Anti-Staphylococcus aureus Single-Chain Fragment Variables Play a Protective Anti-Inflammatory Role In Vitro and In Vivo
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Cell Culture
2.2. Preparation of S. aureus Virulence Factors
2.3. Optimization and Bio-Panning of the ScFv Phage Display Library
2.4. Affinity Selection against Virulence Factors
2.5. Expression and Purification of ScFvs
2.6. Adhesion and Invasion of S. aureus on MAC-T Cells
2.7. Bacterial Growth Inhibition Assay
2.8. Assessment of Apoptosis by Immunofluorescence Assay (IFA)
2.9. LDH Cytotoxicity Assay
2.10. Cell Viability Assay
2.11. Animal Experiment
2.12. Bacteria Count of Mammary Gland Tissues
2.13. Histopathological Evaluation of Mammary Gland Tissues
2.14. MPO Activity Assay
2.15. ELISA Assay of Cytokine Expression Levels
2.16. qPCR Assay of Cytokine Transcription Levels
2.17. Statistical Analysis
3. Results
3.1. Expression and Purification of Virulence Factors
3.2. The Characteristics and the Screening of ScFv Phage Library
3.3. Identification and Expression of ScFv
3.4. Characteristics of Purified ScFvs
3.5. ScFvs Can Affect the Adhesion and Invasion of S. aureus on MAC-T Cells
3.6. ScFvs Can Effectively Inhibit the Bacteria Proliferation In Vitro and In Vivo
3.7. ScFvs Can Attenuate the Apoptosis and Necrosis of S. aureus on MAC-T Cells
3.8. ScFvs Can Weaken the Cytotoxicity of S. aureus on MAC-T Cells
3.9. Effect of ScFvs on S. aureus-Induced Histopathologic Changes and MPO Activity of Mammary Gland Tissues
3.10. Effect of ScFvs on Inflammatory Cytokine Production in Mammary Gland Tissues
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Oliveira, L.; Hulland, C.; Ruegg, P. Characterization of clinical mastitis occurring in cows on 50 large dairy herds in Wisconsin. J. Dairy Sci. 2013, 96, 7538–7549. [Google Scholar] [CrossRef] [Scilit]
- Alonzo, F., 3rd; Kozhaya, L.; Rawlings, S.A.; Reyes-Robles, T.; DuMont, A.L.; Myszka, D.G.; Landau, N.R.; Unutmaz, D.; Torres, V.J. CCR5 is a receptor for Staphylococcus aureus leukotoxin ED. Nature 2013, 493, 51–55. [Google Scholar] [CrossRef] [Scilit]
- Naushad, S.; Nobrega, D.B.; Naqvi, S.A.; Barkema, H.W.; De Buck, J. Genomic Analysis of Bovine Staphylococcus aureus Isolates from Milk to Elucidate Diversity and Determine the Distributions of Antimicrobial and Virulence Genes and Their Association with Mastitis. mSystems 2020, 5. [Google Scholar] [CrossRef] [Scilit]
- Jenkins, A.; Diep, B.A.; Mai, T.T.; Vo, N.H.; Warrener, P.; Suzich, J.; Stover, C.K.; Sellman, B.R. Differential expression and roles of Staphylococcus aureus virulence determinants during colonization and disease. mBio 2015, 6, e02272-14. [Google Scholar] [CrossRef] [Scilit]
- Viguier, C.; Arora, S.; Gilmartin, N.; Welbeck, K.; O’Kennedy, R. Mastitis detection: Current trends and future perspectives. Trends Biotechnol. 2009, 27, 486–493. [Google Scholar] [CrossRef] [Scilit]
- Foster, T.J.; Geoghegan, J.A.; Ganesh, V.K.; Hook, M. Adhesion, invasion and evasion: The many functions of the surface proteins of Staphylococcus aureus. Nat. Rev. Microbiol. 2014, 12, 49–62. [Google Scholar] [CrossRef] [Scilit]
- Li, J.N.; Wang, H.; Han, Y.X.; Zhao, Y.T.; Zhou, H.H.; Xu, J.; Li, L. Novel peptides screened by phage display peptide library can mimic epitopes of the FnBPA-A protein and induce protective immunity against Staphylococcus aureus in mice. MicrobiologyOpen 2019, 8, e910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thammavongsa, V.; Kim, H.K.; Missiakas, D.; Schneewind, O. Staphylococcal manipulation of host immune responses. Nat. Rev. Microbiol. 2015, 13, 529–543. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Colpitts, S.L.; Menoret, A.; Budelsky, A.L.; Lefrancois, L.; Vella, A.T. Rapid alphabeta T-cell responses orchestrate innate immunity in response to Staphylococcal enterotoxin A. Mucosal Immunol. 2013, 6, 1006–1015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sagar, A.; Klemm, C.; Hartjes, L.; Mauerer, S.; van Zandbergen, G.; Spellerberg, B. The beta-hemolysin and intracellular survival of Streptococcus agalactiae in human macrophages. PLoS ONE 2013, 8, e60160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kerro-Dego, O.; Prysliak, T.; Perez-Casal, J.; Potter, A.A. Role of GapC in the pathogenesis of Staphylococcus aureus. Vet. Microbiol. 2012, 156, 443–447. [Google Scholar] [CrossRef] [Scilit]
- Herman-Bausier, P.; El-Kirat-Chatel, S.; Foster, T.J.; Geoghegan, J.A.; Dufrene, Y.F. Staphylococcus aureus Fibronectin-Binding Protein A Mediates Cell-Cell Adhesion through Low-Affinity Homophilic Bonds. mBio 2015, 6, e00413-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holmes, M.A.; Zadoks, R.N. Methicillin resistant S. aureus in human and bovine mastitis. J. Mammary Gland. Biol. Neoplasia 2011, 16, 373–382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mushtaq, S.; Shah, A.M.; Shah, A.; Lone, S.A.; Hussain, A.; Hassan, Q.P.; Ali, M.N. Bovine mastitis: An appraisal of its alternative herbal cure. Microb. Pathog. 2018, 114, 357–361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, L.S.; Fowler, V.G.; Shukla, S.K.; Rose, W.E.; Proctor, R.A. Development of a vaccine against Staphylococcus aureus invasive infections: Evidence based on human immunity, genetics and bacterial evasion mechanisms. FEMS Microbiol. Rev. 2020, 44, 123–153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shinefield, H.R.; Black, S. Prevention of Staphylococcus aureus infections: Advances in vaccine development. Expert Rev. Vaccines 2005, 4, 669–676. [Google Scholar] [CrossRef] [Scilit]
- Zhen, Y.H.; Jin, L.J.; Guo, J.; Li, X.Y.; Li, Z.; Fang, R.; Xu, Y.P. Characterization of specific egg yolk immunoglobulin (IgY) against mastitis-causing Staphylococcus aureus. J. Appl. Microbiol. 2008, 105, 1529–1535. [Google Scholar] [CrossRef] [Scilit]
- Rouha, H.; Badarau, A.; Visram, Z.C.; Battles, M.B.; Prinz, B.; Magyarics, Z.; Nagy, G.; Mirkina, I.; Stulik, L.; Zerbs, M.; et al. Five birds, one stone: Neutralization of alpha-hemolysin and 4 bi-component leukocidins of Staphylococcus aureus with a single human monoclonal antibody. MAbs 2015, 7, 243–254. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Zhang, Y.; Zhu, J. Anti-Staphylococcus aureus single-chain variable region fragments provide protection against mastitis in mice. Appl. Microbiol. Biotechnol. 2016, 100, 2153–2162. [Google Scholar] [CrossRef] [Scilit]
- Ascione, A.; Capecchi, B.; Campitelli, L.; Imperiale, V.; Flego, M.; Zamboni, S.; Gellini, M.; Alberini, I.; Pittiglio, E.; Donatelli, I.; et al. Human monoclonal antibodies in single chain fragment variable format with potent neutralization activity against influenza virus H5N1. Antivir. Res. 2009, 83, 238–244. [Google Scholar] [CrossRef] [Scilit]
- Guo, X.; Cao, H.; Wang, Y.; Liu, Y.; Chen, Y.; Wang, N.; Jiang, S.; Zhang, S.; Wu, Q.; Li, T.; et al. Screening scFv antibodies against infectious bursal disease virus by co-expression of antigen and antibody in the bacteria display system. Vet. Immunol. Immunopathol. 2016, 180, 45–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saw, P.E.; Song, E.W. Phage display screening of therapeutic peptide for cancer targeting and therapy. Protein Cell 2019, 10, 787–807. [Google Scholar] [CrossRef] [Scilit]
- Hammers, C.M.; Stanley, J.R. Antibody phage display: Technique and applications. J. Investig. Dermatol. 2014, 134, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Vu, K.B.; Ghahroudi, M.A.; Wyns, L.; Muyldermans, S. Comparison of llama VH sequences from conventional and heavy chain antibodies. Mol. Immunol. 1997, 34, 1121–1131. [Google Scholar] [CrossRef] [Scilit]
- Sompunga, P.; Pruksametanan, N.; Rangnoi, K.; Choowongkomon, K.; Yamabhai, M. Generation of human and rabbit recombinant antibodies for the detection of Zearalenone by phage display antibody technology. Talanta 2019, 201, 397–405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, Y.; Huang, Y.; He, J.; Wang, H.; Luo, Y.; Li, Y.; Liu, J.; Zhong, L.; Zhao, Y. PEGylated immunoliposome-loaded endoglin single-chain antibody enhances anti-tumor capacity of porcine alpha1,3GT gene. Biomaterials 2019, 217, 119231. [Google Scholar] [CrossRef] [Scilit]
- Shaw, I.; O’Reilly, A.; Charleton, M.; Kane, M. Development of a high-affinity anti-domoic acid sheep scFv and its use in detection of the toxin in shellfish. Anal. Chem. 2008, 80, 3205–3212. [Google Scholar] [CrossRef] [Scilit]
- Ge, S.; Xu, L.; Li, B.; Zhong, F.; Liu, X.; Zhang, X. Canine Parvovirus is diagnosed and neutralized by chicken IgY-scFv generated against the virus capsid protein. Vet. Res. 2020, 51, 110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, F.; Chen, Y.; Ke, Y.; Zhang, L.; Zhang, B.; Yang, L.; Zhu, J. Single Chain Fragment Variable (scFv) Antibodies Targeting the Spike Protein of Porcine Epidemic Diarrhea Virus Provide Protection against Viral Infection in Piglets. Viruses 2019, 11, 58. [Google Scholar] [CrossRef] [Scilit]
- Kasprzak, A.; Szmyt, M.; Malkowski, W.; Przybyszewska, W.; Helak-Lapaj, C.; Seraszek-Jaros, A.; Surdacka, A.; Malkowska-Lanzafame, A.; Kaczmarek, E. Analysis of immunohistochemical expression of proinflammatory cytokines (IL-1alpha, IL-6, and TNF-alpha) in gallbladder mucosa: Comparative study in acute and chronic calculous cholecystitis. Folia Morphol. 2015, 74, 65–72. [Google Scholar] [CrossRef] [Scilit]
- Gupta, M.; Babic, A.; Beck, A.H.; Terry, K. TNF-alpha expression, risk factors, and inflammatory exposures in ovarian cancer: Evidence for an inflammatory pathway of ovarian carcinogenesis? Hum. Pathol. 2016, 54, 82–91. [Google Scholar] [CrossRef] [Scilit]
- Kaplanski, G.; Marin, V.; Montero-Julian, F.; Mantovani, A.; Farnarier, C. IL-6: A regulator of the transition from neutrophil to monocyte recruitment during inflammation. Trends Immunol. 2003, 24, 25–29. [Google Scholar] [CrossRef] [Scilit]
- Verdrengh, M.; Thomas, J.A.; Hultgren, O.H. IL-1 receptor-associated kinase 1 mediates protection against Staphylococcus aureus infection. Microbes Infect. 2004, 6, 1268–1272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koksal, H.; Vatansev, H.; Artac, H.; Kadoglou, N. The clinical value of interleukins-8, -10, and -17 in idiopathic granulomatous mastitis. Clin. Rheumatol. 2020, 39, 1671–1677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; French, B.A.; Nelson, T.J.; Li, J.; Tillman, B.; French, S.W. IL-8 signaling is up-regulated in alcoholic hepatitis and DDC fed mice with Mallory Denk Bodies (MDBs) present. Exp. Mol. Pathol. 2015, 99, 320–325. [Google Scholar] [CrossRef] [Scilit]
- Zou, Y.J.; Xu, J.J.; Wang, X.; Zhu, Y.H.; Wu, Q.; Wang, J.F. Lactobacillus johnsonii L531 Ameliorates Escherichia coli-Induced Cell Damage via Inhibiting NLRP3 Inflammasome Activity and Promoting ATG5/ATG16L1-Mediated Autophagy in Porcine Mammary Epithelial Cells. Vet. Sci. 2020, 7, 112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boulanger, D.; Brouillette, E.; Jaspar, F.; Malouin, F.; Mainil, J.; Bureau, F.; Lekeux, P. Helenalin reduces Staphylococcus aureus infection in vitro and in vivo. Vet. Microbiol. 2007, 119, 330–338. [Google Scholar] [CrossRef] [Scilit]
- Schmiedl, A.; Breitling, F.; Dubel, S. Expression of a bispecific dsFv-dsFv’ antibody fragment in Escherichia coli. Protein Eng. 2000, 13, 725–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koti, M.; Farrugia, W.; Nagy, E.; Ramsland, P.A.; Kaushik, A.K. Construction of single-chain Fv with two possible CDR3H conformations but similar inter-molecular forces that neutralize bovine herpesvirus 1. Mol. Immunol. 2010, 47, 953–960. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.; Yin, Y.; Wang, M.; Fan, T.; Zhu, Y.; Shen, L.; Peng, S.; Gao, J.; Deng, G.; Meng, X.; et al. Disrupting phosphatase SHP2 in macrophages protects mice from high-fat diet-induced hepatic steatosis and insulin resistance by elevating IL-18 levels. J. Biol. Chem. 2020, 295, 10842–10856. [Google Scholar] [CrossRef] [Scilit]
- Guo, M.Y.; Li, W.Y.; Zhang, Z.; Qiu, C.; Li, C.; Deng, G. Betulin suppresses S. aureus-induced mammary gland inflammatory injury by regulating PPAR-gamma in mice. Int. Immunopharmacol. 2015, 29, 824–831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.; Zheng, X.; Zhang, M.; Yin, H.; Jiang, K.; Wu, H.; Dai, A.; Yang, S. Nuciferine alleviates LPS-induced mastitis in mice via suppressing the TLR4-NF-kappaB signaling pathway. Inflamm. Res. 2018, 67, 903–911. [Google Scholar] [CrossRef] [Scilit]
- Hua, X.; Zhou, L.; Feng, L.; Ding, Y.; Shi, H.; Wang, L.; Gee, S.J.; Hammock, B.D.; Wang, M. Competitive and noncompetitive phage immunoassays for the determination of benzothiostrobin. Anal. Chim. Acta 2015, 890, 150–156. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Wang, T.; Guan, Y.; Wang, F.; Zhu, J. The preparation and therapeutic roles of scFv-Fc antibody against Staphylococcus aureus infection to control bovine mastitis. Appl. Microbiol. Biotechnol. 2019, 103, 1703–1712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merghni, A.; Ben Nejma, M.; Helali, I.; Hentati, H.; Bongiovanni, A.; Lafont, F.; Aouni, M.; Mastouri, M. Assessment of adhesion, invasion and cytotoxicity potential of oral Staphylococcus aureus strains. Microb. Pathog. 2015, 86, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Idziorek, T.; Estaquier, J.; De Bels, F.; Ameisen, J.C. YOPRO-1 permits cytofluorometric analysis of programmed cell death (apoptosis) without interfering with cell viability. J. Immunol. Methods 1995, 185, 249–258. [Google Scholar] [CrossRef] [Scilit]
- Su, Y.T.; Chen, R.; Wang, H.; Song, H.; Zhang, Q.; Chen, L.Y.; Lappin, H.; Vasconcelos, G.; Lita, A.; Maric, D.; et al. Novel Targeting of Transcription and Metabolism in Glioblastoma. Clin. Cancer Res. 2018, 24, 1124–1137. [Google Scholar] [CrossRef] [Scilit]
- Gao, W.; Yang, J.; Liu, W.; Wang, Y.; Shao, F. Site-specific phosphorylation and microtubule dynamics control Pyrin inflammasome activation. Proc. Natl. Acad. Sci. USA 2016, 113, E4857–E4866. [Google Scholar] [CrossRef] [Scilit]
- Wang-Bishop, L.; Chen, Z.; Gomaa, A.; Lockhart, A.C.; Salaria, S.; Wang, J.; Lewis, K.B.; Ecsedy, J.; Washington, K.; Beauchamp, R.D.; et al. Inhibition of AURKA Reduces Proliferation and Survival of Gastrointestinal Cancer Cells with Activated KRAS by Preventing Activation of RPS6KB1. Gastroenterology 2019, 156, 662–675. [Google Scholar] [CrossRef] [Scilit]
- Alonzo, F., 3rd; Benson, M.A.; Chen, J.; Novick, R.P.; Shopsin, B.; Torres, V.J. Staphylococcus aureus leucocidin ED contributes to systemic infection by targeting neutrophils and promoting bacterial growth in vivo. Mol. Microbiol. 2012, 83, 423–435. [Google Scholar] [CrossRef] [Scilit]
- Chen, F.; Liu, B.; Wang, D.; Wang, L.; Deng, X.; Bi, C.; Xiong, Y.; Wu, Q.; Cui, Y.; Zhang, Y.; et al. Role of sortase A in the pathogenesis of Staphylococcus aureus-induced mastitis in mice. FEMS Microbiol. Lett. 2014, 351, 95–103. [Google Scholar] [CrossRef] [Scilit]
- Tuchscherr, L.P.; Buzzola, F.R.; Alvarez, L.P.; Caccuri, R.L.; Lee, J.C.; Sordelli, D.O. Capsule-negative Staphylococcus aureus induces chronic experimental mastitis in mice. Infect. Immun. 2005, 73, 7932–7937. [Google Scholar] [CrossRef] [Scilit]
- Ge, B.J.; Zhao, P.; Li, H.T.; Sang, R.; Wang, M.; Zhou, H.Y.; Zhang, X.M. Taraxacum mongolicum protects against Staphylococcus aureus-infected mastitis by exerting anti-inflammatory role via TLR2-NF-kappaB/MAPKs pathways in mice. J. Ethnopharmacol. 2021, 268, 113595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shao, G.; Tian, Y.; Wang, H.; Liu, F.; Xie, G. Protective effects of melatonin on lipopolysaccharide-induced mastitis in mice. Int. Immunopharmacol. 2015, 29, 263–268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.; Guo, X.; Qi, W.; Wu, Z.; de Bruijn, J.D.; Xiao, Y.; Bao, C.; Yuan, H. Macrophage polarization plays roles in bone formation instructed by calcium phosphate ceramics. J. Mater. Chem. B 2020, 8, 1863–1877. [Google Scholar] [CrossRef] [Scilit]
- Torres, V.J.; Stauff, D.L.; Pishchany, G.; Bezbradica, J.S.; Gordy, L.E.; Iturregui, J.; Anderson, K.L.; Dunman, P.M.; Joyce, S.; Skaar, E.P. A Staphylococcus aureus regulatory system that responds to host heme and modulates virulence. Cell Host Microbe 2007, 1, 109–119. [Google Scholar] [CrossRef] [Scilit]
- Vrieling, M.; Boerhout, E.M.; van Wigcheren, G.F.; Koymans, K.J.; Mols-Vorstermans, T.G.; de Haas, C.J.; Aerts, P.C.; Daemen, I.J.; van Kessel, K.P.; Koets, A.P.; et al. LukMF’ is the major secreted leukocidin of bovine Staphylococcus aureus and is produced in vivo during bovine mastitis. Sci. Rep. 2016, 6, 37759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakwinska, O.; Giddey, M.; Moreillon, M.; Morisset, D.; Waldvogel, A.; Moreillon, P. Staphylococcus aureus host range and human-bovine host shift. Appl. Environ. Microbiol. 2011, 77, 5908–5915. [Google Scholar] [CrossRef] [Scilit]
- Wang, T.; Song, X.; Zhang, Z.; Guo, M.; Jiang, H.; Wang, W.; Cao, Y.; Zhu, L.; Zhang, N. Stevioside inhibits inflammation and apoptosis by regulating TLR2 and TLR2-related proteins in S. aureus-infected mouse mammary epithelial cells. Int. Immunopharmacol. 2014, 22, 192–199. [Google Scholar] [CrossRef] [Scilit]
- Jia, F.; Ma, W.; Zhang, X.; Wang, D.; Zhou, X. Matrine and baicalin inhibit apoptosis induced by Panton-Valentine leukocidin of Staphylococcus aureus in bovine mammary epithelial cells. J. Dairy Sci. 2020, 103, 2731–2742. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Chen, W.; Ali, T.; Alkasir, R.; Yin, J.; Liu, G.; Han, B. Staphylococcal enterotoxin H induced apoptosis of bovine mammary epithelial cells in vitro. Toxins 2014, 6, 3552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, G.; Gao, Y.; Wang, H.; Niu, X.; Wang, J. Baicalin Weakens Staphylococcus aureus Pathogenicity by Targeting Sortase B. Front. Cell. Infect. Microbiol. 2018, 8, 418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.; Yao, H.; Wang, S.; Li, H.; Hou, X. Mangiferin Inhibits Apoptosis and Autophagy Induced by Staphylococcus aureus in RAW264.7 Cells. J. Inflamm. Res. 2020, 13, 847–857. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Primer Name | Sequence (5′-3′) | Size (bp) | Reference |
|---|---|---|---|
| Coa-F | CGCGGATCCAGCTTATTTACATGGGAT | 1932 | This study |
| Coa-R | CCGCTCGAGTTATTTTGTTACTCTAGGC | ||
| Hlb-F | CGCGGATCCGCCGAATCTAAGAAAGATGA | 891 | This study |
| Hlb-R | CCGCTCGAGTTTACTATAGGCTTTGATTGGA | ||
| FnBPA-A-F | CCGGGATCCGCATCAGAACAAAAGACAAC | 1629 | This study |
| FnBPA-A-R | CCGAAGCTTTATCAATAGCTGATGAATCCG | ||
| GapC-F | CGCGGATCCATGGCAGTAAAAGTAG | 1008 | This study |
| GapC-R | CCGCTCGAGTTTAGAAAGTTCAGCTAAG | ||
| IL-18-F | TGGTTCCATGCTTTCTGGACTCCT | 132 | [40] |
| IL-18-R | TTCCTGGGCCAAGAGGAAGTGATT | ||
| TNF-α-F | GCCTCCCTCTCATCAGTCTA | 223 | [41] |
| TNF-α-R | GGCAGCCTTGTCCCTG | ||
| IL-6-F | AGTTGTGCATGGCAATTCTGA | 213 | [41] |
| IL-6-R | AGGACTCTGGCTTGTCTTTCT | ||
| IL-1β-F | ACCTGTGTCTTCCCGTGG | 171 | [41] |
| IL-1β-R | TCATCTCGAGCCTGTAGTG | ||
| IL-8-F | CGGCAATGAAGCTTCTGTAT | 224 | [35] |
| IL-8-R | CCTTGAAACTCTTTGCCTCA | ||
| GAPDH-F | CAATGTGTCCGTCGTGGATCT | 124 | [42] |
| GAPDH-R | GTCCTCAGTGTAGCCCAAGATG |
| Round of Screening | Input (cfu/mL) | Output (cfu/mL) | Output/Input | Enrichment Fold | Total Enrichment Fold |
|---|---|---|---|---|---|
| 1 | 1.12 × 1013 | 1.00 × 106 | 8.93 × 10−8 | 1 | |
| 2 | 1.09 × 1013 | 1.58 × 106 | 1.45 × 10−7 | 1.62 | |
| 3 | 1.15 × 1013 | 3.12 × 106 | 2.71 × 10−7 | 1.87 | |
| 4 | 1.21 × 1013 | 4.39 × 107 | 3.63 × 10−6 | 13.39 | |
| 5 | 1.05 × 1013 | 1.40 × 108 | 1.33 × 10−5 | 3.66 | 148.93 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Ye, X.; Zhang, Y.; Wang, F.; Zhang, F.; Jia, Y.; Wu, D.; Tohti, K.; Cheng, M.; Zhu, J. Anti-Staphylococcus aureus Single-Chain Fragment Variables Play a Protective Anti-Inflammatory Role In Vitro and In Vivo. Vaccines 2021, 9, 1300. https://doi.org/10.3390/vaccines9111300
Zhang L, Ye X, Zhang Y, Wang F, Zhang F, Jia Y, Wu D, Tohti K, Cheng M, Zhu J. Anti-Staphylococcus aureus Single-Chain Fragment Variables Play a Protective Anti-Inflammatory Role In Vitro and In Vivo. Vaccines. 2021; 9(11):1300. https://doi.org/10.3390/vaccines9111300
Chicago/Turabian StyleZhang, Lei, Xin Ye, Yan Zhang, Fengqing Wang, Fanqing Zhang, Yan Jia, Dangjin Wu, Kalbinur Tohti, Manling Cheng, and Jianguo Zhu. 2021. "Anti-Staphylococcus aureus Single-Chain Fragment Variables Play a Protective Anti-Inflammatory Role In Vitro and In Vivo" Vaccines 9, no. 11: 1300. https://doi.org/10.3390/vaccines9111300
APA StyleZhang, L., Ye, X., Zhang, Y., Wang, F., Zhang, F., Jia, Y., Wu, D., Tohti, K., Cheng, M., & Zhu, J. (2021). Anti-Staphylococcus aureus Single-Chain Fragment Variables Play a Protective Anti-Inflammatory Role In Vitro and In Vivo. Vaccines, 9(11), 1300. https://doi.org/10.3390/vaccines9111300

