Probiotic Lactobacilli Limit Avian Influenza Virus Subtype H9N2 Replication in Chicken Cecal Tonsil Mononuclear Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Preparation of Cecal Tonsil Mononuclear Cells
2.3. Probiotic Lactobacillus Species, Media, and Growth Conditions
2.4. TLR Ligands
2.5. Virus Strain
2.6. Infection of CT Cells with H9N2 AIV
2.7. Stimulation of CT Cells with a Cocktail of Probiotic Lactobacilli Cocktail and/or CpG ODN 2007
2.8. Evaluation of Antiviral Activity of CT Mononuclear Cells Stimulated with Lactobacilli and/or CpG ODN 2007
2.9. RNA Extraction and Complementary Single-Stranded DNA (cDNA) Synthesis
2.10. Quantitative Real-Time PCR
2.11. Statistical Analyses
3. Results
3.1. Low Pathogenic H9N2 AIV Replicates in Chicken CT Mononuclear Cells
3.2. Stimulation of Chicken CT Mononuclear Cells with Probiotic Lactobacilli Alone or in Combination with CpG ODN Limits H9N2 LPAIV Replication
3.3. Stimulation of Chicken CT Mononuclear Cells with Probiotic Lactobacilli Alone or in Combination with CpG ODN Did not Induce NO Production by CT Cells
3.4. Stimulation of Chicken CT Mononuclear Cells with Probiotic Lactobacilli Induces Cytokine, Chemokine, and Antiviral Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Pillai, S.P.S.; Pantin-Jackwood, M.; Suarez, D.L.; Saif, Y.M.; Lee, C.-W. Pathobiological characterization of low-pathogenicity H5 avian influenza viruses of diverse origins in chickens, ducks and turkeys. Arch. Virol. 2010, 155, 1439–1451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yitbarek, A.; Alkie, T.; Taha-Abdelaziz, K.; Astill, J.; Rodriguez-Lecompte, J.C.; Parkinson, J.; Nagy, É.; Sharif, S. Gut microbiota modulates type I interferon and antibody-mediated immune responses in chickens infected with influenza virus subtype H9N2. Benef. Microbes 2018, 9, 417–427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ICDDR, Bangladesh, I.C for D.D.R., Bangladesh/Government of The People’s Republic of Bangladesh. Outbreak of mild respiratory disease caused by H5N1 and H9N2 infections among young children in Dhaka, Bangladesh. 2011. Available online: https://www-cabdirect-org.subzero.lib.uoguelph.ca/cabdirect/FullTextPDF/2011/20113290802.pdf (accessed on 31 May 2020).
- WHO. Influenza at the Human-Animal Interface, Summary and Assessment as of 3 March 2015. Available online: https://www.who.int/influenza/human_animal_interface/Influenza_Summary_IRA_HA_interface_31_March_2015.pdf (accessed on 30 May 2020).
- Ma, M.-J.; Zhao, T.; Chen, S.-H.; Xia, X.; Yang, X.-X.; Wang, G.-L.; Fang, L.-Q.; Ma, G.-Y.; Wu, M.-N.; Qian, Y.-H.; et al. Avian Influenza A Virus Infection among Workers at Live Poultry Markets, China, 2013–2016. Emerg. Infect. Dis. 2018, 24, 1246–1256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jakhesara, S.J.; Bhatt, V.D.; Patel, N.V.; Prajapati, K.S.; Joshi, C.G. Isolation and characterization of H9N2 influenza virus isolates from poultry respiratory disease outbreak. SpringerPlus 2014, 3, 196. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Guo, X.; Qi, J.; Liu, L.; Wang, J.; Xu, S.; Wang, J.; Yin, Y. Complete Genome Sequence of an H9N2 Influenza Virus Lethal to Chickens. Genome Announc. 2014, 2. [Google Scholar] [CrossRef] [Scilit]
- Park, K.J.; Kwon, H.-I.; Song, M.-S.; Pascua, P.N.Q.; Baek, Y.H.; Lee, J.H.; Jang, H.-L.; Lim, J.-Y.; Mo, I.-P.; Moon, H.-J.; et al. Rapid evolution of low-pathogenic H9N2 avian influenza viruses following poultry vaccination programmes. J. Gen. Virol. 2011, 92, 36–50. [Google Scholar] [CrossRef] [Scilit]
- Peralta, M.F.; Danelli, M.; Vivas, A. Rediscovering the importance of Mucosal Immune System (MIS) in poultry. Acad. J. Biotechnol. 2016, 4, 91–95. [Google Scholar] [CrossRef]
- Kwon, J.-S.; Lee, H.-J.; Lee, D.-H.; Lee, Y.-J.; Mo, I.-P.; Nahm, S.-S.; Kim, M.-J.; Lee, J.-B.; Park, S.-Y.; Choi, I.-S.; et al. Immune responses and pathogenesis in immunocompromised chickens in response to infection with the H9N2 low pathogenic avian influenza virus. Virus Res. 2008, 133, 187–194. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.-H.; Park, J.-K.; Lee, Y.-N.; Song, J.-M.; Kang, S.-M.; Lee, J.-B.; Park, S.-Y.; Choi, I.-S.; Song, C.-S. H9N2 avian influenza virus-like particle vaccine provides protective immunity and a strategy for the differentiation of infected from vaccinated animals. Vaccine 2011, 29, 4003–4007. [Google Scholar] [CrossRef] [Scilit]
- Park, J.-K.; Lee, D.-H.; Cho, C.H.; Yuk, S.-S.; To, E.-O.; Kwon, J.-H.; Noh, J.-Y.; Kim, B.-Y.; Choi, S.-W.; Shim, B.-S.; et al. Supplementation of oil-based inactivated H9N2 vaccine with M2e antigen enhances resistance against heterologous H9N2 avian influenza virus infection. Vet. Microbiol. 2014, 169, 211–217. [Google Scholar] [CrossRef] [Scilit]
- Daviet, S.; Van Borm, S.; Habyarimana, A.; Ahanda, M.-L.E.; Morin, V.; Oudin, A.; Van Den Berg, T.; Zoorob, R. Induction of Mx and PKR Failed to Protect Chickens from H5N1 Infection. Viral Immunol. 2009, 22, 467–472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guan, J.; Fu, Q.; Sharif, S. Replication of an H9N2 Avian Influenza Virus and Cytokine Gene Expression in Chickens Exposed by Aerosol or Intranasal Routes. Avian Dis. 2015, 59, 263–268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spackman, E.; Gelb, J.; Preskenis, L.A.; Ladman, B.S.; Pope, C.R.; Pantin-Jackwood, M.J.; Mckinley, E.T. The pathogenesis of low pathogenicity H7 avian influenza viruses in chickens, ducks and turkeys. Virol. J. 2010, 7, 331. [Google Scholar] [CrossRef] [Scilit]
- Gao, S.; Kang, Y.; Yuan, R.; Ma, H.; Xiang, B.; Wang, Z.; Dai, X.; Wang, F.; Xiao, J.; Liao, M.; et al. Immune Responses of Chickens Infected with Wild Bird-Origin H5N6 Avian Influenza Virus. Front. Microbiol. 2017, 8, 1081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kapczynski, D.R.; Pantin-Jackwood, M.; Guzman, S.G.; Ricardez, Y.; Spackman, E.; Bertran, K.; Suarez, D.L.; Swayne, D.E. Characterization of the 2012 Highly Pathogenic Avian Influenza H7N3 Virus Isolated from Poultry in an Outbreak in Mexico: Pathobiology and Vaccine Protection. J. Virol. 2013, 87, 9086–9096. [Google Scholar] [CrossRef] [Scilit]
- Brisbin, J.T.; Gong, J.; Parvizi, P.; Sharif, S. Effects of Lactobacilli on Cytokine Expression by Chicken Spleen and Cecal Tonsil Cells. Clin. Vaccine Immunol. 2010, 17, 1337–1343. [Google Scholar] [CrossRef] [Scilit]
- Lammers, A.; Wieland, W.H.; Kruijt, L.; Jansma, A.; Straetemans, T.; Schots, A.; den Hartog, G.; Parmentier, H.K. Successive immunoglobulin and cytokine expression in the small intestine of juvenile chicken. Dev. Comp. Immunol. 2010, 34, 1254–1262. [Google Scholar] [CrossRef] [Scilit]
- Tokuhara, D.; Kurashima, Y.; Kamioka, M.; Nakayama, T.; Ernst, P.; Kiyono, H. A comprehensive understanding of the gut mucosal immune system in allergic inflammation. Allergol. Int. 2019, 68, 17–25. [Google Scholar] [CrossRef] [Scilit]
- Taha-Abdelaziz, K.; Alkie, T.N.; Hodgins, D.C.; Shojadoost, B.; Sharif, S. Characterization of host responses induced by Toll-like receptor ligands in chicken cecal tonsil cells. Vet. Immunol. Immunopathol. 2016, 174, 19–25. [Google Scholar] [CrossRef] [Scilit]
- St. Paul, M.; Brisbin, J.T.; Abdul-Careem, M.F.; Sharif, S. Immunostimulatory properties of Toll-like receptor ligands in chickens. Vet. Immunol. Immunopathol. 2013, 152, 191–199. [Google Scholar] [CrossRef] [Scilit]
- Alkie, T.N.; St. Paul, M.; Barjesteh, N.; Brisbin, J.; Sharif, S. Expression profiles of antiviral response genes in chicken bursal cells stimulated with Toll-like receptor ligands. Vet. Immunol. Immunopathol. 2015, 163, 157–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barjesteh, N.; Behboudi, S.; Brisbin, J.T.; Villanueva, A.I.; Nagy, É.; Sharif, S. TLR Ligands Induce Antiviral Responses in Chicken Macrophages. PLoS ONE 2014, 9, e105713. [Google Scholar] [CrossRef] [Scilit]
- Barjesteh, N.; Brisbin, J.T.; Behboudi, S.; Nagy, É.; Sharif, S. Induction of Antiviral Responses Against Avian Influenza Virus in Embryonated Chicken Eggs with Toll-Like Receptor Ligands. Viral Immunol. 2015, 28, 192–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barjesteh, N.; Shojadoost, B.; Brisbin, J.T.; Emam, M.; Hodgins, D.C.; Nagy, É.; Sharif, S. Reduction of avian influenza virus shedding by administration of Toll-like receptor ligands to chickens. Vaccine 2015, 33, 4843–4849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- St. Paul, N.; Mallick, A.I.; Haq, K.; Orouji, S.; Abdul-Careem, M.F.; Sharif, S. In Vivo administration of ligands for chicken toll-like receptors 4 and 21 induces the expression of immune system genes in the spleen. Vet. Immunol. Immunopathol. 2011, 144, 228–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Astill, J.; Alkie, T.; Yitbarek, A.; Taha-Abdelaziz, K.; Shojadoost, B.; Petrik, J.J.; Nagy, É.; Sharif, S. A Comparison of Toll-Like Receptor 5 and 21 Ligands as Adjuvants for a Formaldehyde Inactivated H9N2 Avian Influenza Virus Vaccine in Chickens. Viral Immunol. 2018, 31, 605–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, S.M.; Alkie, T.N.; Hodgins, D.C.; Nagy, É.; Shojadoost, B.; Sharif, S. Systemic immune responses to an inactivated, whole H9N2 avian influenza virus vaccine using class B CpG oligonucleotides in chickens. Vaccine 2015, 33, 3947–3952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alizadeh, M.; Shojadoost, B.; Astill, J.; Taha-Abdelaziz, K.; Karimi, S.H.; Bavananthasivam, J.; Kulkarni, R.R.; Sharif, S. Effects of in ovo Inoculation of Multi-Strain Lactobacilli on Cytokine Gene Expression and Antibody-Mediated Immune Responses in Chickens. Front. Vet. Sci. 2020, 7, 105. [Google Scholar] [CrossRef] [Scilit]
- Brisbin, J.T.; Gong, J.; Orouji, S.; Esufali, J.; Mallick, A.I.; Parvizi, P.; Shewen, P.E.; Sharif, S. Oral Treatment of Chickens with Lactobacilli Influences Elicitation of Immune Responses. Clin. Vaccine Immunol. 2011, 18, 1447–1455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brisbin, J.T.; Davidge, L.; Roshdieh, A.; Sharif, S. Characterization of the effects of three Lactobacillus species on the function of chicken macrophages. Res. Vet. Sci. 2015, 100, 39–44. [Google Scholar] [CrossRef] [Scilit]
- Shojadoost, B.; Kulkarni, R.R.; Brisbin, J.T.; Quinteiro-Filho, W.; Alkie, T.N.; Sharif, S. Interactions between lactobacilli and chicken macrophages induce antiviral responses against avian influenza virus. Res. Vet. Sci. 2019, 125, 441–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taha-Abdelaziz, K.; Astill, J.; Kulkarni, R.R.; Read, L.R.; Najarian, A.; Farber, J.M.; Sharif, S. In Vitro assessment of immunomodulatory and anti-Campylobacter activities of probiotic lactobacilli. Sci. Rep. 2019, 9, 17903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yitbarek, A.; Taha-Abdelaziz, K.; Hodgins, D.C.; Read, L.; Nagy, É.; Weese, J.S.; Caswell, J.L.; Parkinson, J.; Sharif, S. Gut microbiota-mediated protection against influenza virus subtype H9N2 in chickens is associated with modulation of the innate responses. Sci. Rep. 2018, 8, 13189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yitbarek, A.; Astill, J.; Hodgins, D.C.; Parkinson, J.; Nagy, É.; Sharif, S. Commensal gut microbiota can modulate adaptive immune responses in chickens vaccinated with whole inactivated avian influenza virus subtype H9N2. Vaccine 2019, 37, 6640–6647. [Google Scholar] [CrossRef] [Scilit]
- Corthésy, B.; Gaskins, H.R.; Mercenier, A. Cross-Talk between Probiotic Bacteria and the Host Immune System. J. Nutr. 2007, 137, 781S–790S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yurong, Y.; Ruiping, S.; ShiMin, Z.; Yibao, J. Effect of probiotics on intestinal mucosal immunity and ultrastructure of cecal tonsils of chickens. Arch. Anim. Nutr. 2005, 59, 237–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alizadeh, M.; Munyaka, P.; Yitbarek, A.; Echeverry, H.; Rodriguez-Lecompte, J.C. Maternal antibody decay and antibody-mediated immune responses in chicken pullets fed prebiotics and synbiotics. Poult. Sci. 2017, 96, 58–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haghighi, H.R.; Gong, J.; Gyles, C.L.; Hayes, M.A.; Zhou, H.; Sanei, B.; Chambers, J.R.; Sharif, S. Probiotics Stimulate Production of Natural Antibodies in Chickens. Clin. Vaccine Immunol. 2006, 13, 975–980. [Google Scholar] [CrossRef] [Scilit]
- Yang, W.-T.; Yang, G.-L.; Shi, S.-H.; Liu, Y.-Y.; Huang, H.-B.; Jiang, Y.-L.; Wang, J.-Z.; Shi, C.-W.; Jing, Y.-B.; Wang, C.-F. Protection of chickens against H9N2 avian influenza virus challenge with recombinant Lactobacillus plantarum expressing conserved antigens. Appl. Microbiol. Biotechnol. 2017, 101, 4593–4603. [Google Scholar] [CrossRef] [Scilit]
- Bogdan, C. Nitric oxide synthase in innate and adaptive immunity: An update. Trends Immunol. 2015, 36, 161–178. [Google Scholar] [CrossRef] [Scilit]
- Schairer, D.O.; Chouake, J.S.; Nosanchuk, J.D.; Friedman, A.J. The potential of nitric oxide releasing therapies as antimicrobial agents. Virulence 2012, 3, 271–279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yitbarek, A.; Weese, J.S.; Alkie, T.N.; Parkinson, J.; Sharif, S. Influenza A virus subtype H9N2 infection disrupts the composition of intestinal microbiota of chickens. FEMS Microbiol. Ecol. 2018, 94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oláh, I.; Nagy, N.; Vervelde, L. Structure of the Avian Lymphoid System. In Avian Immunology; Elsevier: Amsterdam, The Netherlands, 2014; pp. 11–44. ISBN 978-0-12-396965-1. [Google Scholar]
- Seo, B.J.; Rather, I.A.; Kumar, V.J.R.; Choi, U.H.; Moon, M.R.; Lim, J.H.; Park, Y.H. Evaluation of Leuconostoc mesenteroides YML003 as a probiotic against low-pathogenic avian influenza (H9N2) virus in chickens. J. Appl. Microbiol. 2012, 113, 163–171. [Google Scholar] [CrossRef] [Scilit]
- Chon, H.; Choi, B.; Jeong, G.; Mo, I. Evaluation system for an experimental study of low-pathogenic avian influenza virus (H9N2) infection in specific pathogen free chickens using lactic acid bacteria, Lactobacillus plantarum KFCC11389P. Avian Pathol. 2008, 37, 593–597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pavanelli, W.R.; Gutierrez, F.R.S.; da Silva, J.J.N.; Costa, I.C.; de Menezes Msc, M.C.N.D.; de Abreu Oliveira Msc, F.J.; Itano, E.N.; Watanabe, M.A.E. The effects of nitric oxide on the immune response during giardiasis. Braz. J. Infect. Dis. 2010, 14, 606–612. [Google Scholar] [CrossRef] [Scilit]
- Xing, Z.; Schat, K.A. Inhibitory Effects of Nitric Oxide and Gamma Interferon on In Vitro and In Vivo Replication of Marek’s Disease Virus. J. Virol. 2000, 74, 3605–3612. [Google Scholar] [CrossRef] [Scilit]
- Akaike, T.; Maeda, H. Nitric oxide and virus infection. Immunology 2000, 101, 300–308. [Google Scholar] [CrossRef] [Scilit]
- Perrone, L.A.; Belser, J.A.; Wadford, D.A.; Katz, J.M.; Tumpey, T.M. Inducible Nitric Oxide Contributes to Viral Pathogenesis Following Highly Pathogenic Influenza Virus Infection in Mice. J. Infect. Dis. 2013, 207, 1576–1584. [Google Scholar] [CrossRef] [Scilit]
- Regev-Shoshani, G.; Vimalanathan, S.; McMullin, B.; Road, J.; Av-Gay, Y.; Miller, C. Gaseous nitric oxide reduces influenza infectivity in vitro. Nitric Oxide Biol. Chem. 2013, 31, 48–53. [Google Scholar] [CrossRef] [Scilit]
- Rimmelzwaan, G.F.; Baars, M.M.J.W.; de Lijster, P.; Fouchier, R.A.M.; Osterhaus, A.D.M.E. Inhibition of Influenza Virus Replication by Nitric Oxide. J. Virol. 1999, 73, 8880–8883. [Google Scholar] [CrossRef] [Scilit]
- Höfer, T.; Krichevsky, O.; Altan-Bonnet, G. Competition for IL-2 between Regulatory and Effector T Cells to Chisel Immune Responses. Front. Immunol. 2012, 3, 268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Y.; Cao, W.; Zhu, Y. Immunoregulatory Functions of the IL-12 Family of Cytokines in Antiviral Systems. Viruses 2019, 11, 772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trinchieri, G. Interleukin-12 and interferon-gamma. Do they always go together? Am. J. Pathol. 1995, 147, 1534–1538. [Google Scholar] [PubMed]
- Karupiah, G.; Xie, Q.W.; Buller, R.M.; Nathan, C.; Duarte, C.; MacMicking, J.D. Inhibition of viral replication by interferon-gamma-induced nitric oxide synthase. Science 1993, 261, 1445–1448. [Google Scholar] [CrossRef] [Scilit]
- Takikawa, O.; Habara-Ohkubo, A.; Yoshida, R. IFN-gamma is the inducer of indoleamine 2,3-dioxygenase in allografted tumor cells undergoing rejection. J. Immunol. 1990, 145, 1246–1250. [Google Scholar]
- Akdis, C.A.; Blaser, K. Mechanisms of interleukin-10-mediated immune suppression. Immunology 2001, 103, 131–136. [Google Scholar] [CrossRef] [Scilit]
- Opal, S.M.; De Palo, V.A. Anti-Inflammatory Cytokines (*). Chest 2000, 117, 1162. [Google Scholar] [CrossRef] [Scilit]
- Rojas, J.M.; Avia, M.; Martín, V.; Sevilla, N. IL-10: A Multifunctional Cytokine in Viral Infections. J. Immunol. Res. 2017, 2017. [Google Scholar] [CrossRef] [Scilit]
- Uyemura, K.; Demer, L.L.; Castle, S.C.; Jullien, D.; Berliner, J.A.; Gately, M.K.; Warrier, R.R.; Pham, N.; Fogelman, A.M.; Modlin, R.L. Cross-regulatory roles of interleukin (IL)-12 and IL-10 in atherosclerosis. J. Clin. Investig. 1996, 97, 2130–2138. [Google Scholar] [CrossRef] [Scilit]
- Karpala, A.J.; Stewart, C.; McKay, J.; Lowenthal, J.W.; Bean, A.G.D. Characterization of Chicken Mda5 Activity: Regulation of IFN-β in the Absence of RIG-I Functionality. J. Immunol. 2011, 186, 5397–5405. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.B.; Park, Y.H.; Chungu, K.; Woo, S.J.; Han, S.T.; Choi, H.J.; Rengaraj, D.; Han, J.Y. Targeted Knockout of MDA5 and TLR3 in the DF-1 Chicken Fibroblast Cell Line Impairs Innate Immune Response Against RNA Ligands. Front. Immunol. 2020, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eberle, F.; Sirin, M.; Binder, M.; Dalpke, A.H. Bacterial RNA is recognized by different sets of immunoreceptors. Eur. J. Immunol. 2009, 39, 2537–2547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Funabiki, M.; Kato, H.; Miyachi, Y.; Toki, H.; Motegi, H.; Inoue, M.; Minowa, O.; Yoshida, A.; Deguchi, K.; Sato, H.; et al. Autoimmune Disorders Associated with Gain of Function of the Intracellular Sensor MDA5. Immunity 2014, 40, 199–212. [Google Scholar] [CrossRef] [Scilit]
- Helbig, K.J.; Beard, M.R. The Role of Viperin in the Innate Antiviral Response. J. Mol. Biol. 2014, 426, 1210–1219. [Google Scholar] [CrossRef] [Scilit]
- Mattijssen, S.; Pruijn, G.J.M. Viperin, a key player in the antiviral response. Microbes Infect. 2012, 14, 419–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Gene | Primer Sequence (5′-3′) (F = Forward; R = Reverse) | Annealing Temperature (°C) | GenBank Accession Number |
|---|---|---|---|
| IFN-γ | F: TGGCGGCGGGAGGAAAAGTG | 60 | NM_001030558 |
| R: CACCGTGCTCCAGCTCAGGC | |||
| IL-1β | F: GTGAGGCTCAACATTGCGCTGTA | 64 | Y15006 |
| R: TGTCCAGGCGGTAGAAGATGAAG | |||
| IL-10 | F: AGCAGATCAAGGAGACGTTC | 55 | AJ621614 |
| R: ATCAGCAGGTACTCCTCGAT | |||
| IL-12p40 | F: CCAAGACCTGGAGCACACCGAAG | 60 | AY262752.1 |
| R: CGATCCCTGGCCTGCACAGAGA | |||
| IL-2 | F: GCAGGGCACGTTCAGGTGGG | 58 | NM_204153.1 |
| R: GCCACACAGCCTGGCTCCCT | |||
| IL-6 | F: CTGAAGAACTGGACAGAGAG | 60 | NM_204628.1 |
| R: CACCAGCTTCTGTAAGATGC | |||
| CXCLi2 | F: CTGAAGGTGCAGAAGCAGAG | 64 | AJ009800 |
| R: CCAGCTCTGCCTTGTAGGTT | |||
| MDA5 | F: GCAAAACCAGCACTGAATGGG | 60 | GU570144.1 |
| R: CGTAAATGCTGTTCCACTAACGG | |||
| TGF-β | F: CGGCCGACGATGAGTGGCTC | 60 | M31160.1 |
| R: CGGGGCCCATCTCACAGGGA | |||
| Viperin | F: GGAGGCGGGAATGGAGAAAA | 60 | KY856894.1 |
| R: CAGCTGGCCTACAAATTCGC | |||
| β -Actin | F: CAACACAGTGCTGTCTGGTGGTA | 60 | X00182 |
| R: ATCGTACTCCTGCTTGCTGATCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alqazlan, N.; Alizadeh, M.; Boodhoo, N.; Taha-Abdelaziz, K.; Nagy, E.; Bridle, B.; Sharif, S. Probiotic Lactobacilli Limit Avian Influenza Virus Subtype H9N2 Replication in Chicken Cecal Tonsil Mononuclear Cells. Vaccines 2020, 8, 605. https://doi.org/10.3390/vaccines8040605
Alqazlan N, Alizadeh M, Boodhoo N, Taha-Abdelaziz K, Nagy E, Bridle B, Sharif S. Probiotic Lactobacilli Limit Avian Influenza Virus Subtype H9N2 Replication in Chicken Cecal Tonsil Mononuclear Cells. Vaccines. 2020; 8(4):605. https://doi.org/10.3390/vaccines8040605
Chicago/Turabian StyleAlqazlan, Nadiyah, Mohammadali Alizadeh, Nitish Boodhoo, Khaled Taha-Abdelaziz, Eva Nagy, Byram Bridle, and Shayan Sharif. 2020. "Probiotic Lactobacilli Limit Avian Influenza Virus Subtype H9N2 Replication in Chicken Cecal Tonsil Mononuclear Cells" Vaccines 8, no. 4: 605. https://doi.org/10.3390/vaccines8040605
APA StyleAlqazlan, N., Alizadeh, M., Boodhoo, N., Taha-Abdelaziz, K., Nagy, E., Bridle, B., & Sharif, S. (2020). Probiotic Lactobacilli Limit Avian Influenza Virus Subtype H9N2 Replication in Chicken Cecal Tonsil Mononuclear Cells. Vaccines, 8(4), 605. https://doi.org/10.3390/vaccines8040605

