FCER1G Gene Hypomethylation in Patients with Rheumatoid Arthritis
Abstract
:1. Introduction
2. Materials and Methods
Patients
3. Methylation Study
Statistical Analysis
4. Results
5. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mikhaylenko, D.S.; Nemtsova, M.V.; Bure, I.V.; Kuznetsova, E.B.; Alekseeva, E.A.; Tarasov, V.V.; Lukashev, A.N.; Beloukhova, M.I.; Deviatkin, A.A.; Zamyatnin, A.A. Genetic Polymorphisms Associated with Rheumatoid Arthritis Development and Antirheumatic Therapy Response. Int. J. Mol. Sci. 2020, 21, 4911. [Google Scholar] [CrossRef]
- Padyukov, L. Genetics of Rheumatoid Arthritis. Semin. Immunopathol. 2022, 44, 47–62. [Google Scholar] [CrossRef] [PubMed]
- McInnes, I.B.; Schett, G. The Pathogenesis of Rheumatoid Arthritis. N. Engl. J. Med. 2011, 365, 2205–2219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aletaha, D.; Neogi, T.; Silman, A.J.; Funovits, J.; Felson, D.T.; Bingham, C.O.; Birnbaum, N.S.; Burmester, G.R.; Bykerk, V.P.; Cohen, M.D.; et al. 2010 Rheumatoid Arthritis Classification Criteria: An American College of Rheumatology/European League Against Rheumatism Collaborative Initiative. Ann. Rheum. Dis. 2010, 69, 1580–1588. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Trouw, L.A.; van Wesemael, T.J.; Shi, J.; Bengtsson, C.; Källberg, H.; Malmström, V.; Israelsson, L.; Hreggvidsdottir, H.; Verduijn, W.; et al. Anti-CarP Antibodies in Two Large Cohorts of Patients with Rheumatoid Arthritis and Their Relationship to Genetic Risk Factors, Cigarette Smoking and Other Autoantibodies. Ann. Rheum. Dis. 2014, 73, 1761–1768. [Google Scholar] [CrossRef]
- Volkov, M.; van Schie, K.A.; van der Woude, D. Autoantibodies and B Cells: The ABC of Rheumatoid Arthritis Pathophysiology. Immunol. Rev. 2019, 294, 148–163. [Google Scholar] [CrossRef] [Green Version]
- Strollo, R.; Ponchel, F.; Malmström, V.; Rizzo, P.; Bombardieri, M.; Wenham, C.Y.; Landy, R.; Perret, D.; Watt, F.; Corrigall, V.M.; et al. Autoantibodies to Posttranslationally Modified Type II Collagen as Potential Biomarkers for Rheumatoid Arthritis. Arthritis Rheum. 2013, 65, 1702–1712. [Google Scholar] [CrossRef]
- Darrah, E.; Giles, J.T.; Ols, M.L.; Bull, H.G.; Andrade, F.; Rosen, A. Erosive Rheumatoid Arthritis Is Associated with Antibodies That Activate PAD4 by Increasing Calcium Sensitivity. Sci. Transl. Med. 2013, 5, 186ra65. [Google Scholar] [CrossRef] [Green Version]
- Kolfenbach, J.R.; Deane, K.D.; Derber, L.A.; O’Donnell, C.I.; Gilliland, W.R.; Edison, J.D.; Rosen, A.; Darrah, E.; Norris, J.M.; Holers, V.M. Autoimmunity to Peptidyl Arginine Deiminase Type 4 Precedes Clinical Onset of Rheumatoid Arthritis. Arthritis Rheum. 2010, 62, 2633–2639. [Google Scholar] [CrossRef] [Green Version]
- Okada, Y.; Wu, D.; Trynka, G.; Raj, T.; Terao, C.; Ikari, K.; Kochi, Y.; Ohmura, K.; Suzuki, A.; Yoshida, S.; et al. Genetics of Rheumatoid Arthritis Contributes to Biology and Drug Discovery. Nature 2014, 506, 376–381. [Google Scholar] [CrossRef]
- Ha, E.; Bae, S.-C.; Kim, K. Large-Scale Meta-Analysis across East Asian and European Populations Updated Genetic Architecture and Variant-Driven Biology of Rheumatoid Arthritis, Identifying 11 Novel Susceptibility Loci. Ann. Rheum. Dis. 2021, 80, 558–565. [Google Scholar] [CrossRef] [PubMed]
- Ishigaki, K.; Sakaue, S.; Terao, C.; Luo, Y.; Sonehara, K.; Yamaguchi, K.; Amariuta, T.; Too, C.L.; Laufer, V.A.; Scott, I.C.; et al. Trans-Ancestry Genome-Wide Association Study Identifies Novel Genetic Mechanisms in Rheumatoid Arthritis. medRxiv 2021. [Google Scholar] [CrossRef]
- Okada, Y.; Eyre, S.; Suzuki, A.; Kochi, Y.; Yamamoto, K. Genetics of Rheumatoid Arthritis: 2018 Status. Ann. Rheum. Dis. 2019, 78, 446–453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kolarz, B.; Podgorska, D.; Podgorski, R. Insights of Rheumatoid Arthritis Biomarkers. Biomarkers 2020, 26, 1–34. [Google Scholar] [CrossRef] [PubMed]
- Hammaker, D.; Firestein, G.S. Epigenetics of Inflammatory Arthritis. Curr. Opin. Rheumatol. 2018, 30, 188–196. [Google Scholar] [CrossRef] [PubMed]
- Nemtsova, M.V.; Zaletaev, D.V.; Bure, I.V.; Mikhaylenko, D.S.; Kuznetsova, E.B.; Alekseeva, E.A.; Beloukhova, M.I.; Deviatkin, A.A.; Lukashev, A.N.; Zamyatnin, A.A.J. Epigenetic Changes in the Pathogenesis of Rheumatoid Arthritis. Front. Genet. 2019, 10, 570. [Google Scholar] [CrossRef] [Green Version]
- Golbabapour, S.; Abdulla, M.A.; Hajrezaei, M. A Concise Review on Epigenetic Regulation: Insight into Molecular Mechanisms. Int. J. Mol. Sci. 2011, 12, 8661–8694. [Google Scholar] [CrossRef]
- Bottini, N.; Firestein, G.S. Epigenetics in Rheumatoid Arthritis: A Primer for Rheumatologists. Curr. Rheumatol. Rep. 2013, 15, 372. [Google Scholar] [CrossRef]
- Glant, T.T.; Mikecz, K.; Rauch, T.A. Epigenetics in the Pathogenesis of Rheumatoid Arthritis. BMC Med. 2014, 12, 35. [Google Scholar] [CrossRef] [Green Version]
- Klein, K.; Gay, S. Epigenetic Modifications in Rheumatoid Arthritis, a Review. Curr. Opin. Pharmacol. 2013, 13, 420–425. [Google Scholar] [CrossRef] [Green Version]
- Anderson, R. Manipulation of Cell Surface Macromolecules by Flaviviruses. In Advances in Virus Research; Academic Press: Cambridge, MA, USA, 2003; Volume 59, pp. 229–274. [Google Scholar]
- Mahachie John, J.M.; Baurecht, H.; Rodríguez, E.; Naumann, A.; Wagenpfeil, S.; Klopp, N.; Mempel, M.; Novak, N.; Bieber, T.; Wichmann, H.-E.; et al. Analysis of the High Affinity IgE Receptor Genes Reveals Epistatic Effects of FCER1A Variants on Eczema Risk. Allergy 2010, 65, 875–882. [Google Scholar] [CrossRef] [PubMed]
- Kraft, S.; Kinet, J.-P. New Developments in FcεRI Regulation, Function and Inhibition. Nat. Rev. Immunol. 2007, 7, 365–378. [Google Scholar] [CrossRef] [PubMed]
- Küster, H.; Thompson, H.; Kinet, J.P. Characterization and Expression of the Gene for the Human Fc Receptor Gamma Subunit. Definition of a New Gene Family. J. Biol. Chem. 1990, 265, 6448–6452. [Google Scholar] [CrossRef]
- Fu, L.; Cheng, Z.; Dong, F.; Quan, L.; Cui, L.; Liu, Y.; Zeng, T.; Huang, W.; Chen, J.; Pang, Y.; et al. Enhanced Expression of FCER1G Predicts Positive Prognosis in Multiple Myeloma. J. Cancer 2020, 11, 1182–1194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andreu, P.; Johansson, M.; Affara, N.I.; Pucci, F.; Tan, T.; Junankar, S.; Korets, L.; Lam, J.; Tawfik, D.; DeNardo, D.G.; et al. FcRγ Activation Regulates Inflammation-Associated Squamous Carcinogenesis. Cancer Cell 2010, 17, 121–134. [Google Scholar] [CrossRef] [Green Version]
- Nimmerjahn, F.; Ravetch, J.V. Fcγ Receptors as Regulators of Immune Responses. Nat. Rev. Immunol. 2008, 8, 34–47. [Google Scholar] [CrossRef]
- Arnett, F.C.; Edworthy, S.M.; Bloch, D.A.; McShane, D.J.; Fries, J.F.; Cooper, N.S.; Healey, L.A.; Kaplan, S.R.; Liang, M.H.; Luthra, H.S. The American Rheumatism Association 1987 Revised Criteria for the Classification of Rheumatoid Arthritis. Arthritis Rheum. 1988, 31, 315–324. [Google Scholar] [CrossRef]
- Podgórska, D.; Cieśla, M.; Majdan, M.; Podgórski, R.; Kolarz, B. The Relationship of ADAMTSL2 and LRPAP1 Gene Methylation Level with Rheumatoid Arthritis Activity. Clin. Exp. Rheumatol. 2021. [Google Scholar] [CrossRef]
- Dreos, R.; Ambrosini, G.; Périer, R.C.; Bucher, P. The Eukaryotic Promoter Database: Expansion of EPDnew and New Promoter Analysis Tools. Nucleic Acids Res. 2015, 43, D92–D96. [Google Scholar] [CrossRef]
- Li, L.-C.; Dahiya, R. MethPrimer: Designing Primers for Methylation PCRs. Bioinformatics 2002, 18, 1427–1431. [Google Scholar] [CrossRef] [Green Version]
- Tusnády, G.E.; Simon, I.; Váradi, A.; Arányi, T. BiSearch: Primer-Design and Search Tool for PCR on Bisulfite-Treated Genomes. Nucleic Acids Res. 2005, 33, e9. [Google Scholar] [CrossRef] [PubMed]
- Cieśla, M.; Kolarz, B.; Majdan, M.; Darmochwał-Kolarz, D. IRF5 Promoter Methylation as a New Potential Marker of Rheumatoid Arthritis. Pol. Arch. Intern. Med. 2019, 129, 370–376. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Nimmerjahn, F. Activating and Inhibitory FcγRs in Autoimmune Disorders. Springer Semin. Immun. 2006, 28, 305–319. [Google Scholar] [CrossRef] [PubMed]
- Takai, T. Roles of Fc Receptors in Autoimmunity. Nat. Rev. Immunol. 2002, 2, 580–592. [Google Scholar] [CrossRef]
- Ravetch, J.V.; Kinet, J.P. Fc Receptors. Annu. Rev. Immunol. 1991, 9, 457–492. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Wang, C.; Yang, H.; Zhu, T.; Jiang, H.; Chen, J. Weighted Gene Co-Expression Network Analysis Identifies FCER1G as a Key Gene Associated with Diabetic Kidney Disease. Ann. Transl. Med. 2020, 8, 1427. [Google Scholar] [CrossRef]
- Brandsma, A.M.; Hogarth, P.M.; Nimmerjahn, F.; Leusen, J.H.W. Clarifying the Confusion between Cytokine and Fc Receptor “Common Gamma Chain”. Immunity 2016, 45, 225–226. [Google Scholar] [CrossRef] [Green Version]
- Bruhns, P.; Jönsson, F. Mouse and Human FcR Effector Functions. Immunol. Rev. 2015, 268, 25–51. [Google Scholar] [CrossRef] [Green Version]
- Futosi, K.; Mócsai, A. Tyrosine Kinase Signaling Pathways in Neutrophils. Immunol. Rev. 2016, 273, 121–139. [Google Scholar] [CrossRef]
- Ludwig, R.J.; Vanhoorelbeke, K.; Leypoldt, F.; Kaya, Z.; Bieber, K.; McLachlan, S.M.; Komorowski, L.; Luo, J.; Cabral-Marques, O.; Hammers, C.M.; et al. Mechanisms of Autoantibody-Induced Pathology. Front. Immunol. 2017, 8, 603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Németh, T.; Futosi, K.; Szabó, M.; Aradi, P.; Saito, T.; Mócsai, A.; Jakus, Z. Importance of Fc Receptor γ-Chain ITAM Tyrosines in Neutrophil Activation and in Vivo Autoimmune Arthritis. Front. Immunol. 2019, 10, 252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cunningham, F.; Allen, J.E.; Allen, J.; Alvarez-Jarreta, J.; Amode, M.R.; Armean, I.M.; Austine-Orimoloye, O.; Azov, A.G.; Barnes, I.; Bennett, R.; et al. Ensembl 2022. Nucleic Acids Res. 2022, 50, D988–D995. [Google Scholar] [CrossRef] [PubMed]
- Gordon, J.R.; Zhang, X.; Stevenson, K.; Cosford, K. Thrombin Induces IL-6 but Not TNFalpha Secretion by Mouse Mast Cells: Threshold-Level Thrombin Receptor and Very Low Level FcepsilonRI Signaling Synergistically Enhance IL-6 Secretion. Cell Immunol. 2000, 205, 128–135. [Google Scholar] [CrossRef]
- Shin, J.-S.; Greer, A.M. The Role of FcεRI Expressed in Dendritic Cells and Monocytes. Cell. Mol. Life Sci. 2015, 72, 2349–2360. [Google Scholar] [CrossRef] [Green Version]
- Liang, Y.; Wang, P.; Zhao, M.; Liang, G.; Yin, H.; Zhang, G.; Wen, H.; Lu, Q. Demethylation of the FCER1G Promoter Leads to FcεRI Overexpression on Monocytes of Patients with Atopic Dermatitis. Allergy 2012, 67, 424–430. [Google Scholar] [CrossRef]
- Rajaraman, P.; Brenner, A.V.; Neta, G.; Pfeiffer, R.; Wang, S.S.; Yeager, M.; Thomas, G.; Fine, H.A.; Linet, M.S.; Rothman, N.; et al. Risk of Meningioma and Common Variation in Genes Related to Innate Immunity. Cancer Epidemiol. Biomark. Prev. 2010, 19, 1356–1361. [Google Scholar] [CrossRef] [Green Version]
- Han, S.; Lan, Q.; Park, A.K.; Lee, K.-M.; Park, S.K.; Ahn, H.S.; Shin, H.Y.; Kang, H.J.; Koo, H.H.; Seo, J.J.; et al. Polymorphisms in Innate Immunity Genes and Risk of Childhood Leukemia. Hum. Immunol. 2010, 71, 727–730. [Google Scholar] [CrossRef] [Green Version]
- Karlsson, C.; Dehne, T.; Lindahl, A.; Brittberg, M.; Pruss, A.; Sittinger, M.; Ringe, J. Genome-Wide Expression Profiling Reveals New Candidate Genes Associated with Osteoarthritis. Osteoarthr. Cartil. 2010, 18, 581–592. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Yuan, L.; Wang, Y.; Wang, G.; Zhu, Y.; Cao, R.; Qian, G.; Xie, C.; Liu, X.; Xiao, Y.; et al. Co-Expression Network Analysis Identified FCER1G in Association with Progression and Prognosis in Human Clear Cell Renal Cell Carcinoma. Int. J. Biol. Sci. 2017, 13, 1361–1372. [Google Scholar] [CrossRef] [Green Version]
- Dong, K.; Chen, W.; Pan, X.; Wang, H.; Sun, Y.; Qian, C.; Chen, W.; Wang, C.; Yang, F.; Cui, X. FCER1G Positively Relates to Macrophage Infiltration in Clear Cell Renal Cell Carcinoma and Contributes to Unfavorable Prognosis by Regulating Tumor Immunity. BMC Cancer 2022, 22, 140. [Google Scholar] [CrossRef] [PubMed]

| Characteristics | RA Overall n = 50 | Controls n = 24 | p-Value RA Overall vs. HC |
|---|---|---|---|
| Age, years (SD) | 51 (12.8) | 53 (8.5) | 0.45 |
| Females | 42 (84%) | 17 (70.8%) | 0.31 |
| Disease duration, years | 10 (3–16) | n/a | n/a |
| RF-positive | 34 (68%) | none | n/a |
| ACPA-positive | 46 (92%) | none | n/a |
| ESR, mm/h | 23.5 (8–57) | 15 (7–19) | 0.07 |
| DAS28 | 5.3 (2.11–6.12) | n/a | n/a |
| CRP, mg/dL | 6.52 (0.51–20.76) | 0.58 (0.19–1.97) | 0.003 |
| Number of swollen joints | 3 (0–7) | n/a | n/a |
| Number of painful joints | 4 (1–12) | n/a | n/a |
| VAS PGA | 47.5 (8–70) | n/a | n/a |
| VAS PhGA | 39.5 (5–60) | n/a | n/a |
| Characteristics | RA in High Disease Activity, n = 29 | RA in Remission, n = 21 | p-Value |
|---|---|---|---|
| Age, years (SD) | 54 (13.1) | 47 (11.7) | 0.07 |
| Females | 21 (72.4%) | 21 (100%) | 0.025 |
| Disease duration, years | 10 (3–16) | 9.5 (3–16) | 0.96 |
| RF-positive | 22 (75.9%) | 12 (57.1%) | 0.27 |
| ACPA-positive | 27 (93.1%) | 19 (90.5%) | 0.85 |
| ESR, mm/h | 57 (28–67) | 7 (2–9) | <0.0001 |
| DAS28 | 5.89 (5.34–6.37) | 1.99 (1.58–2.31) | <0.0001 |
| CRP, mg/dL | 17.47 (8.58–29.1) | 0.4 (0.15–1.4) | <0.0001 |
| Number of swollen joints | 6 (4–10) | 0 (0–1) | <0.0001 |
| Number of painful joints | 11 (5–13) | 1 (0–1) | <0.0001 |
| VAS PGA | 68 (55–73) | 8 (3–10) | <0.0001 |
| VAS PhGA | 60 (49–70] | 5 (2–10) | <0.0001 |
| Methotrexate treatment (alone or as a concomitant drug) | 22 (75.9) | 15 (71.4) | 0.98 |
| Methotrexate dose, mg/week | 20 (15–25) | 20 (12.5–25) | 0.64 |
| Gene | Primer Name | Sequence 5′ → 3′ a | Amplicon Size [bp] | Amplicon Location with Reference to Assembly GRCh38 [Chromosome:Start:end:Strand] | Primer Complementary to Methylated/ Unmethylated Sequences |
|---|---|---|---|---|---|
| FCER1G | FCER1G methylated_sense | TGGTTTTTTCGGGAGTCGTTC | 160 | 1:161215165:161215324:+ | methylated sequences |
| FCER1G methylated_antisense | CATCTTAAACTAAAAATCGACCGTTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Podgórska, D.; Cieśla, M.; Kolarz, B. FCER1G Gene Hypomethylation in Patients with Rheumatoid Arthritis. J. Clin. Med. 2022, 11, 4664. https://doi.org/10.3390/jcm11164664
Podgórska D, Cieśla M, Kolarz B. FCER1G Gene Hypomethylation in Patients with Rheumatoid Arthritis. Journal of Clinical Medicine. 2022; 11(16):4664. https://doi.org/10.3390/jcm11164664
Chicago/Turabian StylePodgórska, Dominika, Marek Cieśla, and Bogdan Kolarz. 2022. "FCER1G Gene Hypomethylation in Patients with Rheumatoid Arthritis" Journal of Clinical Medicine 11, no. 16: 4664. https://doi.org/10.3390/jcm11164664
APA StylePodgórska, D., Cieśla, M., & Kolarz, B. (2022). FCER1G Gene Hypomethylation in Patients with Rheumatoid Arthritis. Journal of Clinical Medicine, 11(16), 4664. https://doi.org/10.3390/jcm11164664
