Lipopeptides Produced by Bacillus mojavensis P1709 as an Efficient Tool to Maintain Postharvest Cherry Tomato Quality and Quantity
Round 1
Reviewer 1 Report
Manuscript ID: agriculture-1614599
Title: Lipopeptides produced by Bacillus mojavensis P1709 as an efficient tool to maintain postharvest cherry tomato quality and quantity
In this article, the authors describe Lipopeptides produced by Bacillus mojavensis P1709 as an efficient tool to maintain postharvest cherry tomato quality and quantity. I think the subject is interesting. However, the methods and results are unclear. The manuscript lacks the necessary details for readers to fully understand and difficult to follow the logic of the study. Major revision is required to improve the quality of the content and writing.
The following comments are for the authors to consider:
L16-18: In L290, the authors mentioned “At a concentration of 20 gl-1, APF inhibited fungal radial growth by 93%”. What should it be?
L34-40: This section should be mentioned fungicides more than biopesticides.
L49: “Bacillus” should be italicized.
L68: “Fusarium” should be italicized.
L127-128: Did the authors isolate the 158 bacterial isolates in this study? It is necessary to provide more details for bacterial isolation method. Similar with the identification method, it is necessary to specify clearly. The criteria for bacterial identification should be indicated.
L132-134: These sentences are inappropriate in this section. They should be mentioned in the result section.
L136-141: The authors should assign the appropriate subheading for this experiment.
L143-147: Please revise this section to make it easier to understand. It is difficult to follow the information of the primers used in this study.
L155-156: The authors mentioned “The presence and approximate length of the amplicons were estimated using agarose gel electrophoresis with a 100 bp ladder” Did the authors use a 100 bp ladder (see L253–254)? What is the size of the gene?
L164, L166: What is APF? Please provide more details
L157-164: There are many sentences that are difficult to understand. Please revise this section
L173-174: Please revise this sentence
L183: Please specify the composition of potato dextrose agar used in this study
L186: Please revise this sentence
L187: Please specify the composition of malt extract agar (MEA)
L189: Please indicate the concentration of spore suspension
L193-134: It is difficult to follow the logic of this experiment. Some necessary details are missing e.g. an amount of fungus and number of Petri dish. How the authors cut and homogenized the fungus?
L208: 106 spores?
L211: Please specify the different APF concentrations in this section.
L215: How to calculate the percentage of the growth inhibition? Please specify
L238, 243, 249, 256, 263, 270, 279, 284, 287 and throughout the manuscript: In general, the scientific name must be italicized. The authors should re-check them carefully.
L243-244: The authors stated that “Since the isolate was identified as a Bacillus species, we suggested that the biosurfactants produced by the isolate belonged to the lipopeptide class and could contain surfactin, iturin and fengycin”. Only Bacillus species can produced surfactin, iturin and fengycin ? Please clarify.
L249-260: The analysis of gene size by gel electrophoresis is ineffective in identifying genes. I strongly suggest the author identify the genes by nucleotide sequence analysis
L314: How to calculate the percentage of the disease incidence? Please provide more details in the method section
Figure 5: Enzyme activity should be report as U g-1 or U mL-1
Author Response
Response to Reviewer 1 Comments
Dear Reviewer, thank you for the accurate reading of our manuscript and for your comments. Below you will find the answers
Point 1:
L16-18: In L290, the authors mentioned “At a concentration of 20 gl-1, APF inhibited fungal radial growth by 93%”. What should it be?
Response 1:
APF is the acid precipitated fraction obtained from the cultural medium of a biosurfactant producer. Presumably, APF contains mixture of the crude biosurfactants of different structure and lenght produced by the microbes and other minor compounds. The method of obtaining of APF is described in details in “M&M” section, this method was used by other researchers before (that are cited in the manuscript). The term APF is often used in the studies concerning biosurfactants (Alvarez, 2020; Nayarisseri, 2018; Varadavenkatesan, 2013). According to the Reviewers’ comment, we rephrased the sentence in L290. We also corrected technical mistake in L 16-18.
Сhanges in the manuscript 1
L290: The radial growth of F. oxysporum was inversely correlated with APF concentration in the agar medium, thus the radial growth of the pathogen in the medium containing 20 gl-1 was inhibited by 93±11% as compared with that in control medium.
L16-18: APF (acid-precipitated fraction) of B. mojavensis P1709 culture medium at a concentration of 20 g l-1 inhibited pathogen radial growth on agar plates by 93% and T-2 and HT-2 mycotoxin production by 98% after 5 days of cultivation.
Point 2:
L34-40: This section should be mentioned fungicides more than biopesticides.
Response 2:
Revised according to the comments
Сhanges in the manuscript 2
Biological control agents include biopesticides, in particular fungicides, bactericides and other compounds, produced by microorganisms or the microorganisms themselves
Point 3:
L49: “Bacillus” should be italicized.
Response 3:
Done.
Point 4:
L68: “Fusarium” should be italicized.
Response 4:
Done.
Point 5:
L127-128: Did the authors isolate the 158 bacterial isolates in this study? It is necessary to provide more details for bacterial isolation method. Similar with the identification method, it is necessary to specify clearly. The criteria for bacterial identification should be indicated.
Response 5:
The isolates were obtained in the previous study, and we do not see the need to include more detailed information into the manuscript since it does not correspond to its aim. However, we agree with the reviewer that in case the isolation of 158 strains is mentioned in the text, more details are expected by the reader. Therefore we decided to exclude the whole paragraph from the manuscript and only mention that the strain was obtained from the Institute collection.
Сhanges in the manuscript 5
Biosurfactant-producing strain Bacillus mojavensis P1709 was obtained from the collection of the Institute of Environmental Sciences of Kazan Federal University (Russia). The strain was previously isolated from the rhizosphere soil of Lactuca sativa.
Point 6:
L132-134: These sentences are inappropriate in this section. They should be mentioned in the result section.
Response 6:
Please see the previous comments. Since the selection of the isolate among other 158 isolates is not important for the main goal of the manuscript, this information was deleted.
Point 7:
L136-141: The authors should assign the appropriate subheading for this experiment.
Response 7:
Please see the previous comments. Since the selection of the isolate among other 158 isolates is not important for the main goal of the manuscript, this information was deleted. The method of E24 estimation has been separated in 2.2 subsection.
Сhanges in the manuscript 7
2.2. Emulsification index assessment
Point 8:
L143-147: Please revise this section to make it easier to understand. It is difficult to follow the information of the primers used in this study.
Response 8:
According to the Reviewer’s comment, we composed Table 1 with primer sequences and length, and deleted corresponding sentences from the text
Сhanges in the manuscript 8
Table 1. PCR primers used in this study (Chung et al. 2008)
Point 9:
L155-156: The authors mentioned “The presence and approximate length of the amplicons were estimated using agarose gel electrophoresis with a 100 bp ladder” Did the authors use a 100 bp ladder (see L253–254)? What is the size of the gene?
Response 9:
100 bp - it’s a technical mistake. We used a 1000 bp ladder. Besides, the information about amplicons’ expected length was inserted into the Table 1.
Сhanges in the manuscript 9
The presence and approximate length of the amplicons were estimated using agarose gel electrophoresis with a 1000 bp ladder.
Table 1. PCR primers used in this study
|
Target gene |
Primer sequence, 5’-3’ |
Amplicon length (bp) |
|
fenD |
GGCCCGTTCTCTAAATCCAT |
670 |
|
|
GTCATGCTGACGAGAGCAAA |
|
|
ituC |
GGCTGCTGCAGATGCTTTAT |
423 |
|
|
TCGCAGATAATCGCAGTGAG |
|
|
srfAA |
TCGGGACAGGAAGACATCAT |
201 |
|
|
CCACTCAAACGGATAATCCTGA |
|
Point 10:
L164, L166: What is APF? Please provide more details
Response 10:
APF is the acid precipitated fraction obtained from the cultural medium of a biosurfactant producer. Presumably, APF contains mixture of the crude biosurfactants of different structure and lenght produced by the microbes and other minor compounds.
We rewrote the subsection “Biosurfactant production, extraction and purification” in order to clarify the term “APF”
Сhanges in the manuscript 10
For increased biosurfactant production, strain P1709 was cultivated in glycerol nitrate medium at 35 °C and 180 rpm for 6 days. Then, the mixture of crude biosurfactants produced by the strain was extracted using acid precipitation and purified as described below. As a result, APF (acid precipitated fraction) was obtained and used for further analyses.
The APF was obtained according to Nayarisseri et al. (2016) etc. [38-40]. Briefly, after cultivation, the culture was centrifuged at 8000 rpm for 20 min. The cell free supernatant was adjusted to pH 2 using 2N HCl, incubated overnight at 4 °C and centrifuged at 10,000 rpm and 4 °C for 20 min. The precipitate was purified using dissolving in a CHCl3:CH3OH (2:1, v/v) mixture followed by rotary evaporating under vacuum. The resulting yield of the APF was 5.3 g from 1 L of cell-free supernatant.
Point 11:
L157-164: There are many sentences that are difficult to understand. Please revise this section
Response 11:
Please see the previous comment. The sentences were revised.
Сhanges in the manuscript 11
For increased biosurfactant production, strain P1709 was cultivated in glycerol nitrate medium at 35 °C and 180 rpm for 6 days. Then, the mixture of crude biosurfactants produced by the strain was extracted using acid precipitation and purified as described below. As a result, APF (acid precipitated fraction) was obtained and used for further analyses.
The APF was obtained according to Nayarisseri et al. (2016) etc. [38-40]. Briefly, after cultivation, the culture was centrifuged at 8000 rpm for 20 min. The cell free supernatant was adjusted to pH 2 using 2N HCl, incubated overnight at 4 °C and centrifuged at 10,000 rpm and 4 °C for 20 min. The precipitate was purified using dissolving in a CHCl3:CH3OH (2:1, v/v) mixture followed by rotary evaporating under vacuum. The resulting yield of the APF was 5.3 g from 1 L of cell-free supernatant.
Point 12:
L173-174: Please revise this sentence
Response 12:
The sentence was rephrased
Сhanges in the manuscript 12
The main components were detected by exposure to iodine vapor, p-anisaldehyde, and 1% ninhydrin solution, for staining of lipids, sugars, and free amino groups, respectively. The reagents were sprayed followed by heating at 110 °C until the detection of the definite spots.
Point 13:
L183: Please specify the composition of potato dextrose agar used in this study
Response 13:
The composition was added
Сhanges in the manuscript 13
To collect the spores, the fungus was cultivated on potato dextrose agar (0.4% w/v potato extract, 2% w/v glucose, 1.5% w/v agar) for 120 h at 28±2 °C [7].
Point 14:
L186: Please revise this sentence
Response 14:
The sentence was revised
Сhanges in the manuscript 14
For further experiments, a spore concentration was adjusted to 1x106 ml-1.
Point 15:
L187: Please specify the composition of malt extract agar (MEA)
Response 15:
The composition was added
Сhanges in the manuscript 15
Briefly, malt extract agar (2% w/v malt extract, 0.1% w/v peptone, 2% w/v glucose) was pooled into Petri dishes (90 mm) and supplemented with APF to adjust the concentrations of 0.5, 2, 5, 10 and 20 g L-1 [8].
Point 16:
L189: Please indicate the concentration of spore suspension
Response 16:
The concentration of the spores was indicated
Сhanges in the manuscript 16
Ten microliters of spore suspension (1 x106 spores ml-1) were added to the center of the agar plates.
Point 17:
L193-194: It is difficult to follow the logic of this experiment. Some necessary details are missing e.g. an amount of fungus and number of Petri dish. How the authors cut and homogenized the fungus?
Response 17:
The sentences were rewritten and more details were provided for T-2 and HT-2 toxins.
Besides, according to the other Reviewer’s comments, the methods and results of two other mycotoxins’ (zearalenones and fumonisins) analyses were excluded from the manuscript, since i) they were not revealed and ii) they were not expected to be revealed according to the literature search.
Сhanges in the manuscript 17
To assess the presence and concentration of T-2 and HT-2 mycotoxins, the content of each Petri dish covered by the fungus was visually estimated and cut with medical scalpel. The resulting substance containing the fungus and the agar medium was homogenized using a mixer mill MM 400 (Retsch, Germany) for 2 min at maximum speed. The homogenous substance obtained was analyzed using the enzyme immunoassay kit manufactured by RIDASCREEN® (R-Biopharm, Germany) according to the provided instruction. The immunoassay results were estimated using a Multiskan FC microplate photometer (Thermo Fisher Scientific, USA). The total concentration of the two mycotoxins was expressed in µg per gram of homogenized substance. Further, the inhibition of the mycotoxins’ production was calculated comparing the concentration of the toxins in the Petri dishes treated with APF with that in the control dishes (without APF).
Point 18:
L208: 106 spores?
Response 18:
It’s technical mistake.
Сhanges in the manuscript 18
1 x106 spores
Point 19:
L211: Please specify the different APF concentrations in this section.
Response 19:
The concentrations were specified.
Additionally, the concentrations of APF were specified in the subsection 2.6 for the fungal radial growth inhibition method – in order to make the methods’ description more similar
Сhanges in the manuscript 19
Ten microliters of APF at different concentrations (0.5, 2, 5, 10, 20 g L-1) was added to each wound under sterile conditions.
Briefly, malt extract agar (2% w/v malt extract, 0.1% w/v peptone, 2% w/v glucose) was pooled into Petri dishes (90 mm) and supplemented with APF to adjust the concentrations of 0.5, 2, 5, 10 and 20 g L-1 [8].
Point 20:
L215: How to calculate the percentage of the growth inhibition? Please specify
Response 20:
The detailed method of disease incidence calculation was added to the manuscript.
The term “growth inhibition” was excluded from the subsection 2.7.
Сhanges in the manuscript 20
After incubation, the disease incidence was estimated as described by Khaliq et al. (2017) with slight modifications [44]. In particular, the fungal growth on each fruit was assessed visually using a scale from 0 to 5, where 0 = no signs of decay, 1 = small colonies of the pathogen are visible, 2 = the pathogen colonies occupy 30-50% of the wound, 3 = the pathogen colonies occupy 50-100% of the wound, 4 = decay diameter slightly exceeds the wound diameter (10-50%), 5 = decay diameter significantly exceeds the wound diameter (>50%). To calculate the disease incidence for each treatment variant, the following formula was used:
Disease incidence (%) = x 100
Point 21:
L238, 243, 249, 256, 263, 270, 279, 284, 287 and throughout the manuscript: In general, the scientific name must be italicized. The authors should re-check them carefully.
Response 21:
Done
Point 22:
L243-244: The authors stated that “Since the isolate was identified as a Bacillus species, we suggested that the biosurfactants produced by the isolate belonged to the lipopeptide class and could contain surfactin, iturin and fengycin”. Only Bacillus species can produced surfactin, iturin and fengycin? Please clarify.
Response 22:
According to the literature, Bacillus species can produce biosurfactants of the lipopeptide class such as surfactin, iturin, fengycin, bacillomycin, halobacillin, mycosubtilin and other minor biosurfactants. Among those types of biosurfactants, surfactin, iturin and fengycin are the most common ones for all the Bacillii, besides those biosurfactants possess antimicrobial activity which is relevant for our study.
Other microorganisms except of Bacilli may produce surfactin, iturin and fengycin as well, but this is not relevant for our manuscript.
In the present study, we assumed that since the biosurfactant producer belongs to Bacillus genus, it potentially is able produce surfactin and/or iturin and/or fengycin. The assumption was examined using chemical methods (TLC and FTIR) as well as genic methods (revealing genes encoding synthesis of corresponding compounds).
(Kim 2004; Klich, 1994; Maget-Dana, 1992, Kim, 2010 and others cited in the manuscript)
The sentences in L243-244 were rewritten in order to clarify our ideas.
Сhanges in the manuscript 22
According to the published studies, bacteria belonging to Bacillus genera, typically produce biosurfactants of the lipopeptide class such as surfactin, iturin, or fengycin [12]. Therefore, we assumed that high emulsifying activity revealed before was due to the presence of one or several of those compounds in the cultural medium of the B. mojavensis P1709. To check the assumption, the isolate genome was investigated to reveal the presence of genes responsible for lipopeptide synthesis, and the composition of crude biosurfactants produced by the isolate was analyzed using TLC and FTIR methods.
Point 23:
L249-260: The analysis of gene size by gel electrophoresis is ineffective in identifying genes. I strongly suggest the author identify the genes by nucleotide sequence analysis
Response 23:
Yes, we agree that the genes’ size is ineffective to identify the genes. However, the size was only secondary characteristics of the genes’ revealing process.
The conclusion of the presences of the genes encoding lipopeptide synthesis was made on the basis of PCR test results with specific primers. Since this method is common and published, we do see the need to sequence the genes (Ramarathnam, 2007; Hsieh,2004).
According to the Reviewer’s comment we rewrote the sentences in order to put less stress on amplicon presence but on their length on the gel.
Hsieh, F-Ch., Li, M-Ch., Lin, T-Ch., Kao, S-Sh. Rapid Detection and Characterization of Surfactin-Producing Bacillus subtilis and Closely Related Species Based on PCR. CURRENT MICROBIOLOGY. 2004, 49, 186–191
Ramarathnam, R., Bo, Sh., Chen, Y., Fernando, D.W.G., Xuewen, G., de Kievit, T. Molecular and biochemical detection of fengycin-and bacillomycin D-producing Bacillus spp., antagonistic to fungal pathogens of canola and wheat. Canadian Journal of Microbiology. 2007, 53(7), 901-11
Сhanges in the manuscript 23
The ability of B. mojavensis P1709 to synthesize fengycins, iturins and surfactins was analyzed using PCR with the specific primers for the corresponding genes. According to the gel electrophoresis results (data not shown), only two of three genes were present in the genome of the strain investigated – fenD and srfAA. It should be added, that the approximate length of the amplicons corresponded to the expected ones (600-700 bp and 200-300 bp for fenD and srfAA genes, respectively) [12]. It can be assumed that the cultural medium of B. mojavensis P1709 contained two types of biosurfactants – fengycins and surfactins.
Point 24:
L314: How to calculate the percentage of the disease incidence? Please provide more details in the method section
Response 24
Please see the comment concerning L215 above. The method of calculation of disease incidence was added to the subsection 2.7.
Point 25:
Figure 5: Enzyme activity should be report as U g-1 or U mL-1
Response 25
All the enzyme activity levels were first expressed in U g-1 fresh weight units. Thus, on L 359-360 of the non-revised manuscript it was written that “The initial level of the enzyme activities in the cherry tomato tissue was estimated to be 27.1 and 4.2 U g-1 fresh weight, respectively”. In order to compare the dynamics of both enzymes simultaneously on one Figure, the levels of enzyme activities on the 2nd-6th days were expressed in percentage from the initial level.
To meet the recommendation of the Reviewer, we added the sentence about this calculation into the “M&M” section (subsection 2.8)
Сhanges in the manuscript 25
The activities of polyphenoloxidase and peroxidase were expressed in U g-1 fresh weight for each day of incubation for both control and APF treated variants. Further, the percentage of the two enzyme activities from the corresponding initial levels was calculated.
Author Response File:
Author Response.docx
Reviewer 2 Report
The present paper describes an interesting research about the potential use of the polipeptides produced by Bacillus mojavensis P1709 to maintain postharvesting quality in cherry tomato.
In general, the paper is interesting, quite well structured and the discussion and conclusions are based on the results shown
In general English must be checked by an English native speaker, mainly in the introduction.
I miss some citations that supports your statements, like in the lines 35-37. Also, some citations to support the fact that cited treatments are safes should be included. The statement is too general.
Material and methods is complete but in the case of the identification of the genes, results must be shown.
Line 187. described by ..... (author must be cited)
Point 2.7 should be more clearly explained the methodology
Table 1: reconfigure the table so it is easier to identify which line belongs to each procedure step
Results and discussion is good, I suggest to improve the grammar.
Line 299: You suggest that tomatoes could be dangerous in case of been consumed for 1-1.5 months daily. A tomato is a fresh product. It is not possible to be eating tomatoes from the same source for 1 month. Please check that statement because even in good storage conditions, tomatoes are distributed and consumed sooner, so that situation is not real.
There is a general lack of the use of italics from a point in the paper
Figures are shelf explanatory, but I miss a statistical analysis for the significance of the results, especially in the figure 4
Line 343-344 There are reports... After this sentence there is only one citation. This statement should be supported with more citations
In general, the paper is interesting and the results support the main goal.
Author Response
Response to Reviewer 2 Comments
Dear Reviewer, thank you for the accurate reading of our manuscript and for your comments. Below you will find the answers
Point 1:
I miss some citations that supports your statements, like in the lines 35-37. Also, some citations to support the fact that cited treatments are safes should be included. The statement is too general.
Response 1
The citations were added
The reason of higher safety of biocontrol agents was added
Сhanges in the manuscript 1
Many studies have been dedicated to alternative methods of controlling plant pests, and biological control methods are considered promising. Biological control agents include biopesticides, in particular fungicides, bactericides and other compounds, produced by microorganisms or the microorganisms themselves [5]. They are reported to be efficient but also safe for future consumers, unlike chemical fungicides, biofungicides do not degrade to toxic and persistent compounds in food or the environment [6]. Moreover, biosurfactant molecules are now widely used in the pharmaceutical industry as antioxidants, antimicrobial and anticancer agents, etc. [7]. Therefore, interest in biocontrol agents is especially high for crop treatment at the end of the growing season and for food and feed treatment after harvesting [8].
Point 2:
Material and methods is complete but in the case of the identification of the genes, results must be shown.
Response 2
Previously, we did not find it interesting for the readers, to include the picture of agarose gel into the manuscript.
However, to meet the Reviewers’ recommendation, we include it into the revised manuscript.
Сhanges in the manuscript 2
Figure 1. Revealing of the presence of fenD, ituC, and srfAA genes in the genome of B. mojavensis P1709 using PCR with specific primers followed by agarose gel electrophoresis
Point 3:
Line 187. described by ..... (author must be cited)
Response 3
Done
Сhanges in the manuscript 3
The antifungal activity was estimated as described by Caulier et. al (2019) [6].
Point 4:
Point 2.7 should be more clearly explained the methodology
Table 1: reconfigure the table so it is easier to identify which line belongs to each procedure step
Response 4
The subsection was rewritten. The Table 1 was reconfigured into the plain text.
Сhanges in the manuscript 4
Cherry tomatoes were wounded and spiked with fungal spores as described above. Ten microliters of APF (20 g L-1) or sterile water (for control) was added to each wound under sterile conditions. The fruits were incubated at 20±2 °C under sterile conditions. Every six tomato fruits used for each enzyme assay and for each day of measurement (altogether 144 fruits) were incubated separately. Defense-related enzymes polyphenoloxidase and peroxidase were assessed according to previously outlined methods [18].
Briefly, 1 g of fruit tissue was collected around each fruit wound at 2 h (initial level) and at 2nd-6th days after the beginning of the experiment. The plant tissue obtained was mixed with 10 ml of phosphate buffer (50 mmol L-1, pH 7.8, precooled at 4±2 °C) containing 1.33 mmol L-1 ethylenediaminetetraacetic acid and 1% polyvinyl pyrrolidone, ground and centrifuged at 12,000 rpm at 4±2 °C for 10 min. The supernatant was used for further investigations.
For polyphenoloxidase activity estimation, 0.2 ml of supernatant was mixed with 2.8 ml of catechol preheated for 10 min at 30 ± 2 °C. The absorbance was measured every 3 min at 398 nm. For peroxidase activity estimation, 0.2 ml of supernatant was mixed with 2.2 ml of 0.3% guaiacol (50 mmol L-1, pH 6.4) and incubated for 10 min at 30 ± 2 °C. Then, 0.6 ml of 0.3% H2O2 (50 mmol L-1, pH 6.4) was added, and the mixture was incubated for 10 min at 30 ± 2 °C. The absorbance was measured every 3 min at 470 nm. For both enzymes, 1 unit (U per gram fresh weight) was defined as increase in absorbance of 0.01 per minute.
The activities of polyphenoloxidase and peroxidase were expressed in U g-1 fresh weight for each day of measurement for both control and APF treated variants. Then, the percentage of the two enzyme activities from the corresponding initial levels was calculated.
Point 5:
Line 299: You suggest that tomatoes could be dangerous in case of been consumed for 1-1.5 months daily. A tomato is a fresh product. It is not possible to be eating tomatoes from the same source for 1 month. Please check that statement because even in good storage conditions, tomatoes are distributed and consumed sooner, so that situation is not real.
Response 5
Agree. We excluded this sentence from the manuscript
Point 6:
Figures are shelf explanatory, but I miss a statistical analysis for the significance of the results, especially in the figure 4
Response 6
As mentioned in “M&M” section, the differences between the values were estimated using the Wilcoxon signed rank test.
To meet the Reviewers’ recommendation, we added letters above columns on Figures 3 and 4 indicating the statistically significant differences. The information about the letters was also included into the captures of Figures 3 and 4.
Сhanges in the manuscript 6
Different letters above columns indicate statistically significant differences (p<0.05).
Point 7:
Line 343-344 There are reports... After this sentence there is only one citation. This statement should be supported with more citations
Response 7
References have been added.
Сhanges in the manuscript 7
There are reports that biosurfactants might also play a role in inducing plant resistance systems [4, 5, 15, 46].
Author Response File:
Author Response.docx
Reviewer 3 Report
Dear Authors
It is not clear to me why you have been looking for mycotoxins not produced by Fusarium oxysporum f-sp. lycopersici (trichothecenes, fumonisin and zearalenone) therefore not relevant to tomato and the disease caused by the pathogen.
All these data should be eliminated because not relevant to Fusarium wilt of tomato.
Bets regards,
Author Response
Response to Reviewer 3 Comments
Dear Reviewer, thank you for the accurate reading of our manuscript and for your comments. Below you will find the answers
Point 1:
It is not clear to me why you have been looking for mycotoxins not produced by Fusarium oxysporum f-sp. lycopersici (trichothecenes, fumonisin and zearalenone) therefore not relevant to tomato and the disease caused by the pathogen.
All these data should be eliminated because not relevant to Fusarium wilt of tomato.
Response 1
According to Beukes et al. (2017) and Shabeer et al. (2022), these types of toxins are more rare for Fusarium oxysporum but still can be produced by this fungus. Therefore, previously we included the immunoassays on fumonisin and zearalenone into the study.
However, since they are rare and since they were not revealed in our investigation, we meet the recommendation of the Reviewer and exclude these data from “M&M” and from “Results and Discussion” sessions.
Round 2
Reviewer 1 Report
The revised manuscript is well written and organized. It should be accepted after a minor revision.
Minor comments for the authors consideration:
“in vitro” and “in vivo” should be italicized.
P 3-4 : The authors should provide the composition of all culture media used in this study. For example, Bushnell Hass (BH) and glycerol nitrate medium.
P 4: The authors mentioned “The APF was obtained according to Nayarisseri et al. (2016) etc. [38-40].”. What is “etc.”? Why Nayarisseri et al. (2016) was indicated only?
Author Response
Dear Reviewer, thank you for your comments. According to the Reviewer’s comments, we revised manuscript.
Reviewer 2 Report
The authors have met with the changes suggested in most of cases but in others, still is not clarified or even though the correction is opening more questions about the results obtained.
Figure 4. Authors include letters from a statistical analysis, analysing both radial growth and T2-HT-2 toxins production. This analysis must be independent for 1 Radial Growth and 2 for Toxins production. Statistical analysis is not possible to be carried out in the way performed in the present form. Those are to different elements that cannot be analysed together.
Legends for Figure 4 and Figure 5 must include more information about the test performed.
Figure 5: Is strange to see letters in a growing way (a, b, c, d) and then "e "below "a" and "f" above "a". A proper order should be followed or at least to explain why was carried out in this way.
Error bars are standard deviation or standard error? Visualising different letters and error bars is difficult to see that there are significant differences
Explain what different letters means. Differences between days? Differences between treatments?
I suggest to clarify more the statistical treatment of the data because in the actual situation is difficult to understand and to conclude something.
Author Response
Dear Reviewer,
Thank you for your comments. We corrected the manuscript according to them.
Author Response File:
Author Response.docx
