Sub-Lethal Effects of Lecanicillium lecanii (Zimmermann)-Derived Partially Purified Protein and Its Potential Implication in Cotton (Gossypium hirsutum L.) Defense against Bemisia tabaci Gennadius (Aleyrodidae: Hemiptera)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cultures of Plants and Insects
2.2. Culture of L. lecanii
2.3. Extraction and Partial Purification of Crude Protein
2.4. Protein Sub-Lethal Activitiy Bioassay against B. tabaci
2.5. Extraction of RNA and cDNA Synthesis
2.6. Reverse-Transcription Quantitative PCR
2.7. Statistical Analysis
3. Results
3.1. Necrosis Induced in Nicotiana tabacum Leaves by the Protein Derived from L. lecanii
3.2. Impact of Protein Derived from L. lecanii on the Fecundity of B. tabaci
3.3. Impact of L. lecanii-Derived Protein on Expressions of SA and JA Pathway Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Oliveira, M.; Henneberry, T.; Anderson, P. History, Current Status, and Collaborative Research Projects for Bemisia tabaci. Crop. Prot. 2001, 20, 709–723. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Mbata, G.N.; Punnuri, S.; Simmons, A.M.; Shapiro-Ilan, D.I. Bemisia tabaci on Vegetables in the Southern United States: Incidence, Impact, and Management. Insects 2021, 12, 198. [Google Scholar] [CrossRef]
- Castle, S.J.; Merten, P.; Prabhaker, N. Comparative Susceptibility of Bemisia tabaci to Imidacloprid in field and Laboratory-Based Bioassays. Pest Manag. Sci. 2014, 70, 1538–1546. [Google Scholar] [CrossRef] [PubMed]
- Basit, M.; Saeed, S.; Saleem, M.A.; Sayyed, A.H. Can Resistance in Bemisia tabaci (Homoptera: Aleyrodidae) be Overcome with Mixtures of Neonicotinoids and Insect Growth Regulators? Crop Prot. 2013, 44, 135–141. [Google Scholar] [CrossRef]
- Longhurst, C.; Babcock, J.M.; Denholm, I.; Gorman, K.; Thomas, J.D.; Sparks, T.C. Cross-Resistance Relationships of the sul-Foximine Insecticide Sulfoxaflor with Neonicotinoids and other Insecticides in the Whiteflies Bemisia tabaci and Trialeurodes vaporariorum. Pest Manag. Sci. 2013, 69, 809–813. [Google Scholar] [CrossRef]
- Kaur, G.; Kaur, H. Environmental Hazards of Pesticide in Agriculture. Ecol. Environ. Conserv. 2007, 13, 83. [Google Scholar]
- Quesada-Moraga, E.; Carrasco-Diaz, J.-A.; Santiago-Alvarez, C. Insecticidal and Antifeedant Activities of Proteins Secreted by Entomopathogenic fungi against Spodoptera littoralis (Lep., Noctuidae). J. Appl. Èntomol. 2006, 130, 442–452. [Google Scholar] [CrossRef]
- Khan, S.; Guo, L.; Maimaiti, Y.; Mijit, M.; Qiu, D. Entomopathogenic fungi as Microbial Biocontrol Agent. Mol. Plant Breed. 2012, 3. [Google Scholar] [CrossRef]
- Fiaz, M.; Afzal, M.; Majeed, M.Z. Synergistic Action of Isaria fumosorosea Wize (Hypocreales: Cordycipitaceae) and Spirotetramat against Asian Citrus Psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae) under Field Conditions. Pak. J. Agric. Res. 2018, 31, 106–201. [Google Scholar] [CrossRef]
- Corallo, A.B.; Pechi, E.; Bettucci, L.; Tiscornia, S. Biological Control of the Asian Citrus Psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae) by Entomopathogenic Fungi and their Side Effects on Natural Enemies. Egypt. J. Biol. Pest Control. 2021, 31, 1–9. [Google Scholar] [CrossRef]
- Xie, T.; Jiang, L.; Li, J.; Hong, B.; Wang, X.; Jia, Y. Effects of Lecanicillium lecanii Strain JMC-01 on the Physiology, Biochemistry, and Mortality of Bemisia tabaci Q-Biotype Nymphs. PeerJ 2019, 7, e7690. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, L.; Cheng, B.; Du, D.; Hu, X.; Peng, A.; Pu, Z.; Zhang, X.; Huang, Z.; Chen, G. Morphological, Molecular and virulence Characterization of Three Lencanicillium Species Infecting Asian Citrus Psyllids in Huangyan Citrus Groves. J. Invertebr. Pathol. 2015, 125, 45–55. [Google Scholar] [CrossRef]
- Lin, Y.; Lin, S.; Akutse, K.S.; Hussain, M.; Wang, L. Diaphorina citri Induces Huanglongbing-Infected Citrus Plant Volatiles to Repel and Reduce the Performance of Propylaea Japonica. Front. Plant Sci. 2016, 7. [Google Scholar] [CrossRef] [Green Version]
- Ravindran, K.; Sivaramakrishnan, S.; Hussain, M.; Dash, C.K.; Bamisile, B.S.; Qasim, M.; Liande, W. Investigation and mo-Lecular Docking Studies of Bassianolide from Lecanicillium lecanii against Plutella xylostella (Lepidoptera: Plutellidae). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2018, 206, 65–72. [Google Scholar] [CrossRef]
- Vey, A.; Hoagland, R.E.; Butt, T.M. Toxic Metabolites of Fungal Biocontrol Agents. In Fungi as Biocontrol Agents: Progress, Problems and Potential; Butt, T.M., Jackson, C.W., Magan, N., Eds.; CABI: Wallingford, OX, USA, 2001; pp. 311–346. [Google Scholar] [CrossRef]
- Ballard, C.; Yu, H.; Wang, B. Recent Developments in Depsipeptide Research. Curr. Med. Chem. 2002, 9, 471–498. [Google Scholar] [CrossRef] [PubMed]
- Uchida, R.; Imasato, R.; Yamaguchi, Y.; Masuma, R.; Shiomi, K.; Tomoda, H.; Ōmura, S. New Insecticidal Antibiotics, Hydroxyfungerins A and B, Produced by Metarhizium sp. FKI-1079. J. Antibiot. 2005, 58, 804–809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lozano-Tovar, M.D.; Ortiz-Urquiza, A.; Garrido-Jurado, I.; Trapero-Casas, A.; Quesada-Moraga, E. Assessment of Entomopathogenic Fungi and Their Extracts against a Soil-Dwelling Pest and Soil-Borne Pathogens of Olive. Biol. Control 2013, 67, 409–420. [Google Scholar] [CrossRef]
- Farooq, M.; Freed, S. Insecticidal Activity of Toxic Crude Proteins Secreted by Entomopathogenic Fungi against Musca domes-tica L. (Diptera: Muscidae). Kuwait J. Sci. 2018, 45, 64–74. [Google Scholar]
- Nazir, T.; Basit, A.; Hanan, A.; Majeed, M.; Qiu, D. In Vitro Pathogenicity of Some Entomopathogenic Fungal Strains against Green Peach Aphid Myzus persicae (Homoptera: Aphididae). Agronomy 2018, 9, 7. [Google Scholar] [CrossRef] [Green Version]
- Hanan, A.; Nazir, T.; Basit, A.; Ahmad, S.; Qiu, D. Potential of Lecanicillium lecanii (Zimm.) as a Microbial Control Agent for Green Peach Aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). Pak. J. Zool. 2019, 52. [Google Scholar] [CrossRef]
- Keerio, A.U.; Nazir, T.; Abdulle, Y.A.; Jatoi, G.H.; Gadhi, M.A.; Anwar, T.; Sokea, T.; Qiu, D. In Vitro Pathogenicity of the Fungi Beauveria bassiana and Lecanicillium lecanii at Different Temperatures against the Whitefly, Bemisia tabaci (Genn.) (Hemiptera: Aleyrodidae). Egypt. J. Biol. Pest Control. 2020, 30, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Abdulle, Y.A.; Nazir, T.; Keerio, A.U.; Ali, H.; Zaman, S.; Anwar, T.; Nam, T.D.; Qiu, D. In Vitro Virulence of Three Lecanicil-lium lecanii Strains against the Whitefly, Bemisia tabaci (Genn.) (Hemiptera: Aleyrodidae). Egypt. J. Biol. Pest Control 2020, 30, 1–6. [Google Scholar] [CrossRef]
- Thaler, J.S.; Humphrey, P.T.; Whiteman, N.K. Evolution of Jasmonate and Salicylate Signal Crosstalk. Trends Plant Sci. 2012, 17, 260–270. [Google Scholar] [CrossRef]
- Diezel, C.; von Dahl, C.C.; Gaquerel, E.; Baldwin, I.T. Different Lepidopteran Elicitors Account for Cross-Talk in Herbivory-induced Phytohormone Signaling. Plant Physiol. 2009, 150, 1576–1586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, J.; Baldwin, I.T. Herbivory-Induced Signalling in Plants: Perception and Action. Plant Cell Environ. 2009, 32, 1161–1174. [Google Scholar] [CrossRef] [PubMed]
- Moran, P.J.; Cheng, Y.; Cassell, J.L.; Thompson, G.A. Gene Expression Profiling of Arabidopsis thaliana in Compatible Plant-aphid Interactions. Arch. Insect Biochem. Physiol. 2002, 51, 182–203. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Luan, J.; Qi, J.; Huang, C.; Li, M.; Zhou, X.; Liu, S. Begomovirus–Whitefly Mutualism is Achieved through Repression of Plant Defences by a Virus Pathogenicity Factor. Mol. Ecol. 2012, 21, 1294–1304. [Google Scholar] [CrossRef]
- Basit, A.; Hanan, A.; Nazir, T.; Majeed, M.Z.; Qiu, D. Molecular and Functional Characterization of Elicitor PeBC1 Extracted from Botrytis cinerea Involved in the Induction of Resistance against Green Peach Aphid (Myzus Persicae) in Common Beans (Phaseolus vulgaris L.). Insects 2019, 10, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanan, A.; Basit, A.; Nazir, T.; Majeed, M.Z.; Qiu, D. Anti-Insect Activity of a Partially Purified Protein Derived from the Entomopathogenic Fungus Lecanicillium lecanii (Zimmermann) and its Putative Role in a Tomato Defense Mechanism against Green Peach Aphid. J. Invertebr. Pathol. 2019, 170, 107282. [Google Scholar] [CrossRef]
- Maffei, M.E.; Arimura, G.-I.; Mithöfer, A. Natural Elicitors, Effectors and Modulators of Plant Responses. Nat. Prod. Rep. 2012, 29, 1288–1303. [Google Scholar] [CrossRef]
- Molnár, I.; Gibson, D.M.; Krasnoff, S.B. Secondary metabolites from entomopathogenic Hypocrealean fungi. Nat. Prod. Rep. 2010, 27, 1241–1275. [Google Scholar] [CrossRef]
- Yu, G.; Xie, L.; Li, J.-T.; Sun, X.; Zhang, H.; Du, Q.; Li, Q.; Zhang, S.; Pan, H. Isolation, Partial Characterization, and Cloning of an Extracellular Chitinase from the Entomopathogenic Fungus Verticillium lecanii. Genet. Mol. Res. 2015, 14, 2275–2289. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, H.Q.; Quyen, D.T.; Nguyen, S.L.T.; Vu, V.H. An Extracellular Antifungal Chitinase from Lecanicillium lecanii: Purification, Properties, and Application in Biocontrol against Plant Pathogenic fungi. Turk. J. Boil. 2015, 39, 6–14. [Google Scholar] [CrossRef]
- Keerio, A.U.; Nazir, T.; Anwar, T.; Majeed, M.Z.; Abdulle, Y.A.; Jatoi, G.H.; Gadhi, M.A.; Qiu, D. Sub-Lethal Effects of Partially Purified Protein Extracted from Beauveria bassiana (Balsamo) and Its Presumptive Role in Tomato (Lycopersicon esculentum L.) Defense against Whitefly (Bemisia tabaci Genn.). Insects 2020, 11, 574. [Google Scholar] [CrossRef]
- Gurulingappa, P.; McGee, P.A.; Sword, G. Endophytic Lecanicillium lecanii and Beauveria bassiana reduce the Survival and Fecundity of Aphis Gossypii Following Contact with Conidia and Secondary Metabolites. Crop. Prot. 2011, 30, 349–353. [Google Scholar] [CrossRef]
- Moran, P.J.; Thompson, G.A. Molecular Responses to Aphid Feeding in Arabidopsis in Relation to Plant Defense Pathways. Plant Physiol. 2001, 125, 1074–1085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schaller, F.; Schaller, A.; Stintzi, A. Biosynthesis and Metabolism of Jasmonates. J. Plant Growth Regul. 2004, 23, 179–199. [Google Scholar] [CrossRef]
- Ali, J.; Agrawal, A.A. Specialist Versus Generalist Insect Herbivores and Plant Defense. Trends Plant Sci. 2012, 17, 293–302. [Google Scholar] [CrossRef] [PubMed]
- Coppola, V.; Coppola, M.; Rocco, M.; Digilio, M.C.; D’Ambrosio, C.; Renzone, G.; Martinelli, R.; Scaloni, A.; Pennacchio, F.; Rao, R.; et al. Transcriptomic and Proteomic Analysis of a Compatible Tomato-Aphid Interaction Reveals a Predominant Salicylic Acid-Dependent Plant Response. BMC Genom. 2013, 14, 515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nazir, T.; Hanan, A.; Basit, A.; Majeed, M.Z.; Anwar, T.; Nawaz, I.; Qiu, D. Putative Role of a Yet Uncharacterized Protein Elicitor PeBb1 Derived from Beauveria bassiana ARSEF 2860 Strain against Myzus persicae (Homoptera: Aphididae) in Brassi-ca rapa ssp. Pekinensis. Pathogens 2020, 9, 111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Basit, A.; Nazir, T.; Hanan, A.; Majeed, M.Z.; Farhan, M.; Qiu, D.; Wang, Y. MAMP-Triggered Resistance induced by Elicitor Protein PeBA1 Derived from Bacillus amyloliquefaciens NC6 in Common Bean (Phaseolus vulgaris L.) against Green Peach Aphid (Myzus persicae Sulzer). Not. Bot. Horti Agrobot. Cluj-Napoca 2020, 48, 705–715. [Google Scholar] [CrossRef]
Genes | Forward Primer | Reverse Primer |
---|---|---|
β-ACTIN | GATTCCGTTGTCCAGAAGTCCT | TACGGTCTGCAATACCAGGGA |
OPR3 | ATGTGACGCAACCTCGTTATC | CCGCCACTACACATGAAAGTT |
PPO1 | GGTGATAAGCGACAGCCATT | GGAGTGATGAGCGAAGAACA |
COI1 | ACCACTGCTTGTTAATCCA | CACCTTCTTCATCCTCCATT |
LOX1 | GCCAAGGAGAGCTTCAAGAAT | TAGGGGTACTTGGCAGAACCT |
UBQ7 | GAATGTGGCGCCGGGACCTTC | ACTCAATCCCCACCAGCCTTCTGG |
AOS | AGGATTACCAGAGACTGTATGAT | ATGCCACCGAATGAATTGAA |
Source of Variance | Degree of Freedom | Sum of Squares | Mean Sum of Squares | F-Value | p-Value * |
---|---|---|---|---|---|
Concentration | 3 | 181.197 | 60.3990 | 62.51 | <0.001 |
Time | 6 | 17.043 | 2.8405 | 2.94 | <0.05 |
Concentration × time | 18 | 39.008 | 2.1671 | 2.24 | <0.05 |
Error | 252 | 243.504 | 0.9663 | ||
Total | 279 | 480.751 | |||
Grand mean/Coefficient of variation | 4.2786/22.97 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdulle, Y.A.; Nazir, T.; Sayed, S.; Mahmoud, S.F.; Majeed, M.Z.; Aslam, H.M.U.; Iqbal, Z.; Nisar, M.S.; Keerio, A.U.; Ali, H.; et al. Sub-Lethal Effects of Lecanicillium lecanii (Zimmermann)-Derived Partially Purified Protein and Its Potential Implication in Cotton (Gossypium hirsutum L.) Defense against Bemisia tabaci Gennadius (Aleyrodidae: Hemiptera). Agriculture 2021, 11, 778. https://doi.org/10.3390/agriculture11080778
Abdulle YA, Nazir T, Sayed S, Mahmoud SF, Majeed MZ, Aslam HMU, Iqbal Z, Nisar MS, Keerio AU, Ali H, et al. Sub-Lethal Effects of Lecanicillium lecanii (Zimmermann)-Derived Partially Purified Protein and Its Potential Implication in Cotton (Gossypium hirsutum L.) Defense against Bemisia tabaci Gennadius (Aleyrodidae: Hemiptera). Agriculture. 2021; 11(8):778. https://doi.org/10.3390/agriculture11080778
Chicago/Turabian StyleAbdulle, Yusuf Ali, Talha Nazir, Samy Sayed, Samy F. Mahmoud, Muhammad Zeeshan Majeed, Hafiz Muhammad Usman Aslam, Zubair Iqbal, Muhammad Shahid Nisar, Azhar Uddin Keerio, Habib Ali, and et al. 2021. "Sub-Lethal Effects of Lecanicillium lecanii (Zimmermann)-Derived Partially Purified Protein and Its Potential Implication in Cotton (Gossypium hirsutum L.) Defense against Bemisia tabaci Gennadius (Aleyrodidae: Hemiptera)" Agriculture 11, no. 8: 778. https://doi.org/10.3390/agriculture11080778
APA StyleAbdulle, Y. A., Nazir, T., Sayed, S., Mahmoud, S. F., Majeed, M. Z., Aslam, H. M. U., Iqbal, Z., Nisar, M. S., Keerio, A. U., Ali, H., & Qiu, D. (2021). Sub-Lethal Effects of Lecanicillium lecanii (Zimmermann)-Derived Partially Purified Protein and Its Potential Implication in Cotton (Gossypium hirsutum L.) Defense against Bemisia tabaci Gennadius (Aleyrodidae: Hemiptera). Agriculture, 11(8), 778. https://doi.org/10.3390/agriculture11080778