Ameliorative Impacts of an Essential Oil Blend on Immune Function and Intestinal Health in Broilers Challenged with a High-Dose Coccidial Vaccine
Abstract
1. Introduction
2. Materials and Methods
2.1. Essential Oil Blend and Drugs
2.2. Animal Ethics Statement
2.3. Experimental Design
2.4. Experimental Diet and Animal Management
2.5. Growth Performance
(number of remaining birds × trial days + trial days of dead or removed birds)
2.6. Quantification of Coccidian Oocyst Shedding in Feces
2.7. Sample Collection
2.8. Intestinal Lesion Score
2.9. Organ Index
2.10. Measurement of Serum Antioxidant Capacity
2.11. Serum Immunological Parameters
2.12. Analysis of Intestinal Morphology
2.13. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.14. Statistical Analysis
3. Results
3.1. Growth Performance of Broilers
3.2. Fecal Oocysts Count and Intestinal Lesion Scores
3.3. Organ Index of Broilers
3.4. Serum Antioxidant Capacity of Broilers
3.5. Serum Immunity of Broilers
3.6. Intestinal Health of Broilers in Duodenum and Jejunum
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| V:C | villus height-to-crypt depth |
| IgG | immunoglobulin G |
| TGF-β | transforming growth factor-β |
| BW | body weight |
| ADG | average daily gain |
| ADFI | average daily feed intake |
| F:G | average daily feed intake: average daily gain |
| OPG | oocyst per gram |
| T-AOC | total antioxidant capacity |
| MDA | malondialdehyde |
| SOD | superoxide dismutase |
| GSH-Px | glutathione peroxidase |
| IL | interleukin |
| MUC | mucin |
| ZO-1 | zonula occludens-1 |
References
- Attree, E.; Sanchez-Arsuaga, G.; Jones, M.; Xia, D.; Marugan-Hernandez, V.; Blake, D.; Tomley, F. Controlling the causative agents of coccidiosis in domestic chickens; an eye on the past and considerations for the future. CABI Agric. Biosci. 2021, 2, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bedford, M.R.; Apajalahti, J.H. The influence of nutrition on intestinal disease with emphasis on coccidiosis. Avian Pathol. 2022, 51, 504–520. [Google Scholar] [CrossRef] [Scilit]
- Kim, E.; Létourneau-Montminy, M.P.; Lambert, W.; Chalvon-Demersay, T.; Kiarie, E.G. Centennial review: A meta-analysis of the significance of Eimeria infection on apparent ileal amino acid digestibility in broiler chickens. Poult. Sci. 2022, 101, 101625. [Google Scholar] [CrossRef] [Scilit]
- Hailegebreal, G.; Molla Tanga, B.; Woldegiorgis, W.; Sulayeman, M.; Sori, T. Epidemiological investigation of morbidity and mortality of improved breeds of chickens in small holder poultry farms in selected districts of Sidama Region, Ethiopia. Heliyon 2022, 8, e10074. [Google Scholar] [CrossRef] [Scilit]
- Martins, R.R.; Silva, L.J.G.; Pereira, A.M.P.T.; Esteves, A.; Duarte, S.C.; Pena, A. Coccidiostats and poultry: A comprehensive review and current legislation. Foods 2022, 11, 2738. [Google Scholar] [CrossRef] [Scilit]
- Broom, L.J. Evidence-based consideration of dietary ‘alternatives’ to anticoccidial drugs to help control poultry coccidial infections. World’s Poult. Sci. J. 2021, 77, 43–54. [Google Scholar] [CrossRef] [Scilit]
- Snyder, R.P.; Guerin, M.T.; Hargis, B.M.; Kruth, P.S.; Page, G.; Rejman, E.; Rotolo, J.L.; Sears, W.; Zeldenrust, E.G.; Whale, J.; et al. Restoration of anticoccidial sensitivity to a commercial broiler chicken facility in Canada. Poult. Sci. 2021, 100, 663–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flores, R.A.; Nguyen, B.T.; Cammayo, P.L.T.; Võ, T.C.; Naw, H.; Kim, S.; Kim, W.H.; Na, B.K.; Min, W. Epidemiological investigation and drug resistance of Eimeria species in Korean chicken farms. BMC Vet. Res. 2022, 18, 277. [Google Scholar] [CrossRef] [Scilit]
- Abd El-Hack, M.E.; El-Saadony, M.T.; Saad, A.M.; Salem, H.M.; Ashry, N.M.; Abo Ghanima, M.M.; Shukry, M.; Swelum, A.A.; Taha, A.E.; El-Tahan, A.M.; et al. Essential oils and their nanoemulsions as green alternatives to antibiotics in poultry nutrition: A comprehensive review. Poult. Sci. 2022, 101, 101584. [Google Scholar] [CrossRef] [Scilit]
- Brenes, A.; Roura, E. Essential oils in poultry nutrition: Main effects and modes of action. Anim. Feed Sci. Technol. 2010, 158, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Lee, K.W.; Everts, H.; Beynen, A. Essential oils in broiler nutrition. Int. J. Poult. Sci. 2004, 3, 738–752. [Google Scholar] [CrossRef] [Scilit]
- Hesabi Nameghi, A.; Edalatian, O.; Bakhshalinejad, R. Effects of a blend of thyme, peppermint and eucalyptus essential oils on growth performance, serum lipid and hepatic enzyme indices, immune response and ileal morphology and microflora in broilers. J. Anim. Physiol. Anim. Nutr. 2019, 103, 1388–1398. [Google Scholar] [CrossRef] [Scilit]
- Ghiasvand, A.R.; Khatibjoo, A.; Mohammadi, Y.; Akbari Gharaei, M.; Shirzadi, H. Effect of fennel essential oil on performance, serum biochemistry, immunity, ileum morphology and microbial population, and meat quality of broiler chickens fed corn or wheat-based diet. Br. Poult. Sci. 2021, 62, 562–572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Liu, Y.; Yan, F.; Yang, C.; Yang, X. Effects of encapsulated organic acids and essential oils on intestinal barrier, microbial count, and bacterial metabolites in broiler chickens. Poult. Sci. 2019, 98, 2858–2865. [Google Scholar] [CrossRef] [Scilit]
- De Pablos, L.M.; dos Santos, M.F.; Montero, E.; Garcia-Granados, A.; Parra, A.; Osuna, A. Anticoccidial activity of maslinic acid against infection with Eimeria tenella in chickens. Parasitol. Res. 2010, 107, 601–604. [Google Scholar] [CrossRef] [Scilit]
- Yong, T.; Chen, M.; Li, Y.; Song, X.; Huang, Y.; Chen, Y.; Jia, R.; Zou, Y.; Li, L.; Yin, L.; et al. Anticoccidial effect of Fructus Meliae toosendan extract against Eimeria tenella. Pharm. Biol. 2020, 58, 636–645. [Google Scholar] [CrossRef] [Scilit]
- Felici, M.; Tugnoli, B.; Ghiselli, F.; Massi, P.; Tosi, G.; Fiorentini, L.; Piva, A.; Grilli, E. In vitro anticoccidial activity of thymol, carvacrol, and saponins. Poult. Sci. 2020, 99, 5350–5355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olanrewaju, H.A.; Thaxton, J.P.; Dozier, W.A.; Purswell, J.; Roush, W.B.; Branton, S.L. A review of lighting programs for broiler production. Int. J. Poult. Sci. 2006, 5, 301–308. [Google Scholar] [CrossRef] [Scilit]
- Johnson, J.; Reid, W.M. Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 1970, 28, 30–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fleige, S.; Walf, V.; Huch, S.; Prgomet, C.; Sehm, J.; Pfaffl, M.W. Comparison of relative mRNA quantification models and the impact of RNA integrity in quantitative real-time RT-PCR. Biotechnol. Lett. 2006, 28, 1601–1613. [Google Scholar] [CrossRef] [Scilit]
- Williams, R.B. Fifty years of anticoccidial vaccines for poultry (1952–2002). Avian Dis. 2002, 46, 775–802. [Google Scholar] [CrossRef] [Scilit]
- Mohiti-Asli, M.; Ghanaatparast-Rashti, M. Dietary oregano essential oil alleviates experimentally induced coccidiosis in broilers. Prev. Vet. Med. 2015, 120, 195–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tonda, R.M.; Rubach, J.K.; Lumpkins, B.S.; Mathis, G.F.; Poss, M.J. Effects of tannic acid extract on performance and intestinal health of broiler chickens following coccidiosis vaccination and/or a mixed-species Eimeria challenge. Poult. Sci. 2018, 97, 3031–3042. [Google Scholar] [CrossRef] [Scilit]
- Bafundo, K.W.; Duerr, I.; McNaughton, J.L.; Johnson, A.B. The effects of a quillaja and yucca combination on performance and carcass traits of coccidia-vaccinated broilers exposed to an enteric disease challenge. Poult. Sci. 2021, 100, 101391. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Shi, J.; Li, K.; Zheng, H.; Zhang, W.; Yi, X.; Liu, M.; Bo, R.; Li, J. Eucalyptus oil: A promising anticoccidial agent with multifaceted protective effects. Vet. Parasitol. 2025, 336, 110455. [Google Scholar] [CrossRef] [Scilit]
- Geng, T.; Ruan, X.; Xie, Y.; Shen, B.; Fang, R.; Zhao, J.; Zhou, Y. Anticoccidial activity of a botanical natural product based on eucalyptus, apigenin and eugenol against Eimeria tenella in broiler chickens. Parasites Vectors 2024, 17, 327. [Google Scholar] [CrossRef] [Scilit]
- Qaid, M.M.; Al-Mufarrej, S.I.; Azzam, M.M.; Al-Garadi, M.A. Anticoccidial effectivity of a traditional medicinal plant, Cinnamomum verum, in broiler chickens infected with Eimeria tenella. Poult. Sci. 2021, 100, 100902. [Google Scholar] [CrossRef] [Scilit]
- Tebay, L.E.; Robertson, H.; Durant, S.T.; Vitale, S.R.; Penning, T.M.; Dinkova-Kostova, A.T.; Hayes, J.D. Mechanisms of activation of the transcription factor Nrf2 by redox stressors, nutrient cues, and energy status and the pathways through which it attenuates degenerative disease. Free Radic. Biol. Med. 2015, 88, 108–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelhady, A.Y.; El-Safty, S.A.; Hashim, M.; Ibrahim, M.A.; Mohammed, F.F.; Elbaz, A.M.; Abdel-Moneim, A.E. Comparative evaluation of single or combined anticoccidials on performance, antioxidant status, immune response, and intestinal architecture of broiler chickens challenged with mixed Eimeria species. Poult. Sci. 2021, 100, 101162. [Google Scholar] [CrossRef] [Scilit]
- Bozkurt, M.; Ege, G.; Aysul, N.; Akşit, H.; Tüzün, A.E.; Küçükyılmaz, K.; Borum, A.E.; Uygun, M.; Akşit, D.; Aypak, S.; et al. Effect of anticoccidial monensin with oregano essential oil on broilers experimentally challenged with mixed Eimeria spp. Poult. Sci. 2016, 95, 1858–1868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaur, S.; Bansal, Y.; Kumar, R.; Bansal, G. A panoramic review of IL-6: Structure, pathophysiological roles and inhibitors. Bioorganic Med. Chem. 2020, 28, 115327. [Google Scholar] [CrossRef] [Scilit]
- Fillatreau, S.; Sweenie, C.H.; McGeachy, M.J.; Gray, D.; Anderton, S.M. B cells regulate autoimmunity by provision of IL-10. Nat. Immunol. 2002, 3, 944–950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, Y.; Wi, H.; Choi, M.; Hong, S.; Bae, Y. Regulation of anti-inflammatory cytokines IL-10 and TGF-β in mouse dendritic cells through treatment with Clonorchis sinensis crude antigen. Exp. Mol. Med. 2014, 46, e74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W. TGF-β regulation of T cells. Annu. Rev. Immunol. 2023, 41, 483–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bournazos, S.; Ravetch, J.V. Diversification of IgG effector functions. Int. Immunol. 2017, 29, 303–310. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.W.; Kim, D.H.; Kim, Y.B.; Jeong, S.B.; Oh, S.T.; Cho, S.Y.; Lee, K.W. Dietary encapsulated essential oils improve production performance of coccidiosis-vaccine-challenged broiler chickens. Animals 2020, 10, 481. [Google Scholar] [CrossRef] [Scilit]





| Items | 1–21 D | 22–42 D |
|---|---|---|
| Ingredients, g | ||
| Corn | 501.35 | 393.65 |
| Soybean meal | 254.00 | 206.00 |
| Wheat | -- | 150.00 |
| Wheat flour | 80.00 | -- |
| Canola meal | 30.00 | |
| Cottonseed meal | 50.00 | 50.00 |
| Dicalcium phosphate | 11.70 | 10.00 |
| Corn gluten meal | 50.00 | 50.00 |
| Limestone | 13.50 | 13.40 |
| Duck fat | 11.00 | 70.00 |
| NaCl | 2.60 | 2.40 |
| L-Lysine·HCl | 2.85 | 1.75 |
| DL-Methionine | 3.00 | 2.80 |
| Premix 1 | 20.00 | 20.00 |
| Total | 1000.00 | 1000.00 |
| Nutrient levels 2 | ||
| Metabolizable energy, Kcal/kg | 2900.00 | 3200.00 |
| Crude protein, % | 23.00 | 22.00 |
| Crude fat, % | 3.80 | 8.83 |
| Crude fiber, % | 3.00 | 3.00 |
| Calcium, % | 0.90 | 0.88 |
| Available phosphorus, % | 0.58 | 0.56 |
| Lysine, % | 1.32 | 1.28 |
| Genes 1 | Primer Sequences (5′-3′) 2 | Product (bp) |
|---|---|---|
| GAPDH | F: TGACCACTGTCCATGCCATC | 135 |
| R: CTTTCCCCACAGCCTTAGCA | ||
| Occludin | F: ATCAACGACCGCCTCAATCA | 112 |
| R: TCCGCTTCAGGTCTTTGAGC | ||
| Claudin-4 | F: CATCGCCCTGTCCGTCATC | 131 |
| R: AGTTCATCCACAGCCCTTCC | ||
| Mucin-2 | F: TGTGTAACTGCACCAAGGCT | 154 |
| R: TCACACTCCCAATGCCAACA | ||
| ZO-1 | F: GCCTACTGCTGCTCCTTACA | 113 |
| R: GCGGTAAGGATGATGGCTCT |
| Items 1 | CON | EC | AT | EOB200 | EOB400 | SEM | P1 | P2 |
|---|---|---|---|---|---|---|---|---|
| 1 to 21 d | ||||||||
| BW1, g | 40.91 | 40.86 | 40.95 | 40.86 | 40.85 | 0.034 | 0.654 | 0.751 |
| BW21, g | 631.88 | 625.29 | 641.93 | 635.52 | 608.05 | 7.196 | 0.798 | 0.446 |
| ADFI, g | 45.76 | 46.84 ab | 48.68 a | 46.29 ab | 44.77 b | 0.397 | 0.799 | 0.018 |
| ADG, g | 29.55 | 29.22 | 30.05 | 29.73 | 28.36 | 0.359 | 0.363 | 0.448 |
| F:G | 1.55 | 1.61 | 1.62 | 1.57 | 1.58 | 0.016 | 0.369 | 0.675 |
| 22 to 42 d | ||||||||
| BW22, g | 635.01 | 610.33 | 636.34 | 637.30 | 613.23 | 8.055 | 0.444 | 0.586 |
| BW42, g | 2261.14 | 2204.69 b | 2381.68 a | 2197.01 b | 2155.83 b | 23.831 | 0.496 | 0.001 |
| ADFI, g | 142.81 | 136.70 | 135.16 | 133.64 | 132.74 | 2.342 | 0.438 | 0.910 |
| ADG, g | 77.59 | 75.21 b | 82.85 a | 74.36 b | 73.71 b | 0.924 | 0.538 | <0.001 |
| F:G | 1.86 | 1.80 a | 1.63 b | 1.80 a | 1.81 a | 0.356 | 0.718 | 0.055 |
| Items 1 | CON | EC | AT | EOB200 | EOB400 | SEM | P1 | P2 |
|---|---|---|---|---|---|---|---|---|
| Liver | 2.56 | 2.66 | 2.76 | 2.73 | 2.74 | 0.042 | 0.324 | 0.903 |
| Spleen | 0.12 | 0.12 | 0.12 | 0.12 | 0.12 | 0.002 | 0.617 | 0.923 |
| Bursa of fabricius | 0.27 | 0.28 | 0.32 | 0.30 | 0.29 | 0.009 | 0.898 | 0.588 |
| Duodenum | 1.64 | 1.66 | 1.45 | 1.69 | 1.65 | 0.037 | 0.945 | 0.246 |
| Jejunum | 2.64 | 2.50 | 2.51 | 2.51 | 2.88 | 0.070 | 0.516 | 0.248 |
| Ileum | 1.87 | 2.03 | 1.80 | 1.93 | 2.11 | 0.065 | 0.511 | 0.593 |
| Thymus | 0.27 | 0.23 | 0.25 | 0.23 | 0.27 | 0.013 | 0.341 | 0.822 |
| Items 1 | CON | EC | AT | EOB200 | EOB400 | SEM | P1 | P2 |
|---|---|---|---|---|---|---|---|---|
| Duodenum | ||||||||
| Occludin | 1.00 | 1.37 | 0.88 | 1.79 | 1.59 | 0.157 | 0.484 | 0.389 |
| ZO-1 | 1.00 | 0.60 | 0.49 | 0.34 | 0.70 | 0.120 | 0.426 | 0.640 |
| Jejunum | ||||||||
| Occludin | 1.00 | 0.75 | 0.66 | 0.84 | 0.96 | 0.073 | 0.327 | 0.564 |
| ZO-1 | 1.00 | 1.28 | 1.47 | 0.95 | 1.53 | 0.150 | 0.324 | 0.708 |
| Mucin-2 | 1.00 | 0.88 | 0.74 | 0.57 | 0.85 | 0.097 | 0.728 | 0.770 |
| Claudin-4 | 1.00 | 0.97 | 1.46 | 0.70 | 1.13 | 0.135 | 0.919 | 0.469 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Yang, H.; Li, M.; Liu, C.; Hung, Y.; Shen, B.; Guo, S.; Xu, R.; Hu, T.; Geng, W.; Wang, G.; et al. Ameliorative Impacts of an Essential Oil Blend on Immune Function and Intestinal Health in Broilers Challenged with a High-Dose Coccidial Vaccine. Vaccines 2026, 14, 178. https://doi.org/10.3390/vaccines14020178
Yang H, Li M, Liu C, Hung Y, Shen B, Guo S, Xu R, Hu T, Geng W, Wang G, et al. Ameliorative Impacts of an Essential Oil Blend on Immune Function and Intestinal Health in Broilers Challenged with a High-Dose Coccidial Vaccine. Vaccines. 2026; 14(2):178. https://doi.org/10.3390/vaccines14020178
Chicago/Turabian StyleYang, Hongjun, Minmin Li, Chunxue Liu, Yifen Hung, Bo Shen, Shuaipeng Guo, Rui Xu, Tao Hu, Wenjing Geng, Gaiqin Wang, and et al. 2026. "Ameliorative Impacts of an Essential Oil Blend on Immune Function and Intestinal Health in Broilers Challenged with a High-Dose Coccidial Vaccine" Vaccines 14, no. 2: 178. https://doi.org/10.3390/vaccines14020178
APA StyleYang, H., Li, M., Liu, C., Hung, Y., Shen, B., Guo, S., Xu, R., Hu, T., Geng, W., Wang, G., & Zhao, J. (2026). Ameliorative Impacts of an Essential Oil Blend on Immune Function and Intestinal Health in Broilers Challenged with a High-Dose Coccidial Vaccine. Vaccines, 14(2), 178. https://doi.org/10.3390/vaccines14020178

