Next Article in Journal
Identification of Selection Preferences and Predicting Yield Related Traits in Sugarcane Seedling Families Using RGB Spectral Indices
Next Article in Special Issue
Reproductive Biology Factors Hampering Lemon [Citrus limon (L.) Burm. f.] Genetic Improvement
Previous Article in Journal
A Review of Research Progress on Soil Organic Cover Machinery in China
Previous Article in Special Issue
Identification of the Citrus Superoxide Dismutase Family and Their Roles in Response to Phytohormones and Citrus Bacterial Canker
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification, In Silico Analysis and Expression Profiling of SWEET Gene Family in Loquat (Eriobotrya japonica Lindl.)

1
College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
State Key Laboratory of Ecological Pest Control for Fujian and Taiwan Crops, College of Plant Protection, Fujian Agriculture and Forestry University, Fuzhou 350002, China
3
Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture & Forestry Sciences, Huazhong Agricultural University, Wuhan 430070, China
4
Department of Horticulture, Faculty of Agricultural Sciences and Technology, Bahauddin Zakariya University, Multan 66000, Pakistan
5
Department of Horticulture, College of Agriculture, University of Al-Azhar (Branch Assiut), Assiut 71524, Egypt
6
Plant Production Department, Faculty of Agriculture Saba Basha, Alexandria University, Alexandria 21531, Egypt
*
Authors to whom correspondence should be addressed.
Agriculture 2022, 12(9), 1312; https://doi.org/10.3390/agriculture12091312
Submission received: 7 July 2022 / Revised: 23 August 2022 / Accepted: 23 August 2022 / Published: 26 August 2022
(This article belongs to the Special Issue Breeding, Genetics, and Genomics of Fruit Crops)

Abstract

SWEETs (sugars will eventually be exported transporters) have various physiological and biochemical roles in plant growth, including pollen development, seed nourishment, nectar secretion, and longer-distance sugar transportation. The SWEET genes were identified in various plant species, but they have not yet been thoroughly characterized. Here, we discovered 21 putative SWEET genes from the Eriobotrya japonica Lindl. genome. For further elucidation, comprehensive bioinformatics analysis was utilized to determine the physicochemical properties, gene organization, conserved motifs, cis-regulatory elements, gene duplication, and phylogenetic relationships of EjSWEET genes. Most of the SWEET proteins were predicted to be located on the plasma membrane or vacuole. Gene organization and motif analysis showed that the numbers of exons and motifs in each gene ranged strikingly, between 5 and 6 and between 5 and 8, respectively. Synteny analysis showed that the tandem or segmental duplication played a dynamic role in the evolution of SWEET genes in loquat. Likewise, we analyzed the expression patterns of EjSWEET genes in the root, stem, leaf, flower, and fruit of loquat. Some genes exhibited varying expression in loquat tissues, indicating their potential roles in plant development. The relative expression levels of EjSWEET1, EjSWEET3, and EjSWEET16 were noticeably higher in ripened fruits, suggesting their possible role in the transportation and unloading of sugars in fruits. The present study provides initial genome-wide identification and characterization of the SWEET gene family in loquat and lays the foundation for their further functional analysis.

1. Introduction

Sugars are primarily produced in response to the photosynthetic process, which is a prerequisite for the maintenance of the plant growth cycle, plant signaling, molecule transportation, and energy storage carbon skeletons [1]. Synthesized sugars from leaves are then needed to be transported into different plant tissues (seeds, roots, and fruits) to fulfil sufficient plant growth [2,3,4,5,6]; such transportation and cellular exchange of sugars are undertaken mainly by three major sugar transporter families specifically, SWEETs (sugars will eventually be exported transporters), sucrose transporters (SUTs), and monosaccharide transporters (MSTs) [7]. These transporters are now widely known for sugar facilitation into several plant tissues upon source to sink demand, therefore keenly regulating plant growth and fruit quality [1,7,8,9].
Among the sugar transporters, SUTs and MSTs are major facilitator super-families that are characterized by 12 transmembrane domains [8,9,10]. Additionally, recently acknowledged SWEET proteins for sugar transportation which belong to the MtN3/saliva family (PF03083) regulate selective efflux for disaccharides or monosaccharides between intracellular membranes [3,7,11,12]. SWEET family proteins were characterized for several plant and animal species as well as prokaryotes [13,14]; SWEET proteins from eukaryotes are predicted to be tandem repeats of two 3-α-helical transmembrane (TM) domains (having two conserved MtN3/saliva motifs) and separated by a less conserved single TM [12]. SWEET proteins identified in prokaryotes (also called as SemiSWEETs) hold only a single 3-TM, reflecting that evolution for SWEETs in eukaryotes was undertaken via duplication and fusion of the basic 3-TM unit that exists in prokaryote SemiSWEETs [12].
In recent years, several pieces of evidence linked to SWEETs have shown that they are involved in plant biochemical and physiological process regulation; in maintaining sugar supply and demand for longer-distance sugar transportation, pollen nourishment, and nectar secretion; and in response to pathological stress [3,7,15]. In Arabidopsis thaliana, two genes localized at the plasma membrane, named AtSWEET11 and AtSWEET12, are responsible for the exportation of sucrose from phloem parenchyma cells into the apoplast [16]. AtSWEET9 was reported to directly influence the production of nectar and additionally work as a transporter of sucrose [17]. Moreover, AtSWEET5, also known as VEX1, is noticed to be expressed during the development of pollen [18]; AtSWEET8, also known as RPG1, is highly expressed in the male tapetum as well as microspores during meiosis [19]; and AtSWEET13, also known as RPG2, is noticed to have more expression in plant anther tissues [20].
Similar studies in rice also observed higher expression of OsSWEET5 in anthers [21]. A significant role of SWEETs was also observed in seeds; genes SWEET11, SWEET12, and SWEET15 from A. thaliana were expressed spatiotemporally throughout seed development, while seed defects were only observed in a triple knockout mutant, causing seed wrinkling in mature seeds [22,23]. Other defects include retarded embryo development, reduced seed weight, and lesser starch and lipid contents [24]. In comparison to Arabidopsis, genes OsSWEET4 in rice and ZmSWEET4c in maize are responsible for seed filling as well as hexose transportation across the basal endosperm transfer layer [25]. In addition, pathogen interactions also alter the expression pattern of SWEETs, which is modified according to their needs for carbohydrates to complete their growth cycle [26,27,28,29,30]. SWEETs were studied in many species at genomic and protein levels, mainly in rice and Arabidopsis. Besides providing a better understanding, studies have shown that SWEET genes may cover extensive functional divergence in plants [31].
Loquat (Eriobotrya japonica Lindl.) is an evergreen fruit tree that originated from China [32]. It belongs to the family Rosaceae, subfamily Maloideae [33]. It is a rich source of vitamin A, vitamin B6, potassium, magnesium, and dietary fiber [34,35]. It is most widely grown in Japan, Korea, India, Pakistan, and the south-central region of China [36]. The availability of the loquat (Eriobotrya japonica Lindl.) genome published by Jiang et al. [37] facilitated genomic, proteomic, and functional studies. To expand our knowledge of the SWEET gene family in loquat, we systematically identified 21 SWEETs and further investigated their phylogenetic relationship, subcellular localization, gene duplication, and expression patterns. This investigation helped us to understand the evolutionary patterns and roles of SWEETs in loquat growth and development, including sugar transport in different plant tissues.

2. Materials and Methods

2.1. Identification and Characterization of EjSWEET Genes

In order to identify the SWEET genes in loquat, we explored the corresponding Eriobotrya japonica Lindl. Genome Project from the GigaScience Database (http://gigadb.org/dataset/view/id/100711, accessed on 22 December 2020) [37]. For phylogenetic analysis, the apple genome sequence [38] was acquired from the Phytozome website (http://phytozome.jgi.doe.gov/pz/portal.html, accessed on 16 June 2021) and the genome sequences of Arabidopsis thaliana were downloaded from the Arabidopsis Information Resource (TAIR) (http://www.arabidopsis.org/, accessed on 22 December 2020). Arabidopsis SWEET genes were deployed as a query sequence to run BLAST against the genome databases of the species as mentioned above. Additionally, using the HMMER3 software package, the seed alignment file for the MtN3/saliva domain (PF03083) was retrieved from the Pfam database [39]. HMMER software suite was then used to run HMM searches against the local protein databases of the species as mentioned above [40].
Furthermore, we evaluated the physical locations of all putative SWEET genes and ruled out redundant sequence repeats with the same chromosome location. Additionally, all retrieved SWEET protein sequences were re-analyzed in the Pfam database using the SMART programs (http://smart.embl-heidelberg.de, accessed on 22 January 2022) to identify the presence of the MtN3/saliva domain. The protein sequences that lacked the MtN3/saliva domain were discarded. ExPASy Proteomics Server (http://web.expasy.org/compute_pi/, accessed on 25 January 2022) was used to determine the physicochemical characteristics of EjSWEET proteins. The subcellular localization of EjSWEETs was predicted using the WoLF PSORT web server (https://wolfpsort.hgc.jp/, accessed on 25 January 2022).

2.2. Gene Structure, Conserved Motif, and Promoter Region Analyses of EjSWEET Genes

The exon–intron structure of EjSWEET genes was identified by aligning coding sequences with the respective genomic sequences. TBtools software package (v0.6655) was used to generate diagrams [41]. The MEME suite server (http://meme-suite.org/, accessed on 25 January 2022) was used to identify conserved motifs in the sequences of SWEET genes. The following parameters were set up: maximum numbers of different motifs, 10; minimum width, 10; maximum width, 50. The promoter region analysis was carried out through the online PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 28 January 2025) and illustrated using TBtools software package v0.6655 [41].

2.3. Chromosomal Mapping and Syntenic Analysis of SWEETs in Loquat

Using Tbtools (v0.6655), a gff3-file of the E. japonica genome was employed to evaluate the distribution and mapping of EjSWEET genes on all chromosomes [41]. The MCScanX software was used to identify the duplicated SWEET genes in the loquat genome [42]. BLASTP was used to compare all of the protein sequences from loquat (http://www.ncbi.nlm.nih.gov/blast/blast.cgi, accessed on 14 February 2022) with an e-value less than 1 × 10−5. With default settings, the BLASTP outputs with gene-location files were processed as input for MCScanX to identify syntenic gene pairs and duplication types.

2.4. Ka and Ks Calculation

The values of Ka (nonsynonymous) and Ks (synonymous) of syntenic gene pairs were annotated using MCScanX downstream analysis tools. Briefly, Ka and Ks were calculated using KaKs_Calculator (v2.0) with the Nei–Gojobori (NG) method [43,44].

2.5. Multiple Sequence Alignment and Phylogenetic Analysis

Molecular Evolutionary Genetics Analysis X (MEGA-X v10.2.6) was used to perform phylogenetic and molecular evolutionary genetics studies [45]. Multiple sequence alignment was conducted with MEGA-X (default settings) using Multiple Sequence Caparison by Log-Expectation (MUSCLE). The conserved or similar amino acid sequences were highlighted with GeneDoc (v2.7). The neighbor-joining (NJ) approach was used to generate different SWEET trees with a bootstrap of 1000 repetitions, p-distance, and pairwise deletion using MEGA-X.

2.6. Plant Sampling, RNA Isolation, and Quantitative RT-PCR Analysis

The plant tissues were sampled from 10-year-old loquat trees of the Jiefangzhong cultivar growing in a private orchard located in Fuqing county, Fujian province, China. Total RNA was isolated from root, stem, mature leaf, full-bloom flower, and ripened fruit of loquat using a Total RNA kit (TianGen Biotech, Beijing, China). A NanoDrop N-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and agarose gel electrophoresis were used to assess the quantity and quality of RNA. The first-strand cDNA was synthesized from 1 µg RNA using Prime Script RT Reagent Kit with a gDNA Eraser (TaKaRa, Dalian, China). Quantitative RT-PCR analysis was carried out using high-performance real-time PCR (LightCycler 96, Roche Applied Science, Penzberg, Germany). The 2−ΔΔCT method was used to calculate the relative expression levels of EjSWEET genes with 3 biological and 3 technical replicates. An actin gene (EVM0004523.1) described in previous studies [43,46,47] was selected as a constitutive control, and all the primers used for qRT-PCR are listed in Table 1.

2.7. Statistical Analysis

The obtained qRT-PCR data were statistically analyzed through one-way ANOVA using the software “Statistix v8.1”. The relative expression levels of EjSWEET genes in different tissues of loquat were compared using Fisher’s LSD technique.

3. Results

3.1. Identification and Characterization of EjSWEET Genes in Loquat

In total, 21 EjSWEET genes were identified in the E. japonica genome, and the members of the EjSWEET gene family were named EjSWEET1 to EjSWEET21 based on their positions on 17 chromosomes. Table 2 shows detailed information about gene location on chromosomes and the peptide and CDS sequence lengths of EjSWEETs.
The specific physicochemical properties of EjSWEET genes are shown in Table 3. The protein length of 21 EjSWEET genes was estimated between 232 to 295 amino acids, and the maximum and minimum molecular weights were 33.08 and 25.35 kDa, respectively. The lowest isoelectric point value (4.93) was recorded in EjSWEET6, and the isoelectric point of EjSWEET4 was the highest (9.77). The GRAVY values of all proteins were predicted to be more than 0, indicating their hydrophobic nature. The GRAVY values of EjSWEETs were found to be between 0.502 and 0.992. Additionally, SWEET proteins showed an instability index from 24.63 to 48.15, and the aliphatic index was also found to be from 98.97 to 135.64.

3.2. Protein Conserved Domain, Subcellular Localization, and Gene Structural Analysis of EjSWEET Genes

Conserved domain analysis showed that all EjSWEET genes contained two MtN3/saliva domains, except EjSWEET9 and EjSWEET14. Two genes, EjSWEET9 and EjSWEET14, also contained another domain of the DUF2070 superfamily (Figure S1). Most of the EjSWEET genes were predicted to be positioned in the vacuole and plasma membrane, and a few genes were positioned in mitochondria, chloroplasts, and endoplasmic reticulum (Figure 1A). The structural analysis of EjSWEET genes indicated that all EjSWEET genes contained six exons, except EjSWEET11 and EjSWEET17 (Figure 1B). They contained only five exons and four introns.

3.3. Phylogenetic and Conserved Motif Analysis of EjSWEET Genes

The phylogenetic relationship of 21 EjSWEET genes was constructed by MEGA-X. The EjSWEET genes were divided into three subgroups, according to the similarity level between them. By utilizing online servers of MEME, the distribution of conserved motifs for EjSWEETs was thoroughly assessed; a range of five to eight presumed conserved motifs was acknowledged among EjSWEET proteins. Figure 2 indicates that the EjSWEETs present in all three groups of phylogenetic analysis (A–C) exhibited similarity in their motifs’ organization and composition. The EjSWEETs present in phylogenetic groups A, B, and C showed 7–8, 6–7, and 5–6 motifs. Thus, it can be assumed that during the evolutionary process, EjSWEETs evidently exhibited extreme conservation.

3.4. Chromosomal Mapping and Syntenic Analysis of EjSWEET Genes

The chromosomal mapping of 21 EjSWEET genes is displayed in Figure 3A. Among these genes, four genes (EjSWEET1, EjSWEET2, EjSWEET3, and EjSWEET4) are positioned on Chromosome 1, three genes (EjSWEET5, EjSWEET6, and EjSWEET7) are on Chromosome 2, one gene (EjSWEET8) is on Chromosome 3, one gene (EjSWEET9) is on Chromosome 4, two genes (EjSWEET10 and EjSWEET11) are on Chromosome 6, one gene (EjSWEET12) is on Chromosome 8, three genes (EjSWEET13, EjSWEET14, and EjSWEET15) are on Chromosome 12, one gene (EjSWEET16) is on Chromosome 13, three genes (EjSWEET17, EjSWEET18, and EjSWEET19) are on Chromosome 14, and two genes (EjSWEET20 and EjSWEET21) are on Chromosome 16.
The syntenic analysis of the EjSWEET genes showed that there are two pairs of tandemly repeated sequences (EjSWEET13 and EjSWEET15, EjSWEET20 and EjSWEET21), among the 21 EjSWEET genes (Figure 3B). Meanwhile, the major duplication was observed as “whole-genome (WGD) or segmental-duplication”. We found six pairs of WGD repeated genes (EjSWEET1 and EjSWEET5, EjSWEET2 and EjSWEET6, EjSWEET4 and EjSWEET7, EjSWEET8 and EjSWEET19, EjSWEET9 and EjSWEET14, EjSWEET11 and EjSWEET17).
To further analyze whether these tandem or segmental repeated genes are under selection pressure during evolution, we calculated the Ka and Ks values of these genes [48]. The analysis results show that the Ka/Ks values of these EjSWEET sequences are less than 1 (Table 4), indicating that these genes have undergone purifying selection during the evolution process.

3.5. Analysis of Cis-Acting Regulatory Elements in EjSWEET Promoter Region

To further understand the transcription process of EjSWEET genes, 1000 bp of the upstream region of EjSWEETs were analyzed. The promoter area of EjSWEETs contains a large number of cis-acting elements, mainly divided into four types: light-response-related component type, hormone-response-related component type, stress-response-related component type, and component type of plant growth and development (Figure 4). Several growth-hormone-related cis-elements (i.e., GARE, SARE, AuRE, MeJA, AARE) which regulate different hormones, i.e., gibberellins, methyl jasmonate, salicylic acid, abscisic acid, and auxins, were identified in the promoter regions of EjSWEETs. In addition, low temperature stress response cis-element LTR was also identified in several genes. The LRE was found as a light-responsive cis-element. Apart from the aforementioned cis-elements, circadian was also identified in two EjSWEET genes, having a role in circadian control.

3.6. Multiple Sequence Alignment of EjSWEET Proteins

Sequence alignment revealed that the five motifs were relatively conserved (Figure 5). Furthermore, there were two possible serine phosphorylation sites located on the inner side of the Motif 2 area. However, Motifs 1 and 2 started after alanine. In Motif 1, glycine was highly conserved with isoleucine and asparagine. In addition, leucine, proline, threonine, phenylalanine, and tyrosine were also found highly conserved in Motif 1. Phosphorylation can occur for all of these amino acids but not for alanine. Valine, isoleucine, threonine, and serine were found highly conserved in the case of Motif 2. Motif 3 showed the conservation of phenylalanine and asparagine. Arginine and glutamine were the only amino acid bases conserved in all EjSWEET proteins in Motif 4 and Motif 5, respectively.

3.7. Phylogenetic Analysis of the EjSWEET Genes in Eriobotrya Japonica, Malus Domestica, and Arabidopsis Thaliana

The phylogenetic tree of 63 SWEET genes (21 for Eriobotrya japonica, 25 for Malus domestica, and 17 for Arabidopsis thaliana) was constructed by MEGA-X. These proteins were divided into three groups (A–C) based on their sequence similarity (Figure 6), and the 21 EjSWEET genes were distributed into three groups. Among the EjSWEET gene family, groups A, B, and C contained 11, 6, and 4 genes, respectively.
The grouping results of the integrated phylogenetic tree were basically consistent with the phylogenetic tree based on the EjSWEET protein sequences. According to the results of conserved motifs, the same subgroup has a similar number and type of conserved motifs, which further verifies the grouping results of the phylogenetic tree (Figure 2). In addition, the number and types of conserved motifs and protein conserved domains of groups B and C are significantly less than those of group A.

3.8. Expression Profiling of EjSWEET Genes in Different Tissues of Loquat

Different tissues from loquat were selected for expression profile analysis among 21 SWEET genes, including mature leaves, stems, roots, flowers, and fruits (Figure 7). All genes exhibited significantly different expression levels among different plant tissues. Among 21 loquat SWEETs, 12 genes (EjSWEET1, EjSWEET2, EjSWEET5, EjSWEET7, EjSWEET8, EjSWEET9, EjSWEET11, EjSWEET14, EjSWEET17, EjSWEET19, EjSWEET20, and EjSWEET21) were maximally expressed in full-bloom flowers of loquat, while ripened fruits exhibited the maximum expression of 3 genes, i.e., EjSWEET1, EjSWEET3, and EjSWEET16. Similarly, EjSWEET4, EjSWEET10, EjSWEET15, and EjSWEET18 were maximally expressed in loquat stem, while loquat leaves showed maximum transcript levels of EjSWEET3, EjSWEET6, and EjSWEET15. The expression level of EjSWEET13 was recorded maximum in loquat roots, among all other examined tissues.

4. Discussion

SWEET proteins are widely distributed in plant species and have a basic contribution to numerous processes during the life cycle of the plant [7,13,14,17,24]. To date, studies about the genomic and functional characterization of SWEET genes have only been conducted in a few species, including Arabidopsis, rice, tomato, soybean, and cucumber [11,14,31,49,50,51]. Meanwhile, except for apple, no systematic investigation had been conducted for the SWEET gene family in Rosaceae species until now [52]. Following a combination of available analytical techniques, we identified 21 EjSWEET genes in terms of their gene structure, chromosome distribution, phylogeny, cis-acting regulatory elements, domain architecture, and expression profiles among different tissues of loquat.
As every organism went through evolution, it is proposed that tandem and WGD/segmental duplication both play an integral role in gene duplication and the evolutionary process [46]. Likewise, recently it was suggested that SWEETs also underwent gene duplication during the evolution of rice [49] and soybean [14]. We also found that two pairs of EjSWEETs (EjSWEET13 and EjSWEET15, EjSWEET20 and EjSWEET21) were regarded as tandem duplication (Figure 3). The cis-elements available in promotor regions of EjSWEETs were also investigated, giving at least one cis-element responsible for hormone regulation, and may be integral for corresponding hormone regulation within loquat (Figure 4). Other plant species, e.g., cucumber and rice, were also reported to have tandem duplications among SWEET genes [49,50]. Conserved regions in SWEET proteins could be important for their basic functioning in plants [50]. We also found a relatively conserved region among 21 identified gene sequences in loquat. Moreover, on the inner side of Motif 2 proteins, we observed two possible serine phosphorylation sites (Figure 5), suggesting that EjSWEET proteins may exhibit key functions in regulating reversible dephosphorylation/phosphorylation, controlled by protein phosphatase/kinase [53]. Such outcomes might be a breakthrough for SWEET gene family functional analysis in loquat.
The phylogenetic tree of SWEET genes of loquat, apple, and Arabidopsis was constructed, and these genes were divided into three groups based on their sequence similarity (Figure 6). A similar grouping has been reported earlier when SWEET genes were identified in apple [52,54]. The selection of the apple genome for phylogenetic analysis was due to its similarity with the genome of loquat [37,55]. SWEET genes are well known for their diversified functional regulation throughout the plant life cycle. Though functional characterization of loquat SWEET genes has not been performed yet, there is a high possibility they are likely to have similar features to rice and Arabidopsis SWEET genes. Previously, Arabidopsis and rice SWEET genes were found to be associated with the development of reproductive tissues [11,13,19,56,57]. In such relation, expression profiles were analyzed among different tissues of the loquat SWEET family, and 11 genes showed higher relative expression in flowers (Figure 7), implying that most of the EjSWEET genes may be closely associated with growth and development of reproductive tissues. Paralogs from the SWEET gene family within different species could have functional redundancy or precisely regulate the plant life cycle throughout key developmental stages. Hence, in order to keenly study the functional profiles of SWEET genes, further comprehensive analyses are required, while our experimental outcomes provide a foundation for future studies.
In model plant species, Arabidopsis and rice, sucrose is known as the main form of carbohydrates circulated via phloem sap upon sink requirements. For the transportation of photoassimilates, such as sugars, from leaves to sink organs, phloem loading is the basic step in terms of longer-distance sugar transport [58]. In A. thaliana, two genes localized at the plasma membrane, named AtSWEET11 and AtSWEET12, are responsible for the exportation of sucrose from phloem parenchyma cells to the apoplast [16]. Besides sucrose transportation, raffinose family oligosaccharides (RFOs) are also translocated as primary carbohydrates in many plant species [59,60]. In plants exhibiting RFO transportation, an extensive symplasmic pathway known as a polymer trap is followed for phloem loading [58]; it mechanizes sucrose diffusion into intermediary cells from the mesophyll symplasm, as sucrose molecules are smaller than RFOs and are apparently unable to diffuse back to the mesophyll through plasmodesmata intermediary cells [58,61]. In current study, EjSWEET3, EjSWEET6, and EjSWEET15 exhibited a relatively higher expression in loquat leaves (Figure 7), indicating their possible involvement in RFO transport. Chen et al. [24] also identified the role of the AtSWEET2 gene, as it was to be involved in glucose accumulation in the root and leaf tonoplast of Arabidopsis. The genes EjSWEET3, EjSWEET6, and EjSWEET15 may not directly regulate the phloem loading, but they are noticeably involved in monosaccharide regulation in loquat leaves, having a significant impact on carbon allocation as well as flux transportation between heterotrophic plant tissues. However, specific functional studies still need to be conducted.
Sucrose and hexoses (glucose and fructose) are major sugars found in fruits and plant stems of loquat [36], which suggests that sucrose is translocated into the fruit [5]. Following the apoplastic pathway, sucrose is unloaded from the phloem into the fruits of loquat [62]. Cell wall invertase (cwINV) is subsequently important for sucrose hydrolysis to form hexoses, which are then taken into fruit parenchyma cells for storage via hexose transporters (HT3) [63]. Still, the process contains several unanswered questions; for example, there is an unknown key transporter that exports sucrose from sieve companion cell complexes into apoplastic spaces, and fructose transportation taking place from the cleavage of sucrose in the apoplast remains unclear because HT3 could be a key facilitator only for glucose intake, not fructose [63,64]. We observed that some SWEET genes such as EjSWEET1, EjSWEET3, and EjSWEET16 have higher expression levels in loquat fruits (Figure 7), suggesting their possible role in the transportation and unloading of sugars into fruits for sink storage. Nevertheless, additional experimentations are required to keenly determine the basic functions of SWEET genes for sugar regulation during the fruit development of loquat, as they could be major facilitators for not only sucrose but also fructose and glucose [11,65]. Additionally, SWEET genes were identified and expressed in some fruiting species such as apple [52], tomato [66], and sweet orange [67], but their particular contribution remains unclear.

5. Conclusions

In the present study, 21 putative SWEET genes were identified in the loquat genome, and a comprehensive genome-wide in silico analysis was performed in terms of their possible characteristics, including subcellular localization, gene organization, chromosomal distribution, synteny, phylogeny, multiple sequence alignment, conserved motifs, and cis-regulatory elements in promoter regions. In addition, their relative expression levels were examined in different tissues of loquat. The results revealed the basic understanding of EjSWEET genes and may also facilitate future research that may elucidate the detailed roles of SWEET genes in loquat and other Rosaceae crops.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture12091312/s1, Figure S1: The conserved domain analysis of EjSWEETs; Table S1: The gene IDs of apple and Arabidopsis SWEET genes.

Author Contributions

Conceptualization, B.L., M.M.A. and F.C.; methodology, B.L., M.M.A. and T.G.; software, M.M.A. and S.M.A.; validation, J.I., A.F.Y. and W.F.A.M.; investigation, F.C.; resources, F.C.; data curation, M.M.A.; writing—original draft preparation, B.L. and M.M.A.; writing—review and editing, T.G., S.M.A., S.G., J.I., A.F.Y. and W.F.A.M.; visualization, M.M.A.; supervision, F.C.; project administration, F.C.; funding acquisition, F.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was sponsored by “Fujian Provincial Development and Reform Commission, grant number 2013-772” and “Key Laboratory of Loquat Germplasm Innovation and Utilization, Fujian Province University (Putian), grant number 2019001”.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

Authors are thankful to Songfeng Ma for his technical support during qRT-PCR analysis.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, L.-Q.; Cheung, L.S.; Feng, L.; Tanner, W.; Frommer, W.B. Transport of Sugars. Annu. Rev. Biochem. 2015, 84, 865–894. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Sadat-Hosseini, M.; Bakhtiarizadeh, M.R.; Boroomand, N.; Tohidfar, M.; Vahdati, K. Combining independent de novo assemblies to optimize leaf transcriptome of Persian walnut. PLoS ONE 2020, 15, e0232005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Chen, L. SWEET sugar transporters for phloem transport and pathogen nutrition. New Phytol. 2014, 201, 1150–1155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Lalonde, S.; Wipf, D.; Frommer, W.B. Transport mechanisms for organic forms of carbon and nitrogen between source and sink. Annu. Rev. Plant Biol. 2004, 55, 341–372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Yu, X.; Ali, M.M.; Li, B.; Fang, T.; Chen, F. Transcriptome data-based identification of candidate genes involved in metabolism and accumulation of soluble sugars during fruit development in ‘Huangguan’ plum. J. Food Biochem. 2021, 45, e13878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Pan, T.; Ali, M.M.; Gong, J.; She, W.; Pan, D.; Guo, Z.; Yu, Y.; Chen, F. Fruit Physiology and Sugar-Acid Profile of 24 Pomelo (Citrus grandis (L.) Osbeck) Cultivars Grown in Subtropical Region of China. Agronomy 2021, 11, 2393. [Google Scholar] [CrossRef] [Scilit]
  7. Eom, J.-S.; Chen, L.-Q.; Sosso, D.; Julius, B.T.; Lin, I.; Qu, X.-Q.; Braun, D.M.; Frommer, W.B. SWEETs, transporters for intracellular and intercellular sugar translocation. Curr. Opin. Plant Biol. 2015, 25, 53–62. [Google Scholar] [CrossRef] [Scilit]
  8. Kühn, C.; Grof, C.P. Sucrose transporters of higher plants. Curr. Opin. Plant Biol. 2010, 13, 287–297. [Google Scholar] [CrossRef] [Scilit]
  9. Ayre, B.G. Membrane-Transport Systems for Sucrose in Relation to Whole-Plant Carbon Partitioning. Mol. Plant 2011, 4, 377–394. [Google Scholar] [CrossRef] [Scilit]
  10. Slewinski, T.L. Diverse Functional Roles of Monosaccharide Transporters and their Homologs in Vascular Plants: A Physiological Perspective. Mol. Plant 2011, 4, 641–662. [Google Scholar] [CrossRef] [Scilit]
  11. Chen, L.-Q.; Hou, B.-H.; Lalonde, S.; Takanaga, H.; Hartung, M.L.; Qu, X.-Q.; Guo, W.-J.; Kim, J.-G.; Underwood, W.; Chaudhuri, B.; et al. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 2010, 468, 527–532. [Google Scholar] [CrossRef] [Scilit]
  12. Xuan, Y.H.; Hu, Y.B.; Chen, L.-Q.; Sosso, D.; Ducat, D.C.; Hou, B.-H.; Frommer, W.B. Functional role of oligomerization for bacterial and plant SWEET sugar transporter family. Proc. Natl. Acad. Sci. USA 2013, 110, 3685–3694. [Google Scholar] [CrossRef] [Scilit]
  13. Yuan, M.; Wang, S. Rice MtN3/Saliva/SWEET Family Genes and Their Homologs in Cellular Organisms. Mol. Plant 2013, 6, 665–674. [Google Scholar] [CrossRef] [Scilit]
  14. Patil, G.; Valliyodan, B.; Deshmukh, R.; Prince, S.; Nicander, B.; Zhao, M.; Sonah, H.; Song, L.; Lin, L.; Chaudhary, J.; et al. Soybean (Glycine max) SWEET gene family: Insights through comparative genomics, transcriptome profiling and whole genome re-sequence analysis. BMC Genom. 2015, 16, 520. [Google Scholar] [CrossRef] [Scilit]
  15. Chandran, D. Co-option of developmentally regulated plant SWEET transporters for pathogen nutrition and abiotic stress tolerance. IUBMB Life 2015, 67, 461–471. [Google Scholar] [CrossRef] [Scilit]
  16. Chen, L.-Q.; Qu, X.-Q.; Hou, B.-H.; Sosso, D.; Osorio, S.; Fernie, A.R.; Frommer, W.B. Sucrose Efflux Mediated by SWEET Proteins as a Key Step for Phloem Transport. Science 2012, 335, 207–211. [Google Scholar] [CrossRef] [Scilit]
  17. Lin, I.W.; Sosso, D.; Chen, L.-Q.; Gase, K.; Kim, S.-G.; Kessler, D.; Klinkenberg, P.M.; Gorder, M.K.; Hou, B.-H.; Qu, X.-Q.; et al. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature 2014, 508, 546–549. [Google Scholar] [CrossRef] [Scilit]
  18. Engel, M.L.; Holmes-Davis, R.; McCormick, S. Green Sperm. Identification of Male Gamete Promoters in Arabidopsis. Plant Physiol. 2005, 138, 2124–2133. [Google Scholar] [CrossRef] [Scilit]
  19. Guan, Y.-F.; Huang, X.-Y.; Zhu, J.; Gao, J.-F.; Zhang, H.-X.; Yang, Z.-N. RUPTURED POLLEN GRAIN1, a Member of the MtN3/saliva Gene Family, Is Crucial for Exine Pattern Formation and Cell Integrity of Microspores in Arabidopsis. Plant Physiol. 2008, 147, 852–863. [Google Scholar] [CrossRef] [Scilit]
  20. Sun, M.-X.; Huang, X.-Y.; Yang, J.; Guan, Y.-F.; Yang, Z.-N. Arabidopsis RPG1 is important for primexine deposition and functions redundantly with RPG2 for plant fertility at the late reproductive stage. Plant Reprod. 2013, 26, 83–91. [Google Scholar] [CrossRef] [Scilit]
  21. Zhou, Y.; Liu, L.; Huang, W.; Yuan, M.; Zhou, F.; Li, X.; Lin, Y. Overexpression of OsSWEET5 in Rice Causes Growth Retardation and Precocious Senescence. PLoS ONE 2014, 9, e94210. [Google Scholar] [CrossRef] [Scilit]
  22. Arab, M.M.; Brown, P.J.; Abdollahi-Arpanahi, R.; Sohrabi, S.S.; Askari, H.; Aliniaeifard, S.; Mokhtassi-Bidgoli, A.; Mesgaran, M.B.; Leslie, C.A.; Marrano, A.; et al. Genome-wide association analysis and pathway enrichment provide insights into the genetic basis of photosynthetic responses to drought stress in Persian walnut. Hortic. Res. 2022, 9, uhac124. [Google Scholar] [CrossRef] [Scilit]
  23. Arab, M.M.; Marrano, A.; Abdollahi-Arpanahi, R.; Leslie, C.A.; Askari, H.; Neale, D.B.; Vahdati, K. Genome-wide patterns of population structure and association mapping of nut-related traits in Persian walnut populations from Iran using the Axiom J. regia 700K SNP array. Sci. Rep. 2019, 9, 6376. [Google Scholar] [CrossRef] [Scilit]
  24. Chen, L.-Q.; Lin, I.W.; Qu, X.-Q.; Sosso, D.; McFarlane, H.E.; Londoño, A.; Samuels, A.L.; Frommer, W.B. A Cascade of Sequentially Expressed Sucrose Transporters in the Seed Coat and Endosperm Provides Nutrition for the Arabidopsis Embryo. Plant Cell 2015, 27, 607–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Sosso, D.; Luo, D.; Li, Q.-B.; Sasse, J.; Yang, J.; Gendrot, G.; Suzuki, M.; Koch, K.E.; McCarty, D.R.; Chourey, P.S.; et al. Seed filling in domesticated maize and rice depends on SWEET-mediated hexose transport. Nat. Genet. 2015, 47, 1489–1493. [Google Scholar] [CrossRef] [Scilit]
  26. Yuan, M.; Chu, Z.; Li, X.; Xu, C.; Wang, S. Pathogen-Induced Expressional Loss of Function is the Key Factor in Race-Specific Bacterial Resistance Conferred by a Recessive R Gene xa13 in Rice. Plant Cell Physiol. 2009, 50, 947–955. [Google Scholar] [CrossRef] [Scilit]
  27. Streubel, J.; Pesce, C.; Hutin, M.; Koebnik, R.; Boch, J.; Szurek, B. Five phylogenetically close rice SWEET genes confer TAL effector-mediated susceptibility to Xanthomonas oryzae pv. oryzae. New Phytol. 2013, 200, 808–819. [Google Scholar] [CrossRef] [Scilit]
  28. Chong, J.; Piron, M.-C.; Meyer, S.; Merdinoglu, D.; Bertsch, C.; Mestre, P. The SWEET family of sugar transporters in grapevine: VvSWEET4 is involved in the interaction with Botrytis cinerea. J. Exp. Bot. 2014, 65, 6589–6601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Cohn, M.; Bart, R.S.; Shybut, M.; Dahlbeck, D.; Gomez, M.; Morbitzer, R.; Hou, B.-H.; Frommer, W.B.; Lahaye, T.; Staskawicz, B.J. Xanthomonas axonopodis Virulence Is Promoted by a Transcription Activator-Like Effector–Mediated Induction of a SWEET Sugar Transporter in Cassava. Mol. Plant Microbe Interact. 2014, 27, 1186–1198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Hu, Y.; Zhang, J.; Jia, H.; Sosso, D.; Li, T.; Frommer, W.B.; Yang, B.; White, F.F.; Wang, N.; Jones, J.B. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease. Proc. Natl. Acad. Sci. USA 2014, 111, E521–E529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Xie, H.; Wang, D.; Qin, Y.; Ma, A.; Fu, J.; Qin, Y.; Hu, G.; Zhao, J. Genome-wide identification and expression analysis of SWEET gene family in Litchi chinensis reveal the involvement of LcSWEET2a/3b in early seed development. BMC Plant Biol. 2019, 19, 499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Ali, M.M.; Anwar, R.; Shafique, M.W.; Yousef, A.F.; Chen, F. Exogenous Application of Mg, Zn and B Influences Phyto-Nutritional Composition of Leaves and Fruits of Loquat (Eriobotrya japonica Lindl.). Agronomy 2021, 11, 224. [Google Scholar] [CrossRef] [Scilit]
  33. Ali, M.M.; Li, B.; Zhi, C.; Yousef, A.F.; Chen, F. Foliar-Supplied Molybdenum Improves Phyto-Nutritional Composition of Leaves and Fruits of Loquat (Eriobotrya japonica Lindl.). Agronomy 2021, 11, 892. [Google Scholar] [CrossRef] [Scilit]
  34. Ali, M.M.; Rizwan, H.M.; Yousef, A.F.; Zhi, C.; Chen, F. Analysis of toxic elements in leaves and fruits of loquat by inductively coupled plasma-mass spectrometry (ICP-MS). Acta Sci. Pol. Hortorum Cultus 2021, 20, 33–42. [Google Scholar] [CrossRef] [Scilit]
  35. Badenes, M.L.; Canyamas, T.; Romero, C.; Soriano, J.M.; Martínez, J.; Llácer, G. Genetic diversity in european collection of loquat (Eriobotrya japonica Lindl.). Acta Hortic. 2003, 620, 169–174. [Google Scholar] [CrossRef] [Scilit]
  36. Zhi, C.; Ali, M.M.; Zhang, J.; Shi, M.; Ma, S.; Chen, F. Effect of Paper and Aluminum Bagging on Fruit Quality of Loquat (Eriobotrya japonica Lindl.). Plants 2021, 10, 2704. [Google Scholar] [CrossRef] [Scilit]
  37. Jiang, S.; An, H.; Xu, F.; Zhang, X. Chromosome-level genome assembly and annotation of the loquat (Eriobotrya japonica) genome. GigaScience 2020, 9, giaa015. [Google Scholar] [CrossRef] [Scilit]
  38. Daccord, N.; Celton, J.-M.; Linsmith, G.; Becker, C.; Choisne, N.; Schijlen, E.; van de Geest, H.; Bianco, L.; Micheletti, D.; Velasco, R.; et al. High-quality de novo assembly of the apple genome and methylome dynamics of early fruit development. Nat. Genet. 2017, 49, 1099–1106. [Google Scholar] [CrossRef] [Scilit]
  39. Finn, R.D.; Mistry, J.; Tate, J.; Coggill, P.; Heger, A.; Pollington, J.E.; Gavin, O.L.; Gunasekaran, P.; Ceric, G.; Forslund, K.; et al. The Pfam protein families database. Nucleic Acids Res. 2010, 38, D211–D222. [Google Scholar] [CrossRef] [Scilit]
  40. Eddy, S.R. Accelerated Profile HMM Searches. PLoS Comput. Biol. 2011, 7, e1002195. [Google Scholar] [CrossRef] [Scilit]
  41. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [Scilit]
  42. Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.-H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [Scilit]
  43. Gan, X.; Jing, Y.; Shahid, M.Q.; He, Y.; Baloch, F.S.; Lin, S.; Yang, X. Identification, phylogenetic analysis, and expression patterns of the SAUR gene family in loquat (Eriobotrya japonica). Turk. J. Agric. For. 2020, 44, 15–23. [Google Scholar] [CrossRef] [Scilit]
  44. Wang, D.; Zhang, Y.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A Toolkit Incorporating Gamma-Series Methods and Sliding Window Strategies. Genom. Proteom. Bioinform. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Scilit]
  45. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
  46. Ali, M.M.; Alam, S.M.; Anwar, R.; Ali, S.; Shi, M.; Liang, D.; Lin, Z.; Chen, F. Genome-Wide Identification, Characterization and Expression Profiling of Aluminum-Activated Malate Transporters in Eriobotrya japonica Lindl. Horticulturae 2021, 7, 441. [Google Scholar] [CrossRef] [Scilit]
  47. Zhi, C.; Ali, M.M.; Alam, S.M.; Gull, S.; Ali, S.; Yousef, A.F.; Ahmed, M.A.A.; Ma, S.; Chen, F. Genome-Wide In Silico Analysis and Expression Profiling of Phosphoenolpyruvate Carboxylase Genes in Loquat, Apple, Peach, Strawberry and Pear. Agronomy 2021, 12, 25. [Google Scholar] [CrossRef] [Scilit]
  48. Akhunov, E.D.; Sehgal, S.; Liang, H.; Wang, S.; Akhunova, A.R.; Kaur, G.; Li, W.; Forrest, K.L.; See, D.; Šimková, H.; et al. Comparative Analysis of Syntenic Genes in Grass Genomes Reveals Accelerated Rates of Gene Structure and Coding Sequence Evolution in Polyploid Wheat. Plant Physiol. 2012, 161, 252–265. [Google Scholar] [CrossRef] [Scilit]
  49. Yuan, M.; Zhao, J.; Huang, R.; Li, X.; Xiao, J.; Wang, S. Rice MtN3/saliva/SWEET gene family: Evolution, expression profiling, and sugar transport. J. Integr. Plant Biol. 2014, 56, 559–570. [Google Scholar] [CrossRef] [Scilit]
  50. Hu, L.; Zhang, F.; Song, S.; Tang, X.; Xu, H.; Liu, G.; Wang, Y.; He, H. Genome-wide identification, characterization, and expression analysis of the SWEET gene family in cucumber. J. Integr. Agric. 2017, 16, 1486–1501. [Google Scholar] [CrossRef] [Scilit]
  51. Feng, C.-Y.; Han, J.-X.; Han, X.-X.; Jiang, J. Genome-wide identification, phylogeny, and expression analysis of the SWEET gene family in tomato. Gene 2015, 573, 261–272. [Google Scholar] [CrossRef] [Scilit]
  52. Wei, X.; Liu, F.; Chen, C.; Ma, F.; Li, M. The Malus domestica sugar transporter gene family: Identifications based on genome and expression profiling related to the accumulation of fruit sugars. Front. Plant Sci. 2014, 5, 569. [Google Scholar] [CrossRef] [Scilit]
  53. Ardito, F.; Giuliani, M.; Perrone, D.; Troiano, G.; Lo Muzio, L. The crucial role of protein phosphorylation in cell signaling and its use as targeted therapy (Review). Int. J. Mol. Med. 2017, 40, 271–280. [Google Scholar] [CrossRef] [Scilit]
  54. Zhen, Q.; Fang, T.; Peng, Q.; Liao, L.; Zhao, L.; Owiti, A.; Han, Y. Developing gene-tagged molecular markers for evaluation of genetic association of apple SWEET genes with fruit sugar accumulation. Hortic. Res. 2018, 5, 14. [Google Scholar] [CrossRef] [Scilit]
  55. Lo, E.Y.Y.; Donoghue, M.J. Expanded phylogenetic and dating analyses of the apples and their relatives (Pyreae, Rosaceae). Mol. Phylogenet. Evol. 2012, 63, 230–243. [Google Scholar] [CrossRef] [Scilit]
  56. Chu, Z.; Yuan, M.; Yao, J.; Ge, X.; Yuan, B.; Xu, C.; Li, X.; Fu, B.; Li, Z.; Bennetzen, J.L.; et al. Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes Dev. 2006, 20, 1250–1255. [Google Scholar] [CrossRef] [Scilit]
  57. Antony, G.; Zhou, J.; Huang, S.; Li, T.; Liu, B.; White, F.; Yang, B. Rice xa13 Recessive Resistance to Bacterial Blight Is Defeated by Induction of the Disease Susceptibility Gene Os- 11N3. Plant Cell 2010, 22, 3864–3876. [Google Scholar] [CrossRef] [Scilit]
  58. Rennie, E.A.; Turgeon, R. A comprehensive picture of phloem loading strategies. Proc. Natl. Acad. Sci. USA 2009, 106, 14162–14167. [Google Scholar] [CrossRef] [Scilit]
  59. Hu, L.-P.; Meng, F.-Z.; Wang, S.-H.; Sui, X.-L.; Li, W.; Wei, Y.-X.; Sun, J.-L.; Zhang, Z.-X. Changes in carbohydrate levels and their metabolic enzymes in leaves, phloem sap and mesocarp during cucumber (Cucumis sativus L.) fruit development. Sci. Hortic. 2009, 121, 131–137. [Google Scholar] [CrossRef] [Scilit]
  60. Bachmann, M.; Matile, P.; Keller, F. Metabolism of the Raffinose Family Oligosaccharides in Leaves of Ajuga reptans L. (Cold Acclimation, Translocation, and Sink to Source Transition: Discovery of Chain Elongation Enzyme). Plant Physiol. 1994, 105, 1335–1345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Yadav, U.P.; Ayre, B.G.; Bush, D.R. Transgenic approaches to altering carbon and nitrogen partitioning in whole plants: Assessing the potential to improve crop yields and nutritional quality. Front. Plant Sci. 2015, 6, 275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Hu, L.; Sun, H.; Li, R.; Zhang, L.; Wang, S.; Sui, X.; Zhang, Z. Phloem unloading follows an extensive apoplasmic pathway in cucumber (Cucumis sativus L.) fruit from anthesis to marketable maturing stage. Plant. Cell Environ. 2011, 34, 1835–1848. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Hayes, M.A.; Davies, C.; Dry, I.B. Isolation, functional characterization, and expression analysis of grapevine (Vitis vinifera L.) hexose transporters: Differential roles in sink and source tissues. J. Exp. Bot. 2007, 58, 1985–1997. [Google Scholar] [CrossRef] [Scilit]
  64. Cheng, J.-T.; Li, X.; Yao, F.-Z.; Shan, N.; Li, Y.-H.; Zhang, Z.-X.; Sui, X.-L. Functional characterization and expression analysis of cucumber (Cucumis sativus L.) hexose transporters, involving carbohydrate partitioning and phloem unloading in sink tissues. Plant Sci. 2015, 237, 46–56. [Google Scholar] [CrossRef] [Scilit]
  65. Guo, W.-J.; Nagy, R.; Chen, H.-Y.; Pfrunder, S.; Yu, Y.-C.; Santelia, D.; Frommer, W.B.; Martinoia, E. SWEET17, a Facilitative Transporter, Mediates Fructose Transport across the Tonoplast of Arabidopsis Roots and Leaves. Plant Physiol. 2014, 164, 777–789. [Google Scholar] [CrossRef] [Scilit]
  66. Feng, L.; Frommer, W.B. Structure and function of SemiSWEET and SWEET sugar transporters. Trends Biochem. Sci. 2015, 40, 480–486. [Google Scholar] [CrossRef] [Scilit]
  67. Zheng, Q.-M.; Tang, Z.; Xu, Q.; Deng, X.-X. Isolation, phylogenetic relationship and expression profiling of sugar transporter genes in sweet orange (Citrus sinensis). Plant Cell Tissue Organ Cult. 2014, 119, 609–624. [Google Scholar] [CrossRef] [Scilit]
Figure 1. (A) Protein subcellular localization prediction of loquat SWEETs. Maximum and minimum signals are shown with red and green color boxes, respectively, while white color boxes represent no available data. Abbreviations: Nucl, nucleus; Cyto, cytoplasm; Mito, mitochondria; Vacu, vacuole; Plas, plasma membrane; Chlo, chloroplast; Golgi, Golgi apparatus; E.R., endoplasmic reticulum; Pero, peroxisomes; Extr, extracellular region. (B) Gene organization of EjSWEETs. The green boxes represent exons and the black lines represent introns, while untranslated regions (UTR) are denoted by yellow areas.
Figure 1. (A) Protein subcellular localization prediction of loquat SWEETs. Maximum and minimum signals are shown with red and green color boxes, respectively, while white color boxes represent no available data. Abbreviations: Nucl, nucleus; Cyto, cytoplasm; Mito, mitochondria; Vacu, vacuole; Plas, plasma membrane; Chlo, chloroplast; Golgi, Golgi apparatus; E.R., endoplasmic reticulum; Pero, peroxisomes; Extr, extracellular region. (B) Gene organization of EjSWEETs. The green boxes represent exons and the black lines represent introns, while untranslated regions (UTR) are denoted by yellow areas.
Agriculture 12 01312 g001
Figure 2. Phylogenetic relationship and conserved motif analysis of EjSWEET genes.
Figure 2. Phylogenetic relationship and conserved motif analysis of EjSWEET genes.
Agriculture 12 01312 g002
Figure 3. Chromosomal mapping (A) and gene duplication (B) of EjSWEETs.
Figure 3. Chromosomal mapping (A) and gene duplication (B) of EjSWEETs.
Agriculture 12 01312 g003
Figure 4. The promoter region analysis (cis-regulatory elements) of EjSWEET genes. Maximum and minimum number of cis-elements are denoted by red and green boxes, respectively.
Figure 4. The promoter region analysis (cis-regulatory elements) of EjSWEET genes. Maximum and minimum number of cis-elements are denoted by red and green boxes, respectively.
Agriculture 12 01312 g004
Figure 5. Multiple sequence alignment of the EjSWEETs. The positions of the seven motifs are indicated above the sequences. Highly conserved amino acids (>80%) are shaded with black, moderate conservation (60–80%) is with grey, while the non-shaded amino acids represent less conservation (<60%).
Figure 5. Multiple sequence alignment of the EjSWEETs. The positions of the seven motifs are indicated above the sequences. Highly conserved amino acids (>80%) are shaded with black, moderate conservation (60–80%) is with grey, while the non-shaded amino acids represent less conservation (<60%).
Agriculture 12 01312 g005
Figure 6. Phylogenetic associations of SWEET genes among loquat, Arabidopsis, and apple. SWEET genes fall into three groups labeled A, B, and C. Ej—loquat; Md—apple; At—Arabidopsis. The gene IDs of apple and Arabidopsis SWEET genes are provided in Table S1.
Figure 6. Phylogenetic associations of SWEET genes among loquat, Arabidopsis, and apple. SWEET genes fall into three groups labeled A, B, and C. Ej—loquat; Md—apple; At—Arabidopsis. The gene IDs of apple and Arabidopsis SWEET genes are provided in Table S1.
Agriculture 12 01312 g006
Figure 7. Relative expression levels of EjSWEETs in five tissues of loquat, i.e., root, stem, leaf, flower, and fruit. Significant difference among different tissues is denoted by different letters following the least significant difference (LSD) test (p ≤ 0.05). Vertical bars show average ± standard error (6 replicates). ND—not detected. The genetic expression of EjSWEET12 was not detected in all loquat tissues.
Figure 7. Relative expression levels of EjSWEETs in five tissues of loquat, i.e., root, stem, leaf, flower, and fruit. Significant difference among different tissues is denoted by different letters following the least significant difference (LSD) test (p ≤ 0.05). Vertical bars show average ± standard error (6 replicates). ND—not detected. The genetic expression of EjSWEET12 was not detected in all loquat tissues.
Agriculture 12 01312 g007
Table 1. Primer sequences of EjSWEET genes.
Table 1. Primer sequences of EjSWEET genes.
Gene NameGene IDForward Primer (5′–3′)Reverse Primer (5′–3′)
EjSWEET1EVM0038444.1CCCCAATGCCAACATTTAAGGGAAAACAGCTCCGATTGAA
EjSWEET2EVM0001232.1CCGAAAGAGCGGTTAAGATGTGGCGAACCATACATGAAAA
EjSWEET3EVM0035130.1TCTTTCTCTCGCGACGTTTTTGGCTCTCTTGAGGCATCTT
EjSWEET4EVM0038533.1CGCCTTTCTCGATTATGAGCTCCCAAACCCATTTGGAATA
EjSWEET5EVM0008081.1TGTCACCAATGCCAACATTTGAGCAATCCCGATATCCTCA
EjSWEET6EVM0039968.1TTGCGTCCATTGTCTTTGTCGGCATGAACTCAACGCTTTT
EjSWEET7EVM0006793.1TTGTGTCCGCAAACAACATTAGAACAGAGCAAGCACAGCA
EjSWEET8EVM0033338.1TCCCCAATCCCAACATTTTAACCTTCAAGCGTTGTGAACC
EjSWEET9EVM0009105.1TTGGTGCGGTGTTTCAATTACTTTGTCCGGATCACCAAGT
EjSWEET10EVM0029629.1ATGGAATTTTGTGGCTCGTCTTTGGCCTTTCATCATCCTC
EjSWEET11EVM0019072.1ATGGGCTGGGCTTACTTTTTCATGTCCGGTTGTTCTGATG
EjSWEET12EVM0043755.1TTTGCACACTGCTCAACTCCCCACATCCAAGGTTCCAATC
EjSWEET13EVM0005220.1TCATCGAAAGGGTTCCAATCCCGAAAGCGGCTACATTTAC
EjSWEET14EVM0003016.1CGTGGTATGGATCGCCTATTAATCTGCAAGCTCCCAAAGA
EjSWEET15EVM0006392.1CATGTCCTTCCCTTTGTCGTCATTTTCTGCAACCCCATTT
EjSWEET16EVM0043307.1CTCCTTCGGGCTTTTTCTCTCAAGAGTGCTGTCAGGGTGA
EjSWEET17EVM0019370.1GCTCGTTTTCATGGCTCTTCCATATGTGAACCAGGCAACG
EjSWEET18EVM0020014.1TGACTCGCTTTCTAGCCACATGATAACGGAAATGGCATGA
EjSWEET19EVM0044002.1CCGGTCTTTGGTAGTTGGAAGACCAGCCAAACAACTCCAT
EjSWEET20EVM0026582.1AAGCAACAAATGGGAAAACGGCTGAGATAATGGCGGTGAT
EjSWEET21EVM0012820.1TCTTCACCATTAACGGCACAAACGACGGCTGAGATAATGG
EjActEVM0004523.1GGAGCGTGGATATTCCTTCAGCTGCTTCCATTCCAATCAT
Table 2. The basic information about SWEET genes in loquat.
Table 2. The basic information about SWEET genes in loquat.
Gene NameGene IDChromosomeStart SiteEnd SiteStrandCDS (bp)
EjSWEET1EVM0038444.1157610085763757+699
EjSWEET2EVM0001232.1157717485773852+717
EjSWEET3EVM0035130.1157764065778843+708
EjSWEET4EVM0038533.114646981146472452+792
EjSWEET5EVM0008081.1264089916411071+699
EjSWEET6EVM0039968.1264305246432707+717
EjSWEET7EVM0006793.124102994841032274+792
EjSWEET8EVM0033338.133956645139568463711
EjSWEET9EVM0009105.1438378363844089708
EjSWEET10EVM0029629.1682782748279519708
EjSWEET11EVM0019072.162045193820455969765
EjSWEET12EVM0043755.182741549527429282720
EjSWEET13EVM0005220.112889913891387+804
EjSWEET14EVM0003016.1123484945934851971+708
EjSWEET15EVM0006392.1123788508237886461825
EjSWEET16EVM0043307.1133571708235718865+726
EjSWEET17EVM0019370.1142516528225168251786
EjSWEET18EVM0020014.1142829333828295358+888
EjSWEET19EVM0044002.1143172952231732348711
EjSWEET20EVM0026582.11617495051750777762
EjSWEET21EVM0012820.11617685631769839750
CDS: coding sequence (DNA); bp: base pair.
Table 3. Summary information of physicochemical properties of the SWEET proteins in loquat.
Table 3. Summary information of physicochemical properties of the SWEET proteins in loquat.
Gene NameProtein Length (A.A.)MW (kDa)pIInstability IndexAliphatic IndexGRAVY
EjSWEET123225.358198.7134.89128.10.936
EjSWEET223826.62455.4243.89115.420.758
EjSWEET323525.872868.9132.61126.890.926
EjSWEET426328.844019.7736.0298.970.502
EjSWEET523225.374178.5538.09127.280.929
EjSWEET623826.699484.9345.91114.620.777
EjSWEET726328.639819.5730.76102.360.521
EjSWEET823626.584059.0339.64132.330.992
EjSWEET923525.992049.0345.23121.530.871
EjSWEET1023526.532638.9934.12121.530.716
EjSWEET1125428.661189.4130.9117.760.63
EjSWEET1223926.426145.6743.5118.280.714
EjSWEET1326729.882519.3424.63111.690.59
EjSWEET1423525.924696.5545.96123.190.857
EjSWEET1527430.573318.2441.78111.790.596
EjSWEET1624126.690839.2231.14121.290.687
EjSWEET1726129.345069.7138.69124.330.628
EjSWEET1829533.08745.9748.15120.240.664
EjSWEET1923626.842379.5741.76135.640.911
EjSWEET2025328.097249.1540.88115.060.532
EjSWEET2124927.585699.3639.2117.310.584
MW: molecular weight of amino acid sequence; pI: theoretical isoelectric point; GRAVY: grand average of hydropathicity.
Table 4. The Ka/Ks ratio of duplicated EjSWEET genes.
Table 4. The Ka/Ks ratio of duplicated EjSWEET genes.
Gene 1Gene 2KaKsKa/KsDuplication
EjSWEET1EjSWEET50.024420.16833630.1450679segmental
EjSWEET2EjSWEET60.0482970.12542520.3850654segmental
EjSWEET4EjSWEET70.0464860.21839780.2128524segmental
EjSWEET8EjSWEET190.0960190.15806280.6074743segmental
EjSWEET9EjSWEET140.0525420.08567630.6132632segmental
EjSWEET11EjSWEET170.0860590.1350990.6370108segmental
EjSWEET13EjSWEET150.4529872.30060350.1968992tandem
EjSWEET20EjSWEET210.0144110.0328820.4382501tandem
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, B.; Ali, M.M.; Guo, T.; Alam, S.M.; Gull, S.; Iftikhar, J.; Yousef, A.F.; Mosa, W.F.A.; Chen, F. Genome-Wide Identification, In Silico Analysis and Expression Profiling of SWEET Gene Family in Loquat (Eriobotrya japonica Lindl.). Agriculture 2022, 12, 1312. https://doi.org/10.3390/agriculture12091312

AMA Style

Li B, Ali MM, Guo T, Alam SM, Gull S, Iftikhar J, Yousef AF, Mosa WFA, Chen F. Genome-Wide Identification, In Silico Analysis and Expression Profiling of SWEET Gene Family in Loquat (Eriobotrya japonica Lindl.). Agriculture. 2022; 12(9):1312. https://doi.org/10.3390/agriculture12091312

Chicago/Turabian Style

Li, Binqi, Muhammad Moaaz Ali, Tianxin Guo, Shariq Mahmood Alam, Shaista Gull, Junaid Iftikhar, Ahmed Fathy Yousef, Walid F. A. Mosa, and Faxing Chen. 2022. "Genome-Wide Identification, In Silico Analysis and Expression Profiling of SWEET Gene Family in Loquat (Eriobotrya japonica Lindl.)" Agriculture 12, no. 9: 1312. https://doi.org/10.3390/agriculture12091312

APA Style

Li, B., Ali, M. M., Guo, T., Alam, S. M., Gull, S., Iftikhar, J., Yousef, A. F., Mosa, W. F. A., & Chen, F. (2022). Genome-Wide Identification, In Silico Analysis and Expression Profiling of SWEET Gene Family in Loquat (Eriobotrya japonica Lindl.). Agriculture, 12(9), 1312. https://doi.org/10.3390/agriculture12091312

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop