Xeno-Free Condition Enhances Therapeutic Functions of Human Wharton’s Jelly-Derived Mesenchymal Stem Cells against Experimental Colitis by Upregulated Indoleamine 2,3-Dioxygenase Activity
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation and Culture of WJ-MSCs
2.2. Flow Cytometric Analysis of Immunophenotype
2.3. In Vitro Differentiation Assay
2.4. Cumulative Population Doubling Level
2.5. Isolation and Culture of Human Umbilical Cord Blood (hUCB)-Derived Mononuclear Cells (MNCs)
2.6. CFSE Proliferation Assay
2.7. Hematopoietic Stem Cell (HSC) Expansion Analysis
2.8. Generation and Stimulation of Macrophages
2.9. Th Cell Analysis
2.10. Cell Viability Assay
2.11. Western Blot Analysis
2.12. Quantitative PCR
2.13. CFU-F Assay
2.14. Colitis Induction
2.15. Histopathologic Evaluation
2.16. Statistical Analysis
3. Results
3.1. Characterization of WJ-MSCs Cultured in FBS and XF Conditions
3.2. WJ-MSCs Expanded in XF Conditions Show Increased Adipogenesis but Reduced Osteogenic Differentiation Potential
3.3. XF Conditions Support the Hematopoietic Activity of WJ-MSCs
3.4. XF Condition Enhances the Immunosuppressive Properties of WJ-MSCs via IDO Production
3.5. XF-MSCs Regulate Helper T Cell and Macrophage Polarization
3.6. XF-MSCs Improve Protective Effects against DSS-Induced Colitis in Mice
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Hass, R.; Kasper, C.; Bohm, S.; Jacobs, R. Different populations and sources of human mesenchymal stem cells (MSC): A comparison of adult and neonatal tissue-derived MSC. Cell Commun. Signal. 2011, 9, 12. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Yamamoto, Y.; Xiao, Z.; Ochiya, T. The Immunomodulatory Functions of Mesenchymal Stromal/Stem Cells Mediated via Paracrine Activity. J. Clin. Med. 2019, 8, 25. [Google Scholar] [CrossRef] [Green Version]
- Jimenez-Puerta, G.J.; Marchal, J.A.; Lopez-Ruiz, E.; Galvez-Martin, P. Role of Mesenchymal Stromal Cells as Therapeutic Agents: Potential Mechanisms of Action and Implications in Their Clinical Use. J. Clin. Med. 2020, 9, 445. [Google Scholar] [CrossRef] [Green Version]
- Weiss, A.R.R.; Dahlke, M.H. Immunomodulation by Mesenchymal Stem Cells (MSCs): Mechanisms of Action of Living, Apoptotic, and Dead MSCs. Front. Immunol. 2019, 10, 1191. [Google Scholar] [CrossRef] [Green Version]
- Yu, K.R.; Lee, J.Y.; Kim, H.S.; Hong, I.S.; Choi, S.W.; Seo, Y.; Kang, I.; Kim, J.J.; Lee, B.C.; Lee, S.; et al. A p38 MAPK-mediated alteration of COX-2/PGE2 regulates immunomodulatory properties in human mesenchymal stem cell aging. PLoS ONE 2014, 9, e102426. [Google Scholar] [CrossRef]
- Bai, L.; Lennon, D.P.; Eaton, V.; Maier, K.; Caplan, A.I.; Miller, S.D.; Miller, R.H. Human bone marrow-derived mesenchymal stem cells induce Th2-polarized immune response and promote endogenous repair in animal models of multiple sclerosis. Glia 2009, 57, 1192–1203. [Google Scholar] [CrossRef] [Green Version]
- Aggarwal, S.; Pittenger, M.F. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 2005, 105, 1815–1822. [Google Scholar] [CrossRef] [Green Version]
- Shin, T.H.; Kim, H.S.; Kang, T.W.; Lee, B.C.; Lee, H.Y.; Kim, Y.J.; Shin, J.H.; Seo, Y.; Won Choi, S.; Lee, S.; et al. Human umbilical cord blood-stem cells direct macrophage polarization and block inflammasome activation to alleviate rheumatoid arthritis. Cell Death Dis. 2016, 7, e2524. [Google Scholar] [CrossRef]
- Jiang, X.X.; Zhang, Y.; Liu, B.; Zhang, S.X.; Wu, Y.; Yu, X.D.; Mao, N. Human mesenchymal stem cells inhibit differentiation and function of monocyte-derived dendritic cells. Blood 2005, 105, 4120–4126. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.S.; Shin, T.H.; Lee, B.C.; Yu, K.R.; Seo, Y.; Lee, S.; Seo, M.S.; Hong, I.S.; Choi, S.W.; Seo, K.W.; et al. Human umbilical cord blood mesenchymal stem cells reduce colitis in mice by activating NOD2 signaling to COX2. Gastroenterology 2013, 145, 1392–1403. [Google Scholar] [CrossRef]
- Deng, Y.; Zhang, Y.; Ye, L.; Zhang, T.; Cheng, J.; Chen, G.; Zhang, Q.; Yang, Y. Umbilical Cord-derived Mesenchymal Stem Cells Instruct Monocytes Towards an IL10-producing Phenotype by Secreting IL6 and HGF. Sci. Rep. 2016, 6, 37566. [Google Scholar] [CrossRef]
- Burisch, J.; Munkholm, P. Inflammatory bowel disease epidemiology. Curr. Opin. Gastroenterol. 2013, 29, 357–362. [Google Scholar] [CrossRef]
- Dave, M.; Mehta, K.; Luther, J.; Baruah, A.; Dietz, A.B.; Faubion, W.A., Jr. Mesenchymal Stem Cell Therapy for Inflammatory Bowel Disease: A Systematic Review and Meta-analysis. Inflamm. Bowel Dis. 2015, 21, 2696–2707. [Google Scholar] [CrossRef]
- Gao, F.; Chiu, S.M.; Motan, D.A.; Zhang, Z.; Chen, L.; Ji, H.L.; Tse, H.F.; Fu, Q.L.; Lian, Q. Mesenchymal stem cells and immunomodulation: Current status and future prospects. Cell Death Dis. 2016, 7, e2062. [Google Scholar] [CrossRef] [Green Version]
- Adak, S.; Mukherjee, S.; Seni, D. Mesenchymal Stem Cell as a Potential Therapeutic for Inflammatory Bowel Disease- Myth or Reality? Curr. Stem Cell Res. Ther. 2017, 12, 644–657. [Google Scholar] [CrossRef]
- Yu, K.R.; Kang, K.S. Aging-related genes in mesenchymal stem cells: A mini-review. Gerontology 2013, 59, 557–563. [Google Scholar] [CrossRef]
- Lee, J.Y.; Yu, K.R.; Kim, H.S.; Kang, I.; Kim, J.J.; Lee, B.C.; Choi, S.W.; Shin, J.H.; Seo, Y.; Kang, K.S. BMI1 inhibits senescence and enhances the immunomodulatory properties of human mesenchymal stem cells via the direct suppression of MKP-1/DUSP1. Aging 2016, 8, 1670–1689. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.H.; Lee, H.S.; Choi, H.K.; Kim, J.A.; Chu, I.S.; Leem, S.H.; Oh, I.H. Heterogeneous Niche Activity of Ex-Vivo Expanded MSCs as Factor for Variable Outcomes in Hematopoietic Recovery. PLoS ONE 2016, 11, e0168036. [Google Scholar] [CrossRef]
- Erickson, G.A.; Bolin, S.R.; Landgraf, J.G. Viral contamination of fetal bovine serum used for tissue culture: Risks and concerns. Dev. Biol. Stand. 1991, 75, 173–175. [Google Scholar]
- Tekkatte, C.; Gunasingh, G.P.; Cherian, K.M.; Sankaranarayanan, K. “Humanized” stem cell culture techniques: The animal serum controversy. Stem Cells Int. 2011, 2011, 504723. [Google Scholar] [CrossRef] [Green Version]
- Bieback, K.; Hecker, A.; Kocaomer, A.; Lannert, H.; Schallmoser, K.; Strunk, D.; Kluter, H. Human alternatives to fetal bovine serum for the expansion of mesenchymal stromal cells from bone marrow. Stem Cells 2009, 27, 2331–2341. [Google Scholar] [CrossRef]
- Cholewa, D.; Stiehl, T.; Schellenberg, A.; Bokermann, G.; Joussen, S.; Koch, C.; Walenda, T.; Pallua, N.; Marciniak-Czochra, A.; Suschek, C.V.; et al. Expansion of Adipose Mesenchymal Stromal Cells Is Affected by Human Platelet Lysate and Plating Density. Cell Transplant. 2011, 20, 1409–1422. [Google Scholar] [CrossRef]
- Hemeda, H.; Giebel, B.; Wagner, W. Evaluation of human platelet lysate versus fetal bovine serum for culture of mesenchymal stromal cells. Cytotherapy 2014, 16, 170–180. [Google Scholar] [CrossRef] [Green Version]
- Lange, C.; Cakiroglu, F.; Spiess, A.N.; Cappallo-Obermann, H.; Dierlamm, J.; Zander, A.R. Accelerated and safe expansion of human mesenchymal stromal cells in animal serum-free medium for transplantation and regenerative medicine. J. Cell Physiol. 2007, 213, 18–26. [Google Scholar] [CrossRef]
- Lindroos, B.; Boucher, S.; Chase, L.; Kuokkanen, H.; Huhtala, H.; Haataja, R.; Vemuri, M.; Suuronen, R.; Miettinen, S. Serum-free, xeno-free culture media maintain the proliferation rate and multipotentiality of adipose stem cells in vitro. Cytotherapy 2009, 11, 958–972. [Google Scholar] [CrossRef]
- Chase, L.G.; Yang, S.; Zachar, V.; Yang, Z.; Lakshmipathy, U.; Bradford, J.; Boucher, S.E.; Vemuri, M.C. Development and characterization of a clinically compliant xeno-free culture medium in good manufacturing practice for human multipotent mesenchymal stem cells. Stem Cells Transl. Med. 2012, 1, 750–758. [Google Scholar] [CrossRef]
- Chase, L.G.; Lakshmipathy, U.; Solchaga, L.A.; Rao, M.S.; Vemuri, M.C. A novel serum-free medium for the expansion of human mesenchymal stem cells. Stem Cell Res. Ther. 2010, 1, 8. [Google Scholar] [CrossRef] [Green Version]
- Patrikoski, M.; Sivula, J.; Huhtala, H.; Helminen, M.; Salo, F.; Mannerstrom, B.; Miettinen, S. Different culture conditions modulate the immunological properties of adipose stem cells. Stem Cells Transl. Med. 2014, 3, 1220–1230. [Google Scholar] [CrossRef]
- Yoshida, K.; Nakashima, A.; Doi, S.; Ueno, T.; Okubo, T.; Kawano, K.I.; Kanawa, M.; Kato, Y.; Higashi, Y.; Masaki, T. Serum-Free Medium Enhances the Immunosuppressive and Antifibrotic Abilities of Mesenchymal Stem Cells Utilized in Experimental Renal Fibrosis. Stem Cells Transl. Med. 2018, 7, 893–905. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.; Lee, S.K.; Kim, H.; Kim, T.M. Exosomes Secreted from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells Accelerate Skin Cell Proliferation. Int. J. Mol. Sci. 2018, 19, 119. [Google Scholar] [CrossRef] [Green Version]
- Baum, C.M.; Weissman, I.L.; Tsukamoto, A.S.; Buckle, A.M.; Peault, B. Isolation of a candidate human hematopoietic stem-cell population. Proc. Natl. Acad. Sci. USA 1992, 89, 2804–2808. [Google Scholar] [CrossRef] [Green Version]
- Francois, M.; Romieu-Mourez, R.; Li, M.; Galipeau, J. Human MSC suppression correlates with cytokine induction of indoleamine 2,3-dioxygenase and bystander M2 macrophage differentiation. Mol. Ther. 2012, 20, 187–195. [Google Scholar] [CrossRef]
- Vasandan, A.B.; Jahnavi, S.; Shashank, C.; Prasad, P.; Kumar, A.; Prasanna, J. Human Mesenchymal stem cells program macrophage plasticity by altering their metabolic status via a PGE(2)-dependent mechanism. Sci Rep. 2016, 6. [Google Scholar] [CrossRef] [Green Version]
- Seo, Y.; Oh, S.J.; Ahn, J.S.; Shin, Y.Y.; Yang, J.W.; Kim, H.S. Implication of Porphyromonas gingivalis in colitis and homeostasis of intestinal epithelium. Lab. Anim. Res. 2019, 35, 26. [Google Scholar] [CrossRef]
- Sheng, H.M.; Wang, Y.; Jin, Y.Q.; Zhang, Q.Y.; Zhang, Y.; Wang, L.; Shen, B.; Yin, S.; Liu, W.; Cui, L.; et al. A critical role of IFN gamma in priming MSC-mediated suppression of T cell proliferation through up-regulation of B7-H1. Cell Res. 2008, 18, 846–857. [Google Scholar] [CrossRef]
- Cho, Y.H.; Cha, M.J.; Song, B.W.; Kim, I.K.; Song, H.; Chang, W.; Lim, S.; Ham, O.; Lee, S.Y.; Choi, E.; et al. Enhancement of MSC adhesion and therapeutic efficiency in ischemic heart using lentivirus delivery with periostin. Biomaterials 2012, 33, 1376–1385. [Google Scholar] [CrossRef]
- Noronha, N.C.; Mizukami, A.; Caliari-Oliveira, C.; Cominal, J.G.; Rocha, J.L.M.; Covas, D.T.; Swiech, K.; Malmegrim, K.C.R. Priming approaches to improve the efficacy of mesenchymal stromal cell-based therapies. Stem Cell Res. Ther. 2019, 10, 131. [Google Scholar] [CrossRef] [Green Version]
- Devireddy, L.R.; Myers, M.; Screven, R.; Liu, Z.; Boxer, L. A serum-free medium formulation efficiently supports isolation and propagation of canine adipose-derived mesenchymal stem/stromal cells. PLoS ONE 2019, 14, e0210250. [Google Scholar] [CrossRef]
- Maijenburg, M.W.; Kleijer, M.; Vermeul, K.; Mul, E.P.; van Alphen, F.P.; van der Schoot, C.E.; Voermans, C. The composition of the mesenchymal stromal cell compartment in human bone marrow changes during development and aging. Haematologica 2012, 97, 179–183. [Google Scholar] [CrossRef] [Green Version]
- Gnani, D.; Crippa, S.; della Volpe, L.; Rossella, V.; Conti, A.; Lettera, E.; Rivis, S.; Ometti, M.; Fraschini, G.; Bernardo, M.E.; et al. An early-senescence state in aged mesenchymal stromal cells contributes to hematopoietic stem and progenitor cell clonogenic impairment through the activation of a pro-inflammatory program. Aging Cell 2019, 18. [Google Scholar] [CrossRef] [Green Version]
- Kim, M.; Kim, C.; Choi, Y.S.; Kim, M.; Park, C.; Suh, Y. Age-related alterations in mesenchymal stem cells related to shift in differentiation from osteogenic to adipogenic potential: Implication to age-associated bone diseases and defects. Mech. Ageing Dev. 2012, 133, 215–225. [Google Scholar] [CrossRef]
- Chen, Q.; Shou, P.; Zheng, C.; Jiang, M.; Cao, G.; Yang, Q.; Cao, J.; Xie, N.; Velletri, T.; Zhang, X.; et al. Fate decision of mesenchymal stem cells: Adipocytes or osteoblasts? Cell Death Differ. 2016, 23, 1128–1139. [Google Scholar] [CrossRef] [Green Version]
- Infante, A.; Rodriguez, C.I. Osteogenesis and aging: Lessons from mesenchymal stem cells. Stem Cell Res. Ther. 2018, 9, 244. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.R.; Kim, J.; Park, S.R.; Min, B.H.; Choi, B.H. Characterization of Human Fetal Cartilage Progenitor Cells During Long-Term Expansion in a Xeno-Free Medium. Tissue Eng. Regen. Med. 2018, 15, 649–659. [Google Scholar] [CrossRef]
- Selich, A.; Daudert, J.; Hass, R.; Philipp, F.; von Kaisenberg, C.; Paul, G.; Cornils, K.; Fehse, B.; Rittinghausen, S.; Schambach, A.; et al. Massive Clonal Selection and Transiently Contributing Clones During Expansion of Mesenchymal Stem Cell Cultures Revealed by Lentiviral RGB-Barcode Technology. Stem Cells Transl. Med. 2016, 5, 591–601. [Google Scholar] [CrossRef] [Green Version]
- Mendez-Ferrer, S.; Michurina, T.V.; Ferraro, F.; Mazloom, A.R.; Macarthur, B.D.; Lira, S.A.; Scadden, D.T.; Ma’ayan, A.; Enikolopov, G.N.; Frenette, P.S. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature 2010, 466, 829–834. [Google Scholar] [CrossRef]
- Papayannopoulou, T.; Craddock, C.; Nakamoto, B.; Priestley, G.V.; Wolf, N.S. The VLA4/VCAM-1 adhesion pathway defines contrasting mechanisms of lodgement of transplanted murine hemopoietic progenitors between bone marrow and spleen. Proc. Natl. Acad. Sci. USA 1995, 92, 9647–9651. [Google Scholar] [CrossRef] [Green Version]
- Liu, F.; Qiu, H.; Xue, M.; Zhang, S.; Zhang, X.; Xu, J.; Chen, J.; Yang, Y.; Xie, J. MSC-secreted TGF-beta regulates lipopolysaccharide-stimulated macrophage M2-like polarization via the Akt/FoxO1 pathway. Stem Cell Res. Ther. 2019, 10, 345. [Google Scholar] [CrossRef]
- Meisel, R.; Zibert, A.; Laryea, M.; Gobel, U.; Daubener, W.; Dilloo, D. Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2,3-dioxygenase-mediated tryptophan degradation. Blood 2004, 103, 4619–4621. [Google Scholar] [CrossRef] [Green Version]
Name | Primer Direction | Sequences |
---|---|---|
PPAR-γ | Frw | CCTCCGGGCCCTGGCAAAAC |
Rev | CTCCTGCACAGCCTCCSCGG | |
aP2 | Frw | GGGTCACAGCACCCTCCTGA |
Rev | GGTTTGGCCATGCCAGCCAC | |
runx2 | Frw | CCCAGTATGAGAGTAGGTGTCC |
Rev | GGGTAAGACTGGTCATAGGACC | |
ALP | Frw | ATGTCATCATGTTCCTGGGAGAT |
Rev | TGGTGGAGCTGACCCTTGAG | |
COMP | Frw | AGCAGATGGAGCAAACGTATTG |
Rev | ACAGCCTTGAGTTGGATGCC | |
Collagen XIa1 | Frw | CGGAGGCAAACATCGTTGAT |
Rev | ATTTGGCTCATTTGTCCCAGAA | |
COX2 | Frw | AGACGCCCTCAGACAGCAAA |
Rev | TCCTGTCCGGGTACAATCGC | |
IDO | Frw | CCTGAGGAGCTACCATCTGC |
Rev | TCAGTGCCTCCAGTTCCTTT | |
TGF-β1 | Frw | GATGTCACCGGAGTTGTGCG |
Rev | GCCGGTAGTGAACCCGTTGAT | |
IL-1β | Frw | CTCTTCGAGGCACAAGGCAC |
Rev | CAAGTCATCCTCATTGCCACTGT | |
IL-18 | Frw | ACTGCCTGGACAGTCAGCAA |
Rev | GCAGCCATCTTTATTCCTGAGA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kang, J.Y.; Oh, M.-K.; Joo, H.; Park, H.S.; Chae, D.-H.; Kim, J.; Lee, H.-R.; Oh, I.-H.; Yu, K.-R. Xeno-Free Condition Enhances Therapeutic Functions of Human Wharton’s Jelly-Derived Mesenchymal Stem Cells against Experimental Colitis by Upregulated Indoleamine 2,3-Dioxygenase Activity. J. Clin. Med. 2020, 9, 2913. https://doi.org/10.3390/jcm9092913
Kang JY, Oh M-K, Joo H, Park HS, Chae D-H, Kim J, Lee H-R, Oh I-H, Yu K-R. Xeno-Free Condition Enhances Therapeutic Functions of Human Wharton’s Jelly-Derived Mesenchymal Stem Cells against Experimental Colitis by Upregulated Indoleamine 2,3-Dioxygenase Activity. Journal of Clinical Medicine. 2020; 9(9):2913. https://doi.org/10.3390/jcm9092913
Chicago/Turabian StyleKang, Ji Yeon, Mi-Kyung Oh, Hansol Joo, Hyun Sung Park, Dong-Hoon Chae, Jieun Kim, Hae-Ri Lee, Il-Hoan Oh, and Kyung-Rok Yu. 2020. "Xeno-Free Condition Enhances Therapeutic Functions of Human Wharton’s Jelly-Derived Mesenchymal Stem Cells against Experimental Colitis by Upregulated Indoleamine 2,3-Dioxygenase Activity" Journal of Clinical Medicine 9, no. 9: 2913. https://doi.org/10.3390/jcm9092913