Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling and Extraction of Total RNA from Subcutaneous Adipose Tissue
2.2. Single-Strand cDNA Synthesis
2.3. Quantitative Real-Time PCR Analysis
2.4. Statistical Analysis
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Campanile, G.; Di Palo, R.; Infascelli, F.; Gasparrini, B.; Neglia, G.; Zicarelli, F.; D’Occhio, M.J. In-fluence of rumen protein degradability on productive and reproductive performance in buffalo cows. Reprod. Nutr. Dev. 2003, 43, 557–566. [Google Scholar] [CrossRef] [PubMed]
- Cutrignelli, M.I.; Piccolo, G.; D’Urso, S.; Calabrò, S.; Bovera, F.; Tudisco, R.; Infascelli, F. Urinary excretion of purine derivatives in dry buffalo and Fresian cows. Ital. J. Anim. Sci. 2007, 6, 563–566. [Google Scholar] [CrossRef]
- Calabrò, S.; Infascelli, F.; Tudisco, R.; Musco, N.; Grossi, M.; Monastra, G.; Cutrignelli, M.I. Estimation of in vitro methane production in buffalo and cow. Buffalo Bull. 2013, 32, 924–927. [Google Scholar]
- Tufarelli, V.; Dario, M.; Laudadio, V. Diet composition and milk characteristics of Mediterranean water buffaloes reared in Southeastern Italy during spring season. Livest. Res. Rural Dev. 2008, 20, 10. [Google Scholar]
- Tudisco, R.; Cutrignelli, M.I.; Calabrò, S.; Grossi, M.; Musco, N.; Monastra, G.; Infascelli, F. Milk CLA content and Δ9 desaturase activity in buffalo cows along the lactation. Buffalo Bull. 2013, 32, 1330–1333. [Google Scholar]
- Becskei, Z.; Savić, M.; Ćirković, D.; Rašeta, M.; Puvača, N.; Pajić, M.; Đorđević, S.; Paskaš, S. Assessment of Water Buffalo Milk and Traditional Milk Products in a Sustainable Production System. Sustainability 2020, 12, 6616. [Google Scholar] [CrossRef]
- Infascelli, F.; Gigli, S.; Campanile, G. Buffalo meat production: Performance infra vitam and quality of meat. Vet. Res. Commun. 2004, 28, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Giordano, G.; Guarini, P.; Ferrari, P.; Biondi-Zoccai, G.; Schiavone, A.; Giordano, A. Beneficial impact on cardiovascular risk profile of water buffalo meat consumption. Eur. J. Clin. Nutr. 2010, 64, 1000–1006. [Google Scholar] [CrossRef] [PubMed]
- Cavaliere, G.; Trinchese, G.; Musco, N.; Infascelli, F.; De Filippo, C.; Mastellone, V.; Morittu, V.M.; Lombardi, P.; Tudisco, R.; Grossi, M.; et al. Milk from cows fed a diet with a high forage: Concentrate ratio improves inflammatory state, oxidative stress, and mitochondrial function in rats. J. Dairy Sci. 2018, 101, 1843–1851. [Google Scholar] [CrossRef] [PubMed]
- Griinari, J.M.; Bauman, D.E. Biosynthesis of conjugated linoleic acid and its incorporation into meat and milk in ruminants 1999. In Advances in Conjugated Linoleic Acid Reserch; Yurawecz, M.P., Mossoba, M.M., Kramer, J.K.G., Pariza, M.W., Nelson, G.J., Eds.; AOCS Press: Champaign, IL, USA, 2003; Volume 1, pp. 180–220. [Google Scholar]
- Griinari, J.M.; Corl, B.A.; Lacy, S.H.; Chouinard, P.Y.; Nurmela, K.V.V.; Bauman, D.E. Conjugated Linoleic Acid Is Synthesized Endogenously in Lactating Dairy Cows by D9-Desaturase. J. Nutr. 2000, 130, 2285–2291. [Google Scholar] [CrossRef]
- Lock, A.L.; Garnsworthy, P.C. Independent effects of dietary linoleic and linolenic fatty acids on the conjugated linoleic acid content of cow’s milk. Anim. Sci. 2002, 74, 163–176. [Google Scholar] [CrossRef]
- Piperova, L.S.; Sampugna, J.; Teter, B.B.; Kalscheur, K.F.; Yurawecz, M.P.; Ku, Y.; Morehouse, K.M.; Erdman, R.A. Duodenal and Milk Trans Octadecenoic Acid and Conjugated Linoleic Acid (CLA) Isomers Indicate that Postabsorptive Synthesis Is the Predominant Source of cis-9-Containing CLA in Lactating Dairy Cows. J. Nutr. 2002, 132, 1235–1241. [Google Scholar] [CrossRef]
- Kay, J.K.; Mackle, T.R.; Auldist, M.J.; Thompson, N.A.; Bauman, D.E. Endogenous synthesis of cis-9, trans-11 conjugated linoleic acid in pasture-fed dairy cows. J. Dairy Sci. 2002, 85, 176. [Google Scholar] [CrossRef]
- Loor, J.J.; Herbein, J.H.; Polan, C.E. Trans18:1 and 18:2 Isomers in Blood Plasma and Milk Fat of Grazing Cows Fed a Grain Supplement Containing Solvent-Extracted or Mechanically Extracted Soybean Meal. J. Dairy Sci. 2002, 85, 1197–1207. [Google Scholar] [CrossRef]
- Gillis, M.H.; Duckett, S.K.; Sackman, J.S.; Keisler, D.H. Effect of rumen-protected conjugated linoleic acid (CLA) or linoleic acid on leptin and CLA content of bovine adipose depots. J. Anim. Sci. 2003, 81, 12. [Google Scholar]
- Bolte, M.R.; Hess, B.W.; Means, W.J.; Moss, G.E.; Rule, D.C. Feeding lambs high-oleate or high linoleate safflower seeds differentially influences carcass fatty acid composition. J. Anim. Sci. 2002, 80, 609–616. [Google Scholar] [CrossRef]
- Yurawecz, M.P.; Roach, J.A.G.; Sehat, N.; Mossoba, M.M.; Kramer, J.K.G.; Fritsche, J.; Steinhart, H.; Ku, Y. A new conjugated linoleic acid isomer, 7 trans, 9 cis-octadecadienoic acid, in cow milk, cheese beef and human milk and adipose tissue. Lipids 1998, 33, 803–809. [Google Scholar] [CrossRef] [PubMed]
- Parodi, P.W. Conjugated linoleic acid and other anticarcinogenic agents of bovine milk fat. J. Dairy Sci. 1999, 82, 1339–1349. [Google Scholar] [CrossRef]
- Ward, R.J.; Travers, M.T.; Richards, S.E.; Vernon, R.G.; Salter, A.M.; Buttery, P.J.; Barber, M.C. Stearoyl-CoA desaturase mRNA is transcribed from a single gene in the ovine genome. Biochim. Biophys. Acta 1998, 1391, 145–156. [Google Scholar] [CrossRef]
- Chung, M.; Ha, S.; Jeong, S.; Bok, J.; Cho, K.; Baik, M.; Choi, Y. Cloning and characterization of bovine stearoyl CoA desaturasel cDNA from adipose tissues. Biosci. Biotechnol. Biochem. 2000, 64, 1526–1530. [Google Scholar] [CrossRef] [PubMed]
- Bernard, L.; Leroux, C.; Hayes, H.; Gautier, M.; Chilliard, Y.; Martin, P. Characterization of the caprine stearoyl- CoA desaturase gene and its mRNA showing an unsually long 3’-UTR sequence arising from a single exon. Gene 2001, 281, 53–61. [Google Scholar] [CrossRef]
- Moioli, B.; Orrù, L.; Catillo, G.; Congiu, G.B.; Napolitano, F. Partial sequencing of Stearoyl-CoA desaturase gene in buffalo. Ita. J. Anim. Sci. 2005, 4, 25–27. [Google Scholar] [CrossRef]
- Gu, M.; Cosenza, G.; Iannaccone, M.; Macciotta, N.P.P.; Guo, Y.; Di Stasio, L.; Pauciullo, A. The single nucleotide polymorphism g.133A > C in the stearoyl CoA desaturase gene (SCD) promoter affects gene expression and quali-quantitative properties of river buffalo milk. J. Dairy Sci. 2019, 102, 442–451. [Google Scholar] [CrossRef] [PubMed]
- Medrano, J.F.; Johnson, A.; DePeters, E.J.; Islas, A. Genetic modification of the composition of milk fat: Identification of polymorphisms within the bovine stearoyl-CoA desaturase gene. J. Dairy Sci. 1999, 82, 71. [Google Scholar]
- Martin, G.S.; Lunt, D.K.; Britain, K.G.; Smith, S.B. Postnatal development of stearoyl coenzyme A desaturase gene expression and adiposity in bovine subcutaneous adipose tissue. J. Anim. Sci. 1999, 77, 630–636. [Google Scholar] [CrossRef] [PubMed]
- Qin, N.; Bayat, A.; Trevisi, E.; Minuti, A.; Kairenius, P.; Viitala, S.; Mutikainen, M.; Leskinen, H.; Elo, K.; Kokkonen, T.; et al. Dietary supplement of conjugated linoleic acids or polyunsaturated fatty acids suppressed the mobilization of body fat reserves in dairy cows at early lactation through different pathways. J. Dairy Sci. 2018, 101, 7954–7970. [Google Scholar] [CrossRef]
- Kim, H.J.; Miyazaki, M.; Ntambi, J.M. Dietary cholesterol opposes PUFA-mediated repression of the stearoyl-CoA desaturase-1 gene by SREBP-1 independent mechanism. J. Lipid Res. 2002, 43, 1750–1757. [Google Scholar] [CrossRef]
- Ntambi, J.M. Regulation of stearoyl-CoA desaturase by polyunsatured fatty acids and cholesterol. J. Lipid Res. 1999, 40, 1549–1558. [Google Scholar] [CrossRef]
- Singh, K.; Hartley, D.G.; MC Fadden, T.B.; Mackenzie, D.D.S. Dietary fat regulates mammary stearoyl CoA desaturase expression and activity in lactating mice. J. Dairy Res. 2004, 71, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Bernard, L.; Rouel, J.; Leroux, C.; Ferlay, A.; Faulconnier, Y.; Legrand, P.; Chilliard, Y. Mammary Lipid Metabolism and Milk Fatty Acid Secretion in Alpine Goats Fed Vegetable Lipids. J. Dairy Sci. 2005, 88, 1478–1489. [Google Scholar] [CrossRef]
- Daniel, Z.C.T.R.; Wynn, R.J.; Salter, A.M.; Buttery, P.J. Differing effects of forage and concentrate diets on the oleic acid and conjugated linoleic acid content of sheep tissues: The role of stearoyl-CoA desaturase. J. Anim. Sci. 2004, 82, 747–758. [Google Scholar] [CrossRef] [PubMed]
- Tudisco, R.; Calabrò, S.; Cutrignelli, M.I.; Moniello, G.; Grossi, M.; Gonzalez, O.J.; Piccolo, V.; Infascelli, F. Influence of organic systems on Stearoyl-CoA desaturase in goat milk. Small Rum. Res. 2012, 106, 37–42. [Google Scholar] [CrossRef]
- Tudisco, R.; Grossi, M.; Calabrò, S.; Cutrignelli, M.I.; Musco, N.; Addi, A.; Infascelli, F. Influence of pasture on goat milk fatty acids and Stearoyl-CoA desaturase expression in milk somatic cells. Small Rum. Res. 2014, 122, 38–43. [Google Scholar] [CrossRef]
- Tudisco, R.; Morittu, V.M.; Addi, L.; Moniello, G.; Grossi, M.; Musco, N.; Grazioli, R.; Mastellone, V.; Pero, M.E.; Lombardi, P.; et al. Influence of pasture on stearoyl-coa desaturase and mirna 103 expression in goat milk: Preliminary results. Animals 2019, 9, 606. [Google Scholar] [CrossRef] [PubMed]
- Tudisco, R.; Chiofalo, B.; Addi, L.; Lo Presti, V.; Rao, R.; Calabro’, S.; Musco, N.; Grossi, M.; Cutrignelli, M.I.; Mastellone, V.; et al. Effect of hydrogenated palm oil dietary supplementation on milk yield and composition, fatty acids profile and Stearoyl-CoA desaturase expression in goat milk. Small Rum. Res. 2015, 132, 72–78. [Google Scholar] [CrossRef]
- Tudisco, R.; Chiofalo, B.; Lo Presti, V.; Morittu, V.M.; Moniello, G.; Grossi, M.; Musco, N.; Grazioli, R.; Mastellone, V.; Lombardi, P.; et al. Influence of feeding linseed on SCD activity in grazing goat mammary glands. Animals 2019, 9, 786. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.S.; Pinnamaneni, S.K.; Eo, S.J.; Cho, I.H.; Pyo, J.H.; Kim, C.K.; Sinclair, A.J.; Febbraio, M.A.; Watt, M.J. Saturated, but not n-6 polyunsaturated, fatty acids induce insulin resistance: Role of intramuscular accumulation of lipid metabolites. J. Appl. Physiol. 2006, 100, 1467–1474. [Google Scholar] [CrossRef]
- Pinnamaneni, S.; Southgate, R.; Febbraio, M.; Watt, M. Stearoyl CoA desaturase 1 is elevated in obesity but protects against fatty acid-induced skeletal muscle insulin resistance in vitro. Diabetologia 2006, 49, 3027–3037. [Google Scholar] [CrossRef]
- Kus, V.; Prazak, T.; Brauner, P.; Hensler, M.; Kuda, O.; Flachs, P.; Janovska, P.; Medrikova, D.; Rossmeisl, M.; Jilkova, Z.; et al. Induction of muscle thermogenesis by high-fat diet in mice: Association with obesity-resistance. Am. J. Physiol. Endocrinol. Metab. 2008, 295, E356–E367. [Google Scholar] [CrossRef] [PubMed]
- Pavan, E.; Duckett, S.K. Corn oil supplementation to steers grazing endophyte-free tall fescue. II. Effects on longissimus muscle and subcutaneous adipose fatty acid composition and stearoyl-CoA desaturase activity and expression. J. Anim. Sci. 2007, 85, 1731–1740. [Google Scholar] [CrossRef]
- Janovská, A.; Hatzinikolas, G.; Mano, M.; Gary, A. Wittert The effect of dietary fat content on phospholipid fatty acid profile is muscle fiber type dependent. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E779–E786. [Google Scholar] [CrossRef]
- Pauciullo, A.; Cosenza, G.; D’Avino, A.; Colimoro, L.; Nicodemo, D.; Coletta, A.; Feligini, M.; Marchitelli, C.; Di Berardino, D.; Ramunno, L. Sequence analysis and genetic variability of stearoyl CoA desaturase (SCD) gene in the Italian Mediterranean river buffalo. Mol. Cell. Probes 2010, 24, 407–410. [Google Scholar] [CrossRef] [PubMed]
- Pauciullo, A.; Cosenza, G.; Steri, R.; Coletta, A.; La Battaglia, A.; Di Berardino, D.; Macciotta, N.P.P.; Ramunno, L. A single nucleotide polymorphism in the promoter region of river buffalo stearoyl CoA desaturase gene (SCD) is associated with milk yield. J. Dairy Res. 2012, 79, 429–435. [Google Scholar] [CrossRef]
- Yadav, P.; Kumar, P.; Mukesh, M.; Kataria, R.S.; Yadav, A.; Mohanty, A.K.; Mishra, B.P. Kinetics of lipogenic genes expression in milk purified mammary epithelial cells (MEC) across lactation and their correlation with milk and fat yield in buffalo. Res. Vet. Sci. 2015, 99, 129–136. [Google Scholar] [CrossRef]
- Janmeda, M.; Kharadi, V.; Pandya, G.; Brahmkshtri, B.; Ramani, U.; Tyagi, K. Relative gene expression of fatty acid synthesis genes at 60 days postpartum in bovine mammary epithelial cells of Surti and Jafarabadi buffaloes. Vet. World 2017, 10, 467–476. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Li, Z.; Lu, S.; Cui, K.; Shafique, L.; Rehman, S.; Luo, C.; Wang, Z.; Ruan, J.; Qian, Q.; Liu, Q. Fatty acid biosynthesis and transcriptional regulation of Stearoyl-CoA Desaturase 1 (SCD1) in buffalo milk. BMC Genet. 2020, 21, 23. [Google Scholar] [CrossRef] [PubMed]
- AOAC. Official Methods of Analysis, 19th ed.; AOAC: Arlington, VA, USA, 2012. [Google Scholar]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and non starch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
- INRA. Alimentation Des Ruminants; INRA: Paris, France, 1978. [Google Scholar]
- Folch, J.; Lees, M.; Sloane-Stanley, G.H.S. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Christie, W.W. A simple procedure of rapid transmethylation of glycerolipids and cholesteryl esters. J. Lipid Res. 1982, 23, 1072–1075. [Google Scholar] [CrossRef]
- SAS 2000. SAS Institute, NC, USA. Available online: https://support.sas.com/en/software/system-2000-support.html (accessed on 10 October 2021).
- Calabrò, S.; Cutrignelli, M.I.; Gonzalez, O.J.; Chiofalo, B.; Grossi, M.; Tudisco, R.; Panetta, C.; Infascelli, F. Meat quality of buffalo young bulls fed faba bean as protein source. Meat Sci. 2014, 96, 591–596. [Google Scholar] [CrossRef]
- Valsta, L.M.; Tapanainen, H.; Mannisto, S. Meat fats in nutrition—A review. Meat Sci. 2005, 70, 525–530. [Google Scholar] [CrossRef] [PubMed]
- Scerra, M.; Caparra, P.; Foti, F.; Cilione, C.; Zappia, G.; Motta, C.; Scerra, V. Intramuscular fatty acid composition of lambs fed diets containing alternative protein sources. Meat Sci. 2011, 87, 229–233. [Google Scholar] [CrossRef] [PubMed]
- Cutrignelli, M.I.; Calabrò, S.; Bovera, F.; Tudisco, R.; D’Urso, S.; Marchiello, M.; Piccolo, V.; Infascelli, F. Effects of two protein sources and energy level of diet on the performance of young Marchigiana bulls. 2. Meat quality. Ital. J. Anim. Sci. 2008, 7, 271–285. [Google Scholar] [CrossRef]
- Woods, V.B.; Fearon, E.A. Dietary sources of unsaturated fatty acids for animals and their transfer into meat, milk and eggs: A review. Livest. Sci. 2009, 126, 1–20. [Google Scholar] [CrossRef]
- Hidiroglu, N.; McDowell, L.R.; Johnson, D.D. Effect of diet on animal performance, lipid composition of subcutaneous adipose tissue and liver tissue of beef cattle. Meat Sci. 1987, 20, 195–210. [Google Scholar] [CrossRef]
- Mitchell, G.E.; Reed, A.W.; Rogers, S.A. Influence of feeding regime on the sensory qualities and fatty acid contents of beefsteaks. J. Food Sci. 1991, 56, 1102–1103. [Google Scholar] [CrossRef]
- Rowe, A.; Macedo, F.A.F.; Visentainer, J.V.; Souza, N.E.; Matsushita, M. Muscle composition and fatty acid profile in lambs fattened in dry lot or pasture. Meat Sci. 1999, 51, 283–288. [Google Scholar] [CrossRef]
- Lock, A.L.; Garnsworthy, P.C. Seasonal variation in milk conjugated linoleic acid and 9-desaturase activity in dairy cows. Livest. Prod. Sci. 2003, 79, 47–59. [Google Scholar] [CrossRef]
- Schroeder, A.; Mueller, O.; Stocker, S.; Salowsky, R.; Leiber, M.; Gassmann, M.; Lightfoot, S.; Menzel, W.; Granzow, M.; Ragg, T. The RIN: An RNA integrity number for assigning integrity values to RNA measurements. BMC Mol. Biol. 2003, 7, 3. [Google Scholar] [CrossRef] [PubMed]
- Cedernaes, J.; Alsiö, J.; Västermark, Å.; Risérus, U.; Schiöth, H.B. Adipose tissue stearoyl-CoA desaturase 1 index is increased and linoleic acid is decreased in obesity-prone rats fed a high-fat diet. Lipids Health Dis. 2013, 12, 2. [Google Scholar] [CrossRef]
- Wang, Y.H.; Bower, N.I.; Reverter, A.; Tan, S.H.; De Jager, N.; Wang, R.; McWilliam, S.M.; Café, L.M.; Greenwood, P.L.; Lehnert, S.A. Gene expression patterns during intramuscular fat development in cattle. J. Anim. Sci. 2009, 87, 119–130. [Google Scholar] [CrossRef] [PubMed]
- Hiller, B.; Herdmann, A.; Nuernberg, K. Dietary n-3 Fatty Acids Significantly Suppress Lipogenesis in Bovine Muscle and Adipose Tissue: A Functional Genomics Approach. Lipids 2011, 46, 557–567. [Google Scholar] [CrossRef]
- Hiller, B.; Hocquette, J.; Cassar-Malek, I.; Nuernberg, G.; Nuernberg, K. Dietary n-3 PUFA affect lipid metabolism and tissue function-related genes in bovine muscle. Br. J. Nutr. 2012, 108, 858–863. [Google Scholar] [CrossRef] [PubMed]
- Urrutia, O.; Mendizaba, J.A.; Insausti, K.; Soret, B.; Purroy, A.; Arana, A. Effects of Addition of Linseed and Marine Algae to the Diet on Adipose Tissue Development, Fatty Acid Profile, Lipogenic Gene Expression, and Meat Quality in Lambs. PLoS ONE 2016, 11, e0156765. [Google Scholar] [CrossRef] [PubMed]
- Waters, S.M.; Kelly, J.P.; O’Boyle, P.; Moloney, A.P.; Kenny, D.A. Effect of level and duration of dietary n-3 polyunsaturated fatty acid supplementation on the transcriptional regulation of Δ9-desaturase in muscle of beef cattle. J. Anim. Sci. 2009, 87, 244–253. [Google Scholar] [CrossRef] [PubMed]
- Ebrahimi, M.; Rajion, M.A.; Goh, Y.M.; Sazili, A.Q.; Schonewille, J.T. Effect of Linseed Oil Dietary Supplementation on Fatty Acid Composition and Gene Expression in Adipose Tissue of Growing Goats. BioMed Res. Int. 2013, 2013, 194625. [Google Scholar] [CrossRef] [PubMed]
| Sequence (5′->3′) | Tm (°C) | Product Length (bp) | References | |
|---|---|---|---|---|
| GAPDH-F | TGGAAAGGCCATCACCATCT | 60 | 119 | Li et al. 2020 |
| GAPDH-R | CCCACTTGATGTTGGCAG | |||
| Actin-F | TCCTCCCTGGAGAAGAGCTA | 60 | 101 | Gu et al. 2019 |
| Actin-R | AGGAAGGAAGGCTGGAAGAG | |||
| 18S rRNA-F | CGTTCTTAGTTGGTGG | 60 | 76 | Gu et al. 2019 |
| 18S rRNA-F | GTAACTAGTTAGCATGC | |||
| SCD F | CAGCGGAAGGTCCCGA | 60 | 157 | Gu et al. 2019 |
| SCD R | CAAGTGGGCCGGCATC |
| CS | OH | LFC | HFC | LF Diet | HF Diet | SEM | |
|---|---|---|---|---|---|---|---|
| CP | 77.2 | 90.1 | 220.0 | 220.0 | 140.6 | 140.9 | 4.34 |
| EE | 21.0 | 22.2 | 24.7 | 120.7 | 23.1 B | 71.1 A | 1.92 |
| NDF | 482.2 | 560.0 | 216.1 | 233.2 | 363.0 | 381.6 | 8.46 |
| ADF | 272.1 | 370.0 | 87.6 | 103.4 | 197.5 B | 275.4 A | 12.67 |
| ADL | 31.3 | 38.1 | 12.2 | 21.4 | 24.2 | 27.3 | 1.03 |
| VFU/kg DM | 0.77 | 0.63 | 1.08 | 1.10 | 0.90 | 0.91 | 0.01 |
| LF Diet | HF Diet | |
|---|---|---|
| C14:0 | 0.02 | 0.14 |
| C16:0 | 2.29 | 7.54 |
| C16:1 | 0.02 | 0.06 |
| C18:0 | 0.62 | 1.49 |
| C18:1 cis 9 | 2.84 | 11.6 |
| C18:1 cis 11 | 0.18 | 1.07 |
| C18:2 cis 9 cis 12 | 7.97 | 28.40 |
| C18:3 cis 9 cis12 cis15 | 1.59 | 3.70 |
| C20:0 | 0.09 | 0.14 |
| C22:0 | 0.09 | 0.21 |
| LF | HF | |
|---|---|---|
| Moisture % | 75.3 | 75.4 |
| Fat % | 1.8 | 1.9 |
| Protein % | 21.4 | 21.2 |
| Ash % | 0.71 | 0.70 |
| Acids | LF | HF | SEM | |
|---|---|---|---|---|
| Myristic | C14:0 | 1.25 ± 0.2 | 1.18 ± 0.1 | 0.336 |
| Myristoleic | C14:1 cis-9 | 0.47 ± 0.07 | 0.47 ± 0.02 | 0.039 |
| Pentadecylic | C15:0 iso | 0.17 ± 0.02 | 0.16 ± 0.02 | 0.010 |
| Methyltetradecanoic | C15:0 ante iso | 0.21 ± 0.1 | 0.24 ± 0.09 | 0.009 |
| Palmitic | C16:0 | 20.9 ± 0.7 | 21.0 ± 0.9 | 0.478 |
| Palmitoleic | C16:1 | 1.13 ± 0.17 | 1.17 ± 0.04 | 0.162 |
| Margaric | C17:0 | 1.20 ± 0.3 | 1.24 ± 0.3 | 0.089 |
| Eptadecenoic | C17:1 cis-10 | 0.39 ± 0.07 | 0.41± 0.08 | 0.220 |
| Stearic | C18:0 | 25.1 ± 2.1 | 24.6 ± 1.9 | 0.370 |
| Octadecenoic | C18:1 trans-10 | 0.58 ± 0.05 | 0.62 ± 0.07 | 0.067 |
| trans-Vaccenic | C18:1 trans-11 | 1.32 ± 0.35 | 1.30 ± 0.05 | 0.067 |
| Oleic | C18:1 cis-9 | 30.55 ± 1.5 | 30.86 ± 0.6 | 0.643 |
| C18:1 cis-11 | 1.20 ± 0.09 | 1.20 ± 0.06 | 0.660 | |
| Linoleic | C18:2 ɷ-6 | 7.89 ± 0.9 | 7.92 ± 0.4 | 0.182 |
| alpha-Linolenic | C18:3 ɷ-3 | 0.59 ± 0.02 | 0.56 ± 0.02 | 0.093 |
| gamma-Linolenic | C18:3 ɷ-6 | 0.09 ± 0.01 | 0.09 ± 0.01 | 0.002 |
| Rumenic | cis 9-trans 11 CLA | 0.04 ± 0.003 | 0.05 ± 0.004 | 0.005 |
| Octa-deca Dienoic | trans10-trans12 CLA | 0.16 ± 0.01 | 0.17 ± 0.03 | 0.060 |
| Arachidic | C20:0 | 0.21 ± 0.05 | 0.24 ± 0.06 | 0.093 |
| Gondoic | C20:1 cis-11 | 0.90 ± 0.09 | 0.98 ± 0.05 | 0.025 |
| Eicosadienoic | C20:2 cis11,14 | 0.16 ± 0.06 | 0.20 ± 0.06 | 0.056 |
| Dihomo-gamma-linolenic | C20:3 ɷ-6 | 0.52 ± 0.08 | 0.40 ± 0.05 | 0.096 |
| Eicosapentaenoic | C20:3 ɷ-3 | 0.28 ± 0.05 | 0.21 ± 0.06 | 0.023 |
| Arachidonic | C20:4 ɷ-3 | 1.78 ± 0.1 | 1.62 ± 0.1 | 0.018 |
| Eicosapentanoic | C20:5 ɷ-3 | 0.21 ± 0.01 | 0.22 ± 0.03 | 0.067 |
| Behenic | C22:0 | 0.18 ± 0.01 | 0.18 ± 0.02 | 0.051 |
| Adrenic | C22:4 ɷ-6 | 0.28 ± 0.03 | 0.29 ± 0.02 | 0.078 |
| Docosapentanoic | C22:5 ɷ-3 | 0.41 ± 0.02 | 0.40 ± 0.03 | 0.049 |
| Docosahexaenoic | C22:6 ɷ-3 | 0.20 ± 0.03 | 0.20 ± 0.03 | 0.034 |
| Tricosylic | C23:0 | 0.15 ± 0.01 | 0.22 ± 0.02 | 0.012 |
| Lignoceric | C24:0 | 0.18 ± 0.02 | 0.18 ± 0.03 | 0.027 |
| Nervonic | C24:1 cis15 | 0.40 ± 0.02 | 0.40 ± 0.03 | 0.080 |
| SFA | 50.6 ± 0.47 | 49.9 ± 0.57 | 6.231 | |
| MUFA | 36.3 ± 1.3 | 36.5 ± 0.67 | 3.902 | |
| PUFA | 12.8 ± 1.2 | 13.4 ± 0.48 | 1.924 | |
| PUFA ɷ 6 | 8.78 ± 0.8 | 8.07 ± 0.4 | 1.401 | |
| PUFA ɷ 3 | 3.47 ± 0.2 | 3.21 ± 0.3 | 0.530 | |
| ɷ 6/ɷ 3 | 2.53 ± 0.3 | 2.51 ± 0.3 | 0.630 | |
| CLA | 0.231 ± 0.01 | 0.212 ± 0.01 | 0.072 | |
| C14:1 cis-9/C14:0 | 0.376 ± 0.1 | 0.398 ± 0.09 | 0.106 | |
| C16:1/C16:0 | 0.054 ± 0.02 | 0.055± 0.01 | 0.0042 | |
| C18:1 cis-9/C18:0 | 1.22 ± 0.3 | 1.25 ± 0.2 | 0.652 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iommelli, P.; Infascelli, F.; Musco, N.; Grossi, M.; Ferrara, M.; Sarubbi, F.; D’Aniello, B.; Lombardi, P.; Tudisco, R. Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile. Agriculture 2021, 11, 1209. https://doi.org/10.3390/agriculture11121209
Iommelli P, Infascelli F, Musco N, Grossi M, Ferrara M, Sarubbi F, D’Aniello B, Lombardi P, Tudisco R. Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile. Agriculture. 2021; 11(12):1209. https://doi.org/10.3390/agriculture11121209
Chicago/Turabian StyleIommelli, Piera, Federico Infascelli, Nadia Musco, Micaela Grossi, Maria Ferrara, Fiorella Sarubbi, Biagio D’Aniello, Pietro Lombardi, and Raffaella Tudisco. 2021. "Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile" Agriculture 11, no. 12: 1209. https://doi.org/10.3390/agriculture11121209
APA StyleIommelli, P., Infascelli, F., Musco, N., Grossi, M., Ferrara, M., Sarubbi, F., D’Aniello, B., Lombardi, P., & Tudisco, R. (2021). Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile. Agriculture, 11(12), 1209. https://doi.org/10.3390/agriculture11121209

