The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Identification
2.2. Determination of Antimicrobial Susceptibility
2.3. Resistance Gene Detection
3. Results
3.1. Isolation of Bacterial from Bovine Clinical Mastitis
3.2. Phenotypic Resistance of E. coli Isolated from Bovine Clinical Mastitis
3.3. Genotypic Analysis of Antimicrobial-Resistance in Isolated E. coli Strains
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bar, D.; Tauer, L.W.; Bennett, G.; González, R.; Hertl, J.A.; Schukken, Y.H.; Schulte, H.F.; Welcome, F.L.; Gröhn, Y.T. The cost of generic clinical mastitis in dairy cows as estimated by using dynamic programming. J. Dairy Sci. 2008, 91, 2205–2214. [Google Scholar] [CrossRef] [PubMed]
- Hertl, J.A.; Groehn, Y.T.; Leach, J.; Bar, D.; Bennett, G.J.; Gonzalez, R.N.; Rauch, B.J.; Welcome, F.L.; Tauer, L.W.; Schukken, Y.H. Effects of clinical mastitis caused by gram-positive and gram-negative bacteria and other organisms on the probability of conception in New York State Holstein dairy cows. J. Dairy Sci. 2010, 93, 1551–1560. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Barkema, H.W.; Zhang, L.; Liu, G.; Deng, Z.; Cai, L.; Shan, R.; Zhang, S.; Zou, J.; Kastelic, J.P. Incidence of clinical mastitis and distribution of pathogens on large Chinese dairy farms. J. Dairy Sci. 2017, 100, 4797–4806. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Ma, S.; Lei, L.; He, J.; Li, X.; Tao, J.; Wang, X.; Song, S.; Wang, Y.; Wu, C.; et al. Prevalence, etiology, and economic impact of clinical mastitis on large dairy farms in China—ScienceDirect. Vet. Microbiol. 2020, 242, 108570. [Google Scholar] [CrossRef]
- Zhao, X.; Lacasse, P. Mammary tissue damage during mastitis: Causes and controls. J. Dairy Sci. 2005, 88, 2. [Google Scholar]
- Esener, N.; Green, M.J.; Emes, R.D.; Jowett, B.; Davies, P.L.; Bradley, A.J.; Dottorini, T. Discrimination of contagious and environmental strains of Streptococcus uberis in dairy herds by means of mass spectrometry and machine-learning. Sci. Rep. 2018, 8, 17517. [Google Scholar] [CrossRef]
- White, D.G.; Zhao, S.; Simjee, S.; Wagner, D.D.; McDermott, P.F. Antimicrobial resistance of foodborne pathogens. Microbes Infect. 2002, 4, 405–412. [Google Scholar] [CrossRef]
- Yang, F.; Zhang, S.; Shang, X.; Wang, L.; Li, H.; Wang, X. Characteristics of quinolone-resistant Escherichia coli isolated from bovine mastitis in China. J. Dairy Sci. 2018, 101, 6244–6252. [Google Scholar] [CrossRef]
- Blanco, M.; Blanco, J.E.; Mora, A.; Dahbi, G.; Bernárdez, M. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae-xi). J. Clin. Microbiol. 2004, 42, 645. [Google Scholar] [CrossRef]
- Yu, Z.N.; Wang, J.; Ho, H.; Wang, Y.T.; Huang, S.N.; Han, R.W. Prevalence and antimicrobial-resistance phenotypes and genotypes of Escherichia coli isolated from raw milk samples from mastitis cases in four regions of China. J. Glob. Antimicrob. Resist. 2020, 22, 94–101. [Google Scholar] [CrossRef]
- Bradley, A.J.; Green, M.J. Adaptation of Escherichia coli to the Bovine Mammary Gland. J. Clin. Microbiol. 2001, 39, 1845–1849. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Xie, S.; Ahmed, S.; Wang, F.; Gu, Y.; Zhang, C.; Chai, X.; Wu, Y.; Cai, J.; Cheng, G. Antimicrobial Activity and Resistance: Influencing Factors. Front. Pharmacol. 2017, 8, 364. [Google Scholar] [CrossRef] [PubMed]
- Xu, T.; Zhu, H.; Liu, R.; Wu, X.; Chang, G.; Yang, Y.; Yang, Z. The protective role of caffeic acid on bovine mammary epithelial cells and the inhibition of growth and biofilm formation of Gram-negative bacteria isolated from clinical mastitis milk. Front. Immunol. 2022, 13, 1005430. [Google Scholar] [CrossRef] [PubMed]
- Tyerman, J.G.; Ponciano, J.M.; Joyce, P.; Forney, L.J.; Harmon, L.J. The evolution of antibiotic susceptibility and resistance during the formation of Escherichia colibiofilms in the absence of antibiotics. BMC Evol. Biol. 2013, 13, 22. [Google Scholar] [CrossRef] [PubMed]
- Gędas, A.; Olszewska, M.A. Chapter 1—Biofilm formation and resistance. In Recent Trends in Biofilm Science and Technology; Simoes, M., Borges, A., Chaves Simoes, L., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 1–21. [Google Scholar]
- Liu, Y.; Liu, G.; Liu, W.; Liu, Y.; Ali, T.; Chen, W.; Yin, J.; Han, B. Phylogenetic group, virulence factors and antimicrobial resistance of Escherichia coli associated with bovine mastitis. Res. Microbiol. 2014, 165, 273–277. [Google Scholar] [CrossRef]
- Hayer, S.S.; Lim, S.; Hong, S.L.; Elnekave, E.; Alvarez, J. Genetic determinants of extended spectrum cephalosporin and fluoroquinolone resistance in Escherichia coli isolated from diseased pigs in the U.S.A. mSphere 2020, 5, 920–990. [Google Scholar] [CrossRef]
- Srinivasan, V.; Gillespie, B.E.; Lewis, M.J.; Nguyen, L.T.; Headrick, S.I.; Schukken, Y.H.; Oliver, S.P. Phenotypic and genotypic antimicrobial resistance patterns of Escherichia coli isolated from dairy cows with mastitis. Vet. Microbiol. 2007, 124, 319–328. [Google Scholar] [CrossRef]
- López Meza, J.E.; Higuera Ramos, J.E.; Ochoa Zarzosa, A.; Chassin Noria, O.; Valdez Alarcón, J.J.; Bravo Patiño, A.; Baizabal Aguirre, V.M. Molecular characterization of Staphylococcus spp. isolates associated with bovine mastitis in Tarímbaro, Michoacán, Mexico. Técnica Pecu. México 2006, 44, 91–106. [Google Scholar]
- Yu, T.; He, T.; Yao, H.; Zhang, J.B.; Wang, G.Q. Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China. Foodborne Pathog. Dis. 2015, 12, 770–777. [Google Scholar] [CrossRef]
- Xu, T.; Wu, X.; Cao, H.; Pei, T.; Zhou, Y.; Yang, Y.; Yang, Z. The Characteristics of Multilocus Sequence Typing, Virulence Genes and Drug Resistance of Klebsiella pneumoniae Isolated from Cattle in Northern Jiangsu, China. Animals 2022, 12, 2627. [Google Scholar] [CrossRef]
- Hogan, J.S.; Gonzalez, R.N.; Harmon, R.J.; Nickerson, S.C.; Smith, K.L. Laboratory Handbook on Bovine Mastitis; National Mastitis Council: Madison, WI, USA, 1999. [Google Scholar]
- Blum, S.; Heller, E.D.; Krifucks, O.; Sela, S.; Hammer-Muntz, O.; Leitner, G. Identification of a bovine mastitis Escherichia coli subset. Vet. Microbiol. 2008, 132, 135–148. [Google Scholar] [CrossRef]
- Frank, J.A.; Reich, C.I.; Sharma, S.; Weisbaum, J.S.; Wilson, B.A.; Olsen, G.J. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 2008, 74, 2461–2470. [Google Scholar] [CrossRef]
- Ceriotti, F.; Zakowski, J.; Sine, H.; Altaie, S.; Horowitz, G.; Pesce, A.J.; Boyd, J.; Horn, P.; Gard, U.; Horowitz, G. Clinical and Laboratory Standards Institute (CLSI). 2012. Available online: https://www.scienceopen.com/document?vid=1d021ccc-8583-4e6b-a47c-8735734df154 (accessed on 1 December 2022).
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, M100, 31st ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2021. [Google Scholar]
- Turton, J.F.; Perry, C.; Elgohari, S.; Hampton, C.V. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J. Med. Microbiol. 2010, 59, 541. [Google Scholar] [CrossRef] [PubMed]
- Yu, W.L.; Ko, W.C.; Cheng, K.C.; Lee, C.C.; Lai, C.C.; Chuang, Y.C. Comparison of prevalence of virulence factors for Klebsiella pneumoniae liver abscesses between isolates with capsular K1/K2 and non-K1/K2 serotypes. Diagn. Microbiol. Infect. Dis. 2008, 62, 1–6. [Google Scholar] [CrossRef]
- Dong, W.; Fawan, L.; Xuqing, W.; Jianbo, W.; Jianming, P.; Linjun, D.; Junhong, L.; Dengqiang, H. Isolation and identification of mastitis pathogens in dairy cows from some areas of Ningxia. Prograss Vet. Med. Chin. 2012, 33, 4. [Google Scholar] [CrossRef]
- Dan, W.; Feng, Y.; Xinpu, L.; Jinyin, L.; Longhai, L.; Zhe, Z.; Yaru, Z.; Hongsheng, L. Isolation, identification and drug resistance detection of the pathogenic bacteria causing dairy cow mastitis in Suzhou and capsular polysaccharide typing test of the pathogens. Chin. J. Prev. Vet. Med. 2018, 40, 7. [Google Scholar] [CrossRef]
- Qian, S.; Juyun, D.; Yina, L.; Jinlian, S.; Zongshuai, L.; Xingxu, Z.; Yong, Z. Isolation, Identification and Drug Resistance Analysis of Main Pathogens ofDairy Cow Clinical Mastitis in Wuzhong Area of Ningxia. Prog. Veterianry Med. Chin. 2022, 43, 6. [Google Scholar]
- Saini, V.; Mcclure, J.T.; Léger, D.; Keefe, G.P.; Scholl, D.T.; Morck, D.W.; Barkema, H.W. Antimicrobial resistance profiles of common mastitis pathogens on Canadian dairy farms. J. Dairy Sci. 2012, 95, 4319–4332. [Google Scholar] [CrossRef]
- Metzger, S.A.; Hogan, J.S. Short communication: Antimicrobial susceptibility and frequency of resistance genes in Escherichia coli isolated from bovine mastitis. J. Dairy Sci. 2013, 96, 3044–3049. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.H.; Giske, C.G.; Wei, Z.Q.; Shen, P.; Heddini, A.; Li, L.J. Epidemiology and characteristics of antimicrobial resistance in China. Drug Resist. Updates 2011, 14, 236–250. [Google Scholar] [CrossRef]
- Zhang, S.; Abbas, M.; Rehman, M.U.; Wang, M.; Jia, R.; Chen, S.; Liu, M.; Zhu, D.; Zhao, X.; Gao, Q.; et al. Updates on the global dissemination of colistin-resistant Escherichia coli: An emerging threat to public health. Sci. Total Environ. 2021, 799, 149280. [Google Scholar] [CrossRef] [PubMed]
- Neela, F.A.; Nonaka, L.; Rahman, M.H.; Suzuki, S. Transfer of the chromosomally encoded tetracycline resistance gene tet(M) from marine bacteria to Escherichia coli and Enterococcus faecalis. World J. Microbiol. Biotechnol. 2009, 25, 1095–1101. [Google Scholar] [CrossRef]
- Wang, G.Q.; Wu, C.M.; Du, X.D.; Shen, Z.Q.; Song, L.H.; Chen, X.; Shen, J.Z. Characterization of integrons-mediated antimicrobial resistance among Escherichia coli strains isolated from bovine mastitis. Vet. Microbiol. 2008, 127, 73–78. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.X.; Zhao, J.L.; Shen, J.Z.; Fan, H.L.; Guan, H.; An, X.P.; Li, P.F. Prevalence and molecular characterization of fluoroquinolone resistance in Escherichia coli isolates from dairy cattle with endometritis in China. Microb. Drug Resist. 2014, 20, 162–169. [Google Scholar] [CrossRef] [PubMed]
- Bajaj, P.; Kanaujia, P.K.; Singh, N.S.; Sharma, S.; Kumar, S.; Virdi, J.S. Quinolone co-resistance in ESBL- or AmpC-producing Escherichia coli from an Indian urban aquatic environment and their public health implications. Environ. Sci. Pollut. Res. Int. 2016, 23, 1954–1959. [Google Scholar] [CrossRef]
Genes | Primers (5′-3′) | Annealing (°C) | Products (bp) |
---|---|---|---|
blaTEM | F: TCGCCGCATACACTATTCTCAGAATGA | 50 | 445 |
R: ACGCTCACCGGCTCCAGATTTAT | |||
blaCTX-M | F: ATGTGCAGACCAGTAAGTATGGC | 57 | 593 |
R: TGGGTAATAGTACCAGAACAG | |||
blaSHV | F: ATGCGTTATATTCGCCTGTG | 57 | 747 |
R: TGCTTTGTTATTCGGGCCAA | |||
armA | F: GGGTCTTACTATTCTGCCTAT | 50 | 503 |
R: ATTCCCTTCTCCTTTCCAG | |||
armB | F: TTTCTGCGGGCGATGTAA | 57 | 523 |
R: AGTTCTGTTCCGATGGTCTTT | |||
tetA | F: GCTACATCCTGCTTGCCTTC | 60 | 210 |
R: CATAGATCGCCGTGAAGAGG | |||
tetB | F: TTGGTTAGGGGCAAGTTTTG | 60 | 659 |
R: GTAATGGGCCAATAACACCG | |||
tetC | F: CTTGAGACCTTCAACCCAG | 60 | 418 |
R: ATGGTCGTCATCTACCTGCC | |||
qnrS | F: ACATAAAGACTTAAGTGATC | 52 | 619 |
R: CAATTAGTCAGGATAAAC | |||
qepA | F: CCAGCTCGGCAACTTGATAC | 60 | 570 |
R: ATGCTCGCCTTCCAGAAAA | |||
oqxA | F: CTCGGCGCGATGATGCT | 57 | 392 |
R: CCACTCTTCACGGGAGACGA | |||
oqxB | F: TTCTCCCCCGGCGGGAAGTAC | 64 | 512 |
R: CTCGGCCATTTTGGCGCGTA | |||
16SrDNA | TTCGGACCTCACGCTATCA | 62 | 824 |
GAAGGCACCAA TCCATCTC |
Items | Positive Isolates | Negative Isolates | Total Isolates |
---|---|---|---|
Samples (No.) | 143 | 13 | 156 |
Ratio (%) | 91.67 | 8.33 | 100 |
Items | Single Isolates | Double Isolates | Triple Isolates | Total Isolates |
---|---|---|---|---|
Samples (No.) | 44 | 52 | 47 | 143 |
Ratio (%) | 30.77 | 36.36 | 32.87 | 100 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, T.; Cao, W.; Huang, Y.; Zhao, J.; Wu, X.; Yang, Z. The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China. Agriculture 2023, 13, 90. https://doi.org/10.3390/agriculture13010090
Xu T, Cao W, Huang Y, Zhao J, Wu X, Yang Z. The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China. Agriculture. 2023; 13(1):90. https://doi.org/10.3390/agriculture13010090
Chicago/Turabian StyleXu, Tianle, Wendi Cao, Yicai Huang, Jingwen Zhao, Xinyue Wu, and Zhangping Yang. 2023. "The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China" Agriculture 13, no. 1: 90. https://doi.org/10.3390/agriculture13010090
APA StyleXu, T., Cao, W., Huang, Y., Zhao, J., Wu, X., & Yang, Z. (2023). The Prevalence of Escherichia coli Derived from Bovine Clinical Mastitis and Distribution of Resistance to Antimicrobials in Part of Jiangsu Province, China. Agriculture, 13(1), 90. https://doi.org/10.3390/agriculture13010090