Scratch-Based Isolation of Primary Cells (SCIP): A Novel Method to Obtain a Large Number of Human Dental Pulp Cells Through One-Step Cultivation
Abstract
1. Background
2. Materials and Methods
2.1. Ethics Statement
2.2. Extraction of DPs and Their Scraping onto the Culture Dish
2.3. Alkaline Phosphatase (ALP) Assay
2.4. Reverse Transcription Polymerase Chain Reaction (RT-PCR) Analysis
2.5. Immunocytochemical Staining
2.6. Success Rates of the SCIP Method
3. Results
3.1. Acquisition of HDDPCs by SCIP
3.2. SCIP-Based Acquisition of HDDPCs Through Repeated Passage
3.3. Cytochemical Staining for ALP Activity
3.4. RT-PCR Analysis
3.5. Immunocytochemical Analysis
3.6. SCIP-Based Propagation of DP Cells from Patients
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Miura, M.; Gronthos, S.; Zhao, M.; Lu, B.; Fisher, L.W.; Robey, P.G.; Shi, S. SHED: Stem cells from human exfoliated deciduous teeth. Proc. Natl. Acad. Sci. USA 2003, 100, 5807–5812. [Google Scholar] [CrossRef] [Scilit]
- Yamaza, T.; Kentaro, A.; Chen, C.; Liu, Y.; Shi, Y.; Gronthos, S.; Wang, S.; Shi, S. Immunomodulatory properties of stem cells from human exfoliated deciduous teeth. Stem Cell Res. Ther. 2010, 1, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamaoki, N.; Takahashi, K.; Tanaka, T.; Ichisaka, T.; Aoki, H.; Takeda-Kawaguchi, T.; Iida, K.; Kunisada, T.; Shibata, T.; Yamanaka, S.; et al. Dental pulp cells for induced pluripotent stem cell banking. J. Dent. Res. 2010, 89, 773–778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sonoyama, W.; Liu, Y.; Fang, D.; Yamaza, T.; Seo, B.-M.; Zhang, C.; Liu, H.; Gronthos, S.; Wang, C.-Y.; Wang, S.; et al. Mesenchymal stem cell-mediated functional tooth regeneration in swine. PLoS ONE 2006, 1, e79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Wang, X.; Sun, Z.; Wang, X.; Yang, H.; Shi, S.; Wang, S. Stem cells from human-exfoliated deciduous teeth can differentiate into dopaminergic neuron-like cells. Stem Cells Dev. 2010, 19, 1375–1383. [Google Scholar] [CrossRef] [Scilit]
- Sakai, V.T.; Zhang, Z.; Dong, Z.; Neiva, K.G.; Machado, M.A.; Shi, S.; Santos, C.F.; Nör, J.E. SHED differentiate into functional odontoblasts and endothelium. J. Dent. Res. 2010, 89, 791–796. [Google Scholar] [CrossRef] [Scilit]
- Gronthos, S.; Brahim, J.; Li, W.; Fisher, L.W.; Cherman, N.; Boyde, A.; DenBesten, P.; Robey, P.G.; Shi, S. Stem cell properties of human dental pulp stem cells. J. Dent. Res. 2002, 81, 531–535. [Google Scholar] [CrossRef] [Scilit]
- Sui, B.; Wu, D.; Xiang, L.; Fu, Y.; Kou, X.; Shi, S. Dental pulp stem cells: From discovery to clinical application. J. Endod. 2020, 46, S46–S55. [Google Scholar] [CrossRef] [Scilit]
- Suchánek, J.; Visek, B.; Soukup, T.; El-Din Mohamed, S.K.; Ivancaková, R.; Mokrỳ, J.; Aboul-Ezz, E.H.A.; Omran, A. Stem cells from human exfoliated deciduous teeth–isolation, long term cultivation and phenotypical analysis. Acta Med. (Hradec Králové) 2010, 53, 93–99. [Google Scholar] [CrossRef] [Scilit]
- Nakamura, S.; Yamada, Y.; Katagiri, W.; Sugito, T.; Ito, K.; Ueda, M. Stem cell proliferation pathways comparison between human exfoliated deciduous teeth and dental pulp stem cells by gene expression profile from promising dental pulp. J. Endod. 2009, 35, 1536–1542. [Google Scholar] [CrossRef] [Scilit]
- Shi, S.; Robey, P.G.; Gronthos, S. Comparison of human dental pulp and bone marrow stromal stem cells by cDNA microarray analysis. Bone 2001, 29, 532–539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishkitiev, N.; Yaegaki, K.; Calenic, B.; Nakahara, T.; Ishikawa, H.; Mitiev, V.; Haapasalo, M. Deciduous and permanent dental pulp mesenchymal cells acquire hepatic morphologic and functional features in vitro. J. Endod. 2010, 36, 469–474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kok, Z.Y.; Alaidaroos, N.Y.A.; Alraies, A.; Colombo, J.S.; Davies, L.C.; Waddington, R.J.; Sloan, A.J.; Moseley, R. Dental pulp stem cell heterogeneity: Finding superior quality ‘needles’ in a dental pulpal ‘haystack’ for regenerative medicine-based applications. Stem Cells Int. 2022, 2022, 9127074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gugliandolo, A.; Mazzon, E. Dental mesenchymal stem cell secretome: An intriguing approach for neuroprotection and neuroregeneration. Int. J. Mol. Sci. 2021, 23, 456. [Google Scholar] [CrossRef] [Scilit]
- Dai, J.; Wang, J.; Lu, J.; Zou, D.; Sun, H.; Dong, Y.; Yu, H.; Zhang, L.; Yang, T.; Zhang, X.; et al. The effect of co-culturing costal chondrocytes and dental pulp stem cells combined with exogenous FGF9 protein on chondrogenesis and ossification in engineered cartilage. Biomaterials 2012, 33, 7699–7711. [Google Scholar] [CrossRef] [Scilit]
- Shen, W.C.; Lai, Y.C.; Li, L.H.; Liao, K.; Lai, H.C.; Kao, S.Y.; Wang, J.; Chuong, C.M.; Hung, S.C. Methylation and PTEN activation in dental pulp mesenchymal stem cells promotes osteogenesis and reduces oncogenesis. Nat. Commun. 2019, 10, 2226. [Google Scholar] [CrossRef] [Scilit]
- Taguchi, T.; Yanagi, Y.; Yoshimaru, K.; Zhang, X.Y.; Matsuura, T.; Nakayama, K.; Kobayashi, E.; Yamaza, H.; Nonaka, K.; Ohga, S.; et al. Regenerative medicine using stem cells from human exfoliated deciduous teeth (SHED): A promising new treatment in pediatric surgery. Surg. Today 2019, 49, 316–322. [Google Scholar] [CrossRef] [Scilit]
- Kawashima, N. Characterisation of dental pulp stem cells: A new horizon for tissue regeneration? Arch. Oral Biol. 2012, 57, 1439–1458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, A.H.C.; Snyder, B.R.; Cheng, P.H.; Chan, A.W.S. Putative dental pulp-derived stem/stromal cells promote proliferation and differentiation of endogenous neural cells in the hippocampus of mice. Stem Cells 2008, 26, 2654–2663. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Lei, T.; Chen, P.; Wang, L.; Wang, J.; Wang, D.; Guo, W.; Zhou, Y.; Li, Q.; Du, H. Stem cells from Human exfoliated deciduous teeth promote hair regeneration in mouse. Cell Transplant. 2021, 30, 09636897211042927. [Google Scholar] [CrossRef] [Scilit]
- Laino, G.; Carinci, F.; Graziano, A.; d'Aquino, R.; Lanza, V.; De Rosa, A.; Gombos, F.; Caruso, F.; Guida, L.; Rullo, R.; et al. In vitro bone production using stem cells derived from human dental pulp. J. Craniofac. Surg. 2006, 17, 511–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seo, B.M.; Sonoyama, W.; Yamaza, T.; Coppe, C.; Kikuiri, T.; Akiyama, K.; Lee, J.S.; Shi, S. SHED repair critical-size calvarial defects in mice. Oral Dis. 2008, 14, 428–434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahdavi-Jouibari, F.; Parseh, B.; Kazeminejad, E.; Khosravi, A. Hopes and opportunities of stem cells from human exfoliated deciduous teeth (SHED) in cartilage tissue regeneration. Front. Bioeng. Biotechnol. 2023, 11, 1021024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujii, H.; Matsubara, K.; Sakai, K.; Ito, M.; Ohno, K.; Ueda, M.; Yamamoto, A. Dopaminergic differentiation of stem cells from human deciduous teeth and their therapeutic benefits for Parkinsonian rats. Brain Res. 2015, 1613, 59–72. [Google Scholar] [CrossRef] [Scilit]
- Bai, X.; Zhang, X.; Wang, C.; Liu, Y.; Liu, X.; Fan, Y.; Zhang, X. Stem cells from human exfoliated deciduous teeth attenuate trigeminal neuralgia in rats. Stem Cells Int. 2021, 2021, 8819884. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Ma, Y.; Guo, W.; Yang, B.; Tian, W. Stem cells from human exfoliated deciduous teeth as an alternative cell source in bio-root regeneration. Theranostics 2019, 9, 2694–2711. [Google Scholar] [CrossRef] [Scilit]
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef] [Scilit]
- Pagella, P.; Stadlinger, B.; Mitsiadis, T.A. Isolation of dental pulp and periodontal cells from human teeth for single-cell RNA sequencing. STAR Protoc. 2021, 2, 100953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spath, L.; Rotilio, V.; Alessandrini, M.; Gambara, G.; De Angelis, L.; Mancini, M.; Mitsiadis, T.A.; Vivarelli, E.; Naro, F.; Filippini, A.; et al. Explant-derived human dental pulp stem cells enhance differentiation and proliferation potentials. J. Cell. Mol. Med. 2010, 14, 1635–1644. [Google Scholar] [CrossRef] [Scilit]
- Mokry, J.; Soukup, T.; Micuda, S.; Karbanova, J.; Visek, B.; Brcakova, E.; Suchanek, J.; Bouchal, J.; Vokurkova, D.; Ivancakova, R. Telomere attrition occurs during ex vivo expansion of human dental pulp stem cells. J. Biomed. Biotechnol. 2010, 2010, 673513. [Google Scholar] [CrossRef] [Scilit]
- Krishna, M.; Shetty, A.; Manjappa, A.B.; Shetty, V.; Hegde, M.N.; Kumar, B.M. Comparative characterization and analysis of telomere length in stem cells derived from deciduous and permanent teeth. Dent. Res. J. 2022, 19, 64. [Google Scholar]
- Nihashi, Y.; Miyoshi, M.; Umezawa, K.; Shimosato, T.; Takaya, T. Identification of a novel osteogenetic oligodeoxynucleotide (osteoDN) that promotes osteoblast differentiation in a TLR9-independent manner. Nanomaterials 2022, 12, 1680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef] [Scilit]
- Martí, M.; Mulero, L.; Pardo, C.; Morera, C.; Carrió, M.; Laricchia-Robbio, L.; Esteban, C.R.; Izpisua Belmonte, J.C. Characterization of pluripotent stem cells. Nat. Protoc. 2013, 8, 223–253. [Google Scholar] [CrossRef] [Scilit]
- Inada, E.; Saitoh, I.; Kubota, N.; Soda, M.; Matsueda, K.; Murakami, T.; Sawami, T.; Kagoshima, A.; Yamasaki, Y.; Sato, M. Alkaline phosphatase and OCT-3/4 as useful markers for predicting susceptibility of human deciduous teeth-derived dental pulp cells to reprogramming factor-induced iPS cells. J. Investig. Clin. Dent. 2017, 8, e12236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yanagisawa, M.; Yu, R.K. The expression and functions of glycoconjugates in neural stem cells. Glycobiology 2007, 17, 57R–74R. [Google Scholar] [CrossRef] [Scilit]
- Inada, E.; Saitoh, I.; Kubota, N.; Iwase, Y.; Murakami, T.; Sawami, T.; Yamasaki, Y.; Sato, M. Increased expression of cell surface SSEA-1 is closely associated with naïve-like conversion from human deciduous teeth dental pulp cells-derived iPS cells. Int. J. Mol. Sci. 2019, 20, 1651. [Google Scholar] [CrossRef] [Scilit]
- Suchanek, J.; Soukup, T.; Visek, B.; Ivancakova, R.; Kucerova, L.; Mokry, J. Dental pulp stem cells and their characterization. Biomed. Pap. Med. Fac. Univ. Palacky. Olomouc Czech Repub. 2009, 153, 31–35. [Google Scholar] [CrossRef] [Scilit]
- Tong, Z.; Yin, Z. Distribution, contribution and regulation of nestin+ cells. J. Adv. Res. 2024, 61, 47–63. [Google Scholar] [CrossRef] [Scilit]
- Werle, S.B.; Lindemann, D.; Steffens, D.; Demarco, F.F.; de Araujo, F.B.; Pranke, P.; Casagrande, L. Carious deciduous teeth are a potential source for dental pulp stem cells. Clin. Oral Investig. 2016, 20, 75–81. [Google Scholar] [CrossRef] [Scilit]
- Perry, B.C.; Zhou, D.; Wu, X.; Yang, F.C.; Byers, M.A.; Chu, T.M.G.; Hockema, J.J.; Woods, E.J.; Goebel, W.S. Collection, cryopreservation, and characterization of human dental pulp-derived mesenchymal stem cells for banking and clinical use. Tissue Eng. Part C Methods 2008, 14, 149–156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galler, K.M.; Weber, M.; Korkmaz, Y.; Widbiller, M.; Feuerer, M. Inflammatory response mechanisms of the dentine–pulp complex and the periapical tissues. Int. J. Mol. Sci. 2021, 22, 1480. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Target Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Size |
|---|---|---|---|
| GAPDH | ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA | 452 |
| OCT3/4 | CATGGCGGGACACCTGGCTTC | CTGATCTGCTGCAGTGTGGGTT | 783 |
| SOX2 | AGGACCAGCTGGGCTACCCG | GCGCCGGGGAGATACATGC | 320 |
| NANOG | TTGGAAGCTGCTGGGGGAAG | GATGGGAGGAGGGGAGAGGA | 193 |
| NESTIN | AGCCCTGACCACTCCAGTTTAG | CCCTCTATGGCTGTTTCTTTCTCT | 128 |
| IGF1 | CTCTTCAGTTCGTGTGTGGAGAC | CAGCCTCCTTAGATCACAGCTC | 134 |
| DSPP | AAAGTGGTGTCCTGGTGCAT | CCTGGATGCCATTTGCTGTG | 246 |
| ABCG | ACCATTGCATCTTGGCTGTC | CGATGCCCTGCTTTACCAAA | 181 |
| OCN | CCCTTTCTCCTGTCCGGATG | GCTGAGCTCTAGGGGAGTC | 246 |
| CD90 | ATGAACCTGGCCATCAGCA | GTGTGCTCAGGCACCCC | 218 |
| MSX1 | CGCTCGGCCATTTCTCGGTG | CGCTCCAGCGCCAGCAGCTGC | 226 |
| MSX2 | CTGGTGAAGCCCTTCGAGAC | GGCGTGCGCGGCTTCCGATTG | 190 |
| Number | Systemic Disease | Dental Disease | Success/ Failed | Repeated Passages | Stock Tubes |
|---|---|---|---|---|---|
| 1 | Hypophosphatasia | Falling off | Success | 6 | 41 |
| 2 | Hypophosphatasia | Pulpitis | Success | 6 | 38 |
| 3 | Osteogenesis Imperfecta | Prolonged Retention | Success | 6 | 43 |
| 4 | Baller–Gerold Syndrome | Prolonged Retention | Failed | - | - |
| 5 | Rett Syndrome | Prolonged Retention | Success | 5 | 31 |
| 6 | Hypophosphatasia | Falling Off | Success | 5 | 34 |
| 7 | Hypophosphatasia | Occlusal Trauma | Success | 5 | 32 |
| 8 | Charge Syndrome | Pulpitis | Success | 5 | 23 |
| 9 | Charge Syndrome | Pulpitis | Success | 5 | 27 |
| 10 | Charge Syndrome | Pulpitis | Success | 5 | 28 |
| 11 | Hypophosphatasia | Prolonged Retention | Success | 10 | 50 |
| 12 | Health | Falling Off | Success | 15 | 23 |
| 13 | Osteogenesis Imperfecta | Prolonged Retention | Success | 12 | 26 |
| 14 | Hypophosphatasia (Adult) | Prolonged Retention | Success | 15 | 43 |
| 15 | Health | Prolonged Retention | Success | 10 | 27 |
| 16 | Health | Prolonged Retention | Success | 10 | 27 |
| 17 | Health | Pulpitis | Success | 10 | 28 |
| 16/17 Samples Succeed (>94% Success Rate) | |||||
| Property | Conventional Method | SCIP Method |
|---|---|---|
| Cell fixation | Dependent on DP volume | Possible with small amounts of DP |
| Continuous supply of primary cells | Not possible (only at once time of cell seeding) | Can be propagated from scratched pulp |
| Cell proliferation | Varies | Good |
| Methodological simplicity | Easy | Easy |
| Difference between operators | Large | Small |
| Damage to cells | Enzymatic treatment is required for about 1 h | Enzymatic treatment is required for about 20 min |
| Reuse of DP | Only once time for culture | Can be used repeatedly |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kiyokawa, Y.; Terajima, M.; Sato, M.; Inada, E.; Hori, Y.; Bando, R.; Iwase, Y.; Kubota, N.; Murakami, T.; Tsugane, H.; et al. Scratch-Based Isolation of Primary Cells (SCIP): A Novel Method to Obtain a Large Number of Human Dental Pulp Cells Through One-Step Cultivation. J. Clin. Med. 2024, 13, 7058. https://doi.org/10.3390/jcm13237058
Kiyokawa Y, Terajima M, Sato M, Inada E, Hori Y, Bando R, Iwase Y, Kubota N, Murakami T, Tsugane H, et al. Scratch-Based Isolation of Primary Cells (SCIP): A Novel Method to Obtain a Large Number of Human Dental Pulp Cells Through One-Step Cultivation. Journal of Clinical Medicine. 2024; 13(23):7058. https://doi.org/10.3390/jcm13237058
Chicago/Turabian StyleKiyokawa, Yuki, Masahiko Terajima, Masahiro Sato, Emi Inada, Yuria Hori, Ryo Bando, Yoko Iwase, Naoko Kubota, Tomoya Murakami, Hiroko Tsugane, and et al. 2024. "Scratch-Based Isolation of Primary Cells (SCIP): A Novel Method to Obtain a Large Number of Human Dental Pulp Cells Through One-Step Cultivation" Journal of Clinical Medicine 13, no. 23: 7058. https://doi.org/10.3390/jcm13237058
APA StyleKiyokawa, Y., Terajima, M., Sato, M., Inada, E., Hori, Y., Bando, R., Iwase, Y., Kubota, N., Murakami, T., Tsugane, H., Watanabe, S., Sonomura, T., Terunuma, M., Maeda, T., Noguchi, H., & Saitoh, I. (2024). Scratch-Based Isolation of Primary Cells (SCIP): A Novel Method to Obtain a Large Number of Human Dental Pulp Cells Through One-Step Cultivation. Journal of Clinical Medicine, 13(23), 7058. https://doi.org/10.3390/jcm13237058

