Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling and Morphological Characterization
2.2. Morpho-Anatomy of the Reproductive System
2.3. Molecular Characterization
3. Results
3.1. Distribution of M. indica in Saudi Arabia
3.2. Systematics
- Class Gastropoda Cuvier, 1795
- Order Stylommatophora A. Schmidt, 1855
- Superfamily Helicarionoidea Bourguignat, 1877
- Family Ariophantidae Godwin-Austen, 1883
- Subfamily Macrochlamydinae Godwin-Austen, 1883
- Genus Macrochlamys Gray, 1847
- Macrochlamys indica Godwin-Austen, 1883
3.3. Morphological Description
3.4. Molecular Characterization
3.4.1. COI
3.4.2. 16S
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Barker, G.M. The Biology of Terrestrial Molluscs; CABI publishing: New York, NY, USA, 2001; p. 558. [Google Scholar]
- Lydeard, C.; Cowie, R.H.; Ponder, W.F.; Bogan, A.E.; Bouchet, P.; Clark, S.A.; Cummings, K.S.; Frest, T.J.; Garominy, O.; Herbert, D.G.; et al. The global decline of nonmarine mollusks. BioScience 2004, 54, 321–330. [Google Scholar] [CrossRef]
- Kerney, M.P.; Cameron, R.A.D. Field Guide to the Land Snails of BRITAIN and North-West Europe; Collins: London, UK, 1979; p. 288. [Google Scholar]
- Baur, B.; Raboud, C. Life history of the land snail Arianta arbustorum along an altitudinal gradient. J. Anim. Ecol. 1988, 57, 71–87. [Google Scholar] [CrossRef]
- Schmera, D.; Baur, B. Gastropod communities in alpine grasslands are characterized by high beta diversity. Community Ecol. 2014, 15, 246–255. [Google Scholar] [CrossRef]
- Cowie, R.H.; Robinson, D.G. Pathways of introductions of nonindigenous land and freshwater snails and slugs. In Invasive Species Vectors and Management Strategies; Carlton, J., Ruiz, G.M., Eds.; Island Press: Washington, DC, USA, 2003; pp. 93–122. [Google Scholar]
- Mc Donnell, M.J.; Hahs, A.K. Adaptation and adaptedness of organisms to urban environments. Annu. Rev. Ecol. Evol. Syst. 2015, 46, 261–280. [Google Scholar] [CrossRef]
- Robinson, D.G. Alien invasions: The effects of the global economy on nonmarine gastropod introductions into the United States. Malacologia 1999, 41, 413–438. [Google Scholar]
- Araya, J.F. Current status of the non-indigenous molluscs in Chile, with the first record of Otala punctata (Müller, 1774) (Gastropoda: Helicidae) in the country and new records for Cornu aspersum (Müller, 1774) and Deroceras laeve (Müller, 1774). J. Nat. Hist. 2015, 49, 1731–1761. [Google Scholar] [CrossRef]
- Godan, D. Pest Slugs and Snails, Biology and Control; Springer: Berlin/Heidelberg, Germany, 1983; p. 445. [Google Scholar]
- Barker, G.M. Molluscs as Crop Pests; CABI publishing: New York, NY, USA, 2002; p. 400. [Google Scholar]
- Michailides, T.J.; Morgan, D.P. Effect of snail (Helix aspersa) damage on Botrytis gray mold caused by Botrytis cinerea in kiwifruit. Plant Dis. 1996, 80, 1141–1146. [Google Scholar] [CrossRef]
- Borkakati, R.N.; Gogoi, R.; Borah, B.K. Snail: From present perspective to the history of Assam. Asian Agri-Hist. 2009, 13, 227–234. [Google Scholar]
- Valente, R.; Robles, M.D.R.; Diaz, J.I. Gastropods as intermediate hosts of Angiostrongylus spp. in the Americas: Bioecological characteristics and geographical distribution. Mem. Inst. Oswaldo Cruz 2020, 115, e200236. [Google Scholar] [CrossRef]
- Barker, G.M.; Watts, C. Management of the Invasive Alien Snail Cantareus Aspersus on Conservation Land; Doc Science Internal Series 31; Department of Conservation: Wellington, New Zealand, 2002; p. 29. [Google Scholar]
- Ramakrishna, S.; Mitra, S.C.; Dey, A. Annotated checklist of Indian land molluscs. Rec. Zool. Surv. India 2010, 306, 1–359. [Google Scholar]
- Sajan, S.; Tripathy, B.; Chandra, K.; Sivakumar, K. A new species of the genus Macrochlamys Gray, 1847 (Stylommatophora: Ariophantidae) from western Himalaya. Indian J. Nat. Hist. 2019, 53, 797–813. [Google Scholar] [CrossRef]
- Sajan, S.K.; Das, S.; Tripathy, B.; Biswas, T. Malacofaunal inventory in Chintamoni Kar Bird Sanctuary, West Bengal, India. J. Threat. Taxa 2021, 13, 17807–17826. [Google Scholar] [CrossRef]
- Kudo, K.; Kagawa, O.; Ito, S.; Wada, S.; Nishi, H.; Shariar, S.M.; Yamazaki, D.; Hirano, T.; Chiba, S. Species identification and invasion pathways of an introduced snail Macrochlamys sp. in Japan. BioInvasions Rec. 2022, 11. in press. [Google Scholar]
- Ueshima, R. Macrochlamys sp., a helicarionid land snail newly introduced to Japan: Discovery of naturalized populations in Okinawa and the possible pathway of introduction. Chiribotan 2009, 39, 116. [Google Scholar]
- Sajan, S.K.; Tripathy, B.; Biswas, T. Species inventory of land and freshwater molluscs from Andhra Pradesh and Telangana states of India. Rec. Zool. Surv. India 2018, 118, 141–155. [Google Scholar] [CrossRef]
- Singh, S.; Sandhu, R.K.; Aravind, N.A. Record of pestiferous land snail, Macrochlamys indica Godwin-Austen 1883 (Gastropoda: Ariophantidae), on citrus and guava plants in Punjab, India. Rec. Zool. Surv. India 2020, 120, 293–296. [Google Scholar]
- Raut, S.K.; Ghose, K.C. Pestiferous Land Snails of India. Tech. Monograph, No. 11; Zoological Survey of India: Calcutta, India, 1984; pp. 1–151. [Google Scholar]
- Jayashankar, M.; Reddy, M.S.; Ramakrishna, S. Incidence of the common garden snail, Macrochlamys indica Benson, 1832 (Gastropoda: Ariophantidae) in Bangalore region. Bioscan 2015, 10, 1003–1006. [Google Scholar]
- Cowie, R.H.; Dillon, R.T.; Robinson, D.G.; Smith, J.W. Alien non-marine snails and slugs of priority quarantine importance in the United States: A preliminary risk assessment. Am. Malacol. Bull. 2009, 27, 113–132. [Google Scholar] [CrossRef]
- Ahmed, S.I. Insect pest problems of neem. In Proceedings of the Workshop on Neem (Azadirachta Indica) AFRI, Jodhpur, India, 8 December 1998; pp. 15–16. [Google Scholar]
- Kumar, S.; Ahmed, S.I. New records of pestiferous land molluscs from Rajasthan, India. Rec. Zool. Surv. India 2000, 98, 67–70. [Google Scholar] [CrossRef]
- Blacket, M.J.; Shea, M.; Semeraro, L.; Malipatil, M.B. Introduced Helicidae garden snails in Australia: Morphological and molecular diagnostics, species distributions and systematics. Rec. Aust. Mus. 2016, 68, 99–116. [Google Scholar] [CrossRef]
- American Veterinary Medical Association. AVMA Guidelines for the Euthanasia of Animals. Available online: https://www.avma.org/sites/default/files/2020-02/Guidelines-on-Euthanasia-2020.pdf (accessed on 5 May 2020).
- Roy, S. Macro- and microscopic morphology of the reproductive system of the terrestrial snail Macrochlamys indica (Godwin-Austen, 1883) (Eupulmonata, Stylommatophora, Ariophantidae). Mollusc. Res. 2020, 40, 379–396. [Google Scholar] [CrossRef]
- Palumbi, S.; Martin, A.; Romano, S.; Mcmillan, W.O.; Stice, L.; Grabowwski, G. The Simple Fool’s Guide to PCR, version 2.0; Department of Zoology, University of Hawaii: Honolulu, HI, USA, 1991; p. 45. [Google Scholar]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acid. Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. Mega X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Kimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evo. 1980, 16, 111–120. [Google Scholar] [CrossRef] [PubMed]
- El-Alfy, N.Z.; Abdel-Rehim, A.H.; Al-Ali, K.A. Karyotype, meiosis and sperm formation in the land snail Macrochlamys indica. Qatar Univ. Sci. J. 1994, 14, 122–128. [Google Scholar]
- Jahan, S.M.; Kulsum, M.U.; Rahman, M.R.; Sarkar, M.M.; Pramanik, M.N. Comparative ecology of Macrochlamys indica and Macrochlamys opiparus (Stylommatophora: Ariophantidae). J. Ecobiol. 2002, 14, 307–318. [Google Scholar]
- Mitra, S.C. Pictorial Handbook-Indian Land Snails (Selected Species); Zoological Survey of India: Kolkata, India, 2005; p. 334. [Google Scholar]
- Raheem, D.C.; Taylor, H.; Ablett, J.; Preece, R.C.; Aravind, N.A.; Naggs, F. A systematic revision of the land snails of the Western Ghats of India. Trop. Nat. Hist. Supplement 2014, 4, 1–294. [Google Scholar]
- Budha, P.B.; Naggs, F.; Backeljau, T. Annotated checklist of the terrestrial gastropods of Nepal. Zookeys 2015, 492, 1–48. [Google Scholar] [CrossRef]
- Faiz, L.Z. Diversity and Damage Assessment of Snail in Cultivated Crops of Neelabut Bagh Azad Jammu and Kashmir (Pakistan). J. Biores. Manag. 2020, 7, 11. [Google Scholar] [CrossRef]
- Maassen, W.J.M. A Preliminary Checklist of the Non-Marine Molluscs of West-Malaysia “A Handlist”; Malacological Contact Group De Kreukel: Amsterdam, The Netherlands, 2001; pp. 1–161. [Google Scholar]
- Phung, C.C.; Yu, F.T.Y.; Liew, T.S. A checklist of land snails from the west coast islands of Sabah, Borneo (Mollusca, Gastropoda). ZooKeys 2017, 673, 49–104. [Google Scholar] [CrossRef] [PubMed]
- Agudo-Padrón, I.; Luz, J.S. First confirmed occurrence record of a Indo-Asiatic land snail in Brazil and the Americas. Rev. Minerva 2017, 1, 19–27. [Google Scholar]
- Chanda, A.; Mandal, B. Major pestiferous snails and slugs of Paschim Medinipur: An account on diagnosis, damage and control. Int. Res. J. Basic Appl. Sci. 2020, 5, 13–22. [Google Scholar]
- Nandy, G.; Barman, H.; Pramanik, S.; Banerjee, S.; Aditya, G. Land snail assemblages and microhabitat preferences in the urban areas of Kolkata, India. J. Urban Ecol. 2022, 8, juac004. [Google Scholar] [CrossRef]
- Blandford, W.T.; Godwin, H.H. Mollusca: Testacellidae and Zonitidae. Fauna Br. India 1908, 32, 95–96. [Google Scholar]
- Pholyotha, A.; Sutcharit, C.; Tongkerd, P.; Jeratthitikul, E.; Panha, S. Integrative systematics reveals the new land-snail genus Taphrenalla (Eupulmonata: Ariophantidae) with a description of nine new species from Thailand. Contrib. Zool. 2020, 90, 21–69. [Google Scholar] [CrossRef]
- Schileyko, A.A. Treatise on recent terrestrial pulmonate molluscs. Part 10. Ariophantidae, Ostracolethidae, Ryssotidae, Milacidae, Dyakiidae, Staffordiidae, Gastrodontidae, Zonitidae, Daudebardiidae, Parmacellidae. Ruthenica 2003, 2, 1309–1466. [Google Scholar]
- Pholyotha, A.; Sutcharit, C.; Panha, S. The land snail genus Macrochlamys Gray, 1984 from Thailand, with descriptions of five new species (Pulmonata: Ariophantidae). Raffles Bull. Zool. 2018, 66, 763–781. [Google Scholar]
- Deshmukh, P.S.; Dummalod, C.B.; Dama, L.B. A morphological study of reproductive system of pestiferous land snail Macrochlamys petrosa from Aurangabad, Maharashtra, India. DAV Int. J. Sci. 2012, 1, 68–71. [Google Scholar]
- Hyman, I.T.; Lamborena, I.; Köhler, F. Molecular phylogenetics and systematic revision of the south-eastern Australian Helicarionidae (Gastropoda, Stylommatophora). Contrib. Zool. 2017, 86, 51–95. [Google Scholar] [CrossRef]
- Hyman, I.T. Three new genera and five new species of Helicarionidae from southeastern Australia (Pulmonata: Stylommatophora: Helicarionoidea). Molluscan Res. 2007, 27, 89–104. [Google Scholar]
- Pholyotha, A.; Sutcharit, C.; Tongkerd, P.; Panha, S. Systematic revision of the limestone karst-restricted land snail genus Aenigmatoconcha (Eupulmonata: Helicarionidae), with description of a new species. Eur. J. Taxon. 2021, 767, 55–82. [Google Scholar] [CrossRef]
Region | Site | Specimen ID | Collection Date | GenBank Accession Number | Latitude | Longitude | Altitude | |
---|---|---|---|---|---|---|---|---|
COI | 16S | |||||||
Tabouk | Al-Yosif Nursery | SATN2a | 29.X.2020 | OK559635 | OK559650 | N28.429333 | E36.62695 | 739 |
SATN2b | OK559636 | OK559651 | ||||||
SATN2c | OK559637 | OK559652 | ||||||
SATN2d | OK559638 | OK559653 | ||||||
SATN2e | OK559639 | OK559654 | ||||||
SATN2f | OK559633 | OK559648 | ||||||
SATN2g | OK559634 | OK559649 | ||||||
Magic Rose Nursery | SATN18a | 6.VI.2021 | OK559640 | OK559655 | N28.428683 | E36.6120166 | 757 | |
SATN18b | OK559641 | OK559656 | ||||||
Riyadh | Al-Hair Nursery | SARN2a | 11.IV.2021 | OK559629 | OK559644 | N24.520694 | E46.7771120 | 657 |
SARN2b | OK559630 | OK559645 | ||||||
Nursery 10 | SARN3a | 11.IV.2021 | OK559631 | OK559646 | N24.587879 | E46.7227594 | 668 | |
SARN3b | OK559632 | OK559647 | ||||||
Al-Habry Nursery | SARN7a | 5.II.2022 | ON469564 | ON468668 | E24.7724166 | N46.667567 | 662 | |
SARN7b | ON469565 | ON468669 | ||||||
Taif | Bostan Al-Zohor Nursery | SAFN16a | 2.X.2021 | ON469568 | ON468672 | N21.269283 | E40.4070333 | 1679 |
SAFN16b | ON469569 | ON468673 | ||||||
Wardet Al-Soltan Nursery | SAFN17a | 2.X.2021 | - | - | N21.340683 | E40.4401166 | 1609 | |
SAFN17b | ||||||||
Rose City nursery | SAFN24a | 2.X.2021 | - | - | N21.280333 | E40.403112 | 1659 | |
Jazan | Alam Domiat Nursery | SAJN9a | 28.XI.2020 | OK559642 | OK559657 | N17.83765 | E42.38015 | 255 |
Al-Ahsaa | My Garden Nursery | SAHN23a | 4.XI.2021 | ON469566 | ON468670 | N25.34842 | E49.57065 | 140 |
SAHN23b | ON469567 | ON468671 | ||||||
Abha | Abeer Alworod Nursery | SAAN4a | 2.III.2022 | ON469570 | ON468674 | N18.58080 | E42.70048 | 2150 |
SAAN4b | ON469571 | ON468675 | ||||||
Al-Madinah | Al-Wafy Nursery | SAMN1a | 30.III.2022 | ON469572 | ON468676 | N24.5468 | E39.57833 | 617 |
SAMN1b | ON469573 | ON468677 | ||||||
Al-Qassim | Al-Fatah Nursery | SAQN1a | 13.V.2022 | - | - | N26.385945 | E44.064817 | 650 |
Gene | Primer-Pairs (5’-3’) | Cycling Conditions | Reference |
---|---|---|---|
COI | LCO1490: GGTCAACAAATCATAAAGATATTGG HCO2198: TAAACTTCAGGGTGACCAAAAAATCA | 94°: 5 min; 94°: 30 s, 42°: 1 min, 72°: 1 min, 35 cycles; 72°: 5 min | Folmer et al. 1994 [32] |
16S | 16SAR: CGCCTGTTTATCAAAAACAT 16SBR: CCGGTCTGAACTCAGATCACGT | 94°: 5 min; 94°: 30 s, 50°: 1 min, 72°: 1 min, 35 cycles; 72°: 5 min | Palumbi et al. 1991 [33] |
Characters | Means ± SD | Ranges |
---|---|---|
Number of shell whorls | 5.42 ± 0.26 | 5.00–6.25 |
Shell width SW (mm) | 17.32 ± 1.78 | 11.35–22.65 |
Shell height SH (mm) | 9.76 ± 1.02 | 8.00–12.20 |
Aperture width AW (mm) | 9.21 ± 0.91 | 7.30–12.55 |
Aperture height AH (mm) | 7.82 ± 0.64 | 6.60–8.65 |
Height of spire HSP | 1.38 ± 0.25 | 1.00–1.95 |
Height of the body whorl HBW (mm) | 6.22 ± 0.63 | 5.00–7.75 |
SH/SW ratio | 0.57 ± 0.08 | 0.39–0.81 |
AH/AW ratio | 0.85 ± 0.08 | 0.86–1.14 |
AW/HSP ratio | 6.91 ± 1.36 | 10.04–4.40 |
HBW/AH ratio | 0.80 ± 0.09 | 1.01–0.63 |
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
MH819411 Macrochlamys India (1) | |||||||||||||||
EF015438 Macrochlamys Australia (2) | 0.002 | ||||||||||||||
LC365425 Macrochlamys Japan (3) | 0.002 | 0.000 | |||||||||||||
MT803095 Sarika Thailand (4) | 0.008 | 0.006 | 0.006 | ||||||||||||
MF476193 Macrochlamys India (5) | 0.028 | 0.026 | 0.026 | 0.024 | |||||||||||
SARN2a Macrochlamys indica SA (6) | 0.006 | 0.004 | 0.004 | 0.002 | 0.022 | ||||||||||
MT364985 Macrochlamys tanymentula Thailand (7) | 0.127 | 0.129 | 0.129 | 0.131 | 0.149 | 0.129 | |||||||||
MT906154 Macrochlamys sp. Thailand (8) | 0.141 | 0.143 | 0.143 | 0.139 | 0.160 | 0.141 | 0.115 | ||||||||
MT894116 Sarika dugasti Thailand (9) | 0.127 | 0.129 | 0.129 | 0.127 | 0.139 | 0.125 | 0.107 | 0.093 | |||||||
MT894098 Sarika hainesi Thailand (10) | 0.121 | 0.123 | 0.123 | 0.121 | 0.133 | 0.119 | 0.113 | 0.105 | 0.091 | ||||||
MT894066 Sarika resplendens Thailand (11) | 0.127 | 0.129 | 0.129 | 0.127 | 0.141 | 0.125 | 0.117 | 0.107 | 0.079 | 0.071 | |||||
MT894063 Sarika resplendens Thailand (12) | 0.125 | 0.127 | 0.127 | 0.125 | 0.139 | 0.123 | 0.117 | 0.109 | 0.079 | 0.069 | 0.002 | ||||
MT894068 Sarika resplendens Thailand (13) | 0.127 | 0.129 | 0.129 | 0.127 | 0.139 | 0.125 | 0.111 | 0.105 | 0.077 | 0.067 | 0.012 | 0.014 | |||
MT894067 Sarika resplendens Thailand (14) | 0.125 | 0.127 | 0.127 | 0.125 | 0.139 | 0.123 | 0.109 | 0.095 | 0.083 | 0.048 | 0.036 | 0.038 | 0.032 | ||
MT894065 Sarika resplendens Thailand (15) | 0.127 | 0.129 | 0.129 | 0.127 | 0.141 | 0.125 | 0.119 | 0.111 | 0.081 | 0.071 | 0.004 | 0.002 | 0.016 | 0.040 | |
KU869819 Helix pomatia (16) | 0.214 | 0.216 | 0.216 | 0.216 | 0.236 | 0.216 | 0.206 | 0.200 | 0.194 | 0.192 | 0.198 | 0.198 | 0.194 | 0.190 | 0.200 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abobakr, Y.; Al-Sarar, A.S.; Alzabib, A.A.; Saleh, A.A. Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia. Agriculture 2022, 12, 1756. https://doi.org/10.3390/agriculture12111756
Abobakr Y, Al-Sarar AS, Alzabib AA, Saleh AA. Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia. Agriculture. 2022; 12(11):1756. https://doi.org/10.3390/agriculture12111756
Chicago/Turabian StyleAbobakr, Yasser, Ali S. Al-Sarar, Ali A. Alzabib, and Amgad A. Saleh. 2022. "Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia" Agriculture 12, no. 11: 1756. https://doi.org/10.3390/agriculture12111756
APA StyleAbobakr, Y., Al-Sarar, A. S., Alzabib, A. A., & Saleh, A. A. (2022). Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia. Agriculture, 12(11), 1756. https://doi.org/10.3390/agriculture12111756