, and red indicate the antimicrobial’s susceptibility with susceptible, intermediate, and resistant, respectively.
Figure 2. Phenotypic drug-resistance proportions of E. coli. All the 78 isolates of E. coli were analyzed with 8 antimicrobial agents. The bars in green, yellow, and red indicate the antimicrobial’s susceptibility with susceptible, intermediate, and resistant, respectively.
Agriculture 13 00090 g002
Figure 3. Multidrug Resistance of 78 E. coli strains to 8 Antibiotics. All 78 E. coli isolates were collected and analyzed for multi-drug resistance with tetracycline, ciprofloxacin, streptomycin, gentamycin, lincomycin, cefothiophene, amoxicilin, and penicillin.
Figure 3. Multidrug Resistance of 78 E. coli strains to 8 Antibiotics. All 78 E. coli isolates were collected and analyzed for multi-drug resistance with tetracycline, ciprofloxacin, streptomycin, gentamycin, lincomycin, cefothiophene, amoxicilin, and penicillin.
Agriculture 13 00090 g003
Figure 4. Detection of drug-resistant genes in E. coli. PCR was performed to identify the carriage of β-lactam (blaTEM, blaCTX-M, and blaSHV), aminoglycoside (armA and armB), tetracycline (tetA, tetB, and tetC), and quinolone (qnrS, qepA, oqxA, and oqxB) related genes in 78 E. coli isolates.
Figure 4. Detection of drug-resistant genes in E. coli. PCR was performed to identify the carriage of β-lactam (blaTEM, blaCTX-M, and blaSHV), aminoglycoside (armA and armB), tetracycline (tetA, tetB, and tetC), and quinolone (qnrS, qepA, oqxA, and oqxB) related genes in 78 E. coli isolates.
Agriculture 13 00090 g004
Table 1. Primers designed for the PCR assay.
Table 1. Primers designed for the PCR assay.
GenesPrimers (5′-3′)Annealing (°C)Products (bp)
blaTEMF: TCGCCGCATACACTATTCTCAGAATGA50445
R: ACGCTCACCGGCTCCAGATTTAT
blaCTX-MF: ATGTGCAGACCAGTAAGTATGGC57593
R: TGGGTAATAGTACCAGAACAG
blaSHVF: ATGCGTTATATTCGCCTGTG57747
R: TGCTTTGTTATTCGGGCCAA
armAF: GGGTCTTACTATTCTGCCTAT50503
R: ATTCCCTTCTCCTTTCCAG
armBF: TTTCTGCGGGCGATGTAA57523
R: AGTTCTGTTCCGATGGTCTTT
tetAF: GCTACATCCTGCTTGCCTTC60210
R: CATAGATCGCCGTGAAGAGG
tetBF: TTGGTTAGGGGCAAGTTTTG60659
R: GTAATGGGCCAATAACACCG
tetCF: CTTGAGACCTTCAACCCAG60418
R: ATGGTCGTCATCTACCTGCC
qnrSF: ACATAAAGACTTAAGTGATC52619
R: CAATTAGTCAGGATAAAC
qepAF: CCAGCTCGGCAACTTGATAC60570
R: ATGCTCGCCTTCCAGAAAA
oqxAF: CTCGGCGCGATGATGCT57392
R: CCACTCTTCACGGGAGACGA
oqxBF: TTCTCCCCCGGCGGGAAGTAC64512
R: CTCGGCCATTTTGGCGCGTA
16SrDNATTCGGACCTCACGCTATCA62824
GAAGGCACCAA TCCATCTC
Table 2. Isolation of 156 clinical mastitis milk samples.
Table 2. Isolation of 156 clinical mastitis milk samples.
ItemsPositive IsolatesNegative IsolatesTotal Isolates
Samples (No.)14313156
Ratio (%)91.678.33100
Table 3. Pathogen infection pattern of 143 positive isolation.
Table 3. Pathogen infection pattern of 143 positive isolation.
ItemsSingle IsolatesDouble IsolatesTriple IsolatesTotal Isolates
Samples (No.)445247143
Ratio (%)30.7736.3632.87100
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, T.; Cao, W.; Huang, Y.; Zhao, J.; Wu, X.; Yang, Z. The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China. Agriculture 2023, 13, 90. https://doi.org/10.3390/agriculture13010090

AMA Style

Xu T, Cao W, Huang Y, Zhao J, Wu X, Yang Z. The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China. Agriculture. 2023; 13(1):90. https://doi.org/10.3390/agriculture13010090

Chicago/Turabian Style

Xu, Tianle, Wendi Cao, Yicai Huang, Jingwen Zhao, Xinyue Wu, and Zhangping Yang. 2023. "The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China" Agriculture 13, no. 1: 90. https://doi.org/10.3390/agriculture13010090

APA Style

Xu, T., Cao, W., Huang, Y., Zhao, J., Wu, X., & Yang, Z. (2023). The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China. Agriculture, 13(1), 90. https://doi.org/10.3390/agriculture13010090

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop