Next Article in Journal
Prevention of Cardiovascular Diseases with Standard-Dose Quadrivalent Influenza Vaccine in People Aged ≥50 Years in Australia During the 2017 A/H3N2 Epidemic
Previous Article in Journal
Salmonella-Based Vaccine: A Promising Strategy for Type 1 Diabetes
Previous Article in Special Issue
COVALENCE STUDY: Immunogenicity and Reactogenicity of a COVID-19 mRNA Vaccine in an Open-Label Cohort of Long-Survivor Patients with Metastatic Lung Cancer
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Next-Generation Adenoviral Vector-Based Vaccines for Severe Acute Respiratory Syndrome Coronavirus-2

by
Muralimanohara S. T. Murala
,
Vivek Gairola
,
Ekramy E. Sayedahmed
and
Suresh K. Mittal
*
Department of Comparative Pathobiology, Purdue Institute of Inflammation, Immunology and Infectious Disease, College of Veterinary Medicine, Purdue University, West Lafayette, IN 47907-2027, USA
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Vaccines 2025, 13(4), 406; https://doi.org/10.3390/vaccines13040406
Submission received: 18 March 2025 / Revised: 8 April 2025 / Accepted: 11 April 2025 / Published: 14 April 2025
(This article belongs to the Collection COVID-19 Vaccines and Vaccination)

Abstract

This review systematically revises adenovirus (Ad) biology, vector structure, immune responses, and currently available Ad vector COVID-19 vaccines. It analyzes the challenges associated with the Ad vector-based vaccines, including preexisting vector immunity and other side effects. Moreover, this review explores novel and innovative strategies to overcome these constraints for developing next-generation vaccines for broad protection to cover emerging SARS-CoV-2 variants. The future refinement of Ad vaccine platforms will be pivotal in achieving durable immunity against emerging variants for global preparedness.

1. Introduction

In late 2019, an extremely contagious coronavirus, Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2), emerged in China, causing the pandemic of acute respiratory illness known as ‘coronavirus disease 2019′ (COVID-19) [1,2]. The rapid global dissemination of SARS-CoV-2 sparked widespread public health concern and had a significant socio-economic impact worldwide. This emphasizes our vulnerability to emerging pathogens and stresses the significance of developing safe and effective vaccines to combat COVID-19. Diverse vaccine platforms, such as inactivated virus, adenoviral (Ad) vector [3], subunit [4], mRNA [5], and DNA [6], were utilized to quickly develop effective vaccines for mass production to meet the global demand. These vaccines have been pivotal in reducing the disease severity and mitigating virus spread [7,8], saving millions of lives during the COVID-19 pandemic, one of the most severe global health crises in modern history. Notably, their development was achieved in record time, with emergency use authorization granted just 11 months after the SARS-CoV-2 genome was sequenced.
Despite the significant achievements of COVID-19 vaccines, several shortcomings became apparent over time. Continuous mutations in the viral genome have led to the emergence of new variants, resulting in the reduced protective efficacy of the vaccines generated using the ancestral strains. Although these vaccines were effective in abating disease severity, they failed to prevent infection and virus transmission [9]. Furthermore, the durability of protection conferred by current COVID-19 vaccines is short [10].
Setting aside the challenges associated with vaccines, it is crucial not to underestimate the significance of Ad vector-based vaccine platforms for developing the next generation of SARS-CoV-2 vaccines with better efficacy against emerging variants. Ad vector vaccines have played a pivotal role in the global endeavor to combat SARS-CoV-2-associated illnesses and deaths [11]. Overall, Ad vector-based vaccine platforms have substantial cloning capacity, efficient transduction efficiency, ease of bulk production in a short time, are excellent in eliciting both humoral and cellular immune responses, and have a safety profile like other vaccine platforms [12]. However, one of the limitations of Ad vectors is the development of strong immune responses against the vector backbone, thereby restricting their reusability within a short duration [13]. The presence of preexisting Ad vector immunity in a high percentage of the population due to exposure to common human Ads also has the potential to curb the utility of certain human Ad vector-based vaccines [14]. Innovative strategies in vector structure, formulation, and delivery have been employed to address these limitations.

2. Shortcomings of Current SARS-CoV-2 Vaccines

While various vaccine platforms have been deployed to combat COVID-19, all face challenges such as waning immunity, reduced cross-variant protection, and incomplete prevention from virus transmission. Understanding these broad limitations provides context for assessing platform-specific issues, particularly those of Ad vector-based vaccines.

2.1. Decreased Vaccine Efficacy Against Emerging SARS-CoV-2 Variants

The existing vaccines target specific virus strains, resulting in limited cross-reactivity and reduced protection against new variants. A luminescence-based lentiviral-based pseudovirus neutralization assay demonstrated that the individuals who received two doses of the BNT162b2 or mRNA-1273 vaccines showed a robust neutralization of the wild-type virus. However, their neutralization efficacy against variants varied significantly [15]. The D614G variant showed minimal reductions in neutralization titers (1.2- to 1.4-fold decrease), while variants with RBD mutations, such as the UK B.1.1.7, Denmark B.1.1.298, and California B.1.429, exhibited moderate reductions (1.4- to 2.3-fold). More resistant strains, such as the Brazilian/Japanese P.2 and P.1 variants, showed greater decreases in neutralization titers (5.8- to 6.7-fold), and the South African B.1.351 variants exhibited the most significant reductions (27.7- to 42.4-fold). This substantial resistance to neutralization was primarily attributed to mutations in the RBD region of the S protein, although additional mutations outside the RBD were also responsible for a lower response to vaccine-induced immunity [15]. Another study in the rodent model highlighted the reduced neutralizing efficacy of Ad-vectored vaccines against emerging SARS-CoV-2 variants [16]. Similarly, Ad-vectored vaccines have shown reduced neutralization efficacy against emerging SARS-CoV-2 variants, with studies indicating that preexisting Ad immunity and antigenic drift contribute to lower immune responses against novel variants. Vaccines targeting specific variants, like Delta, provided strong neutralization against Delta variants and cross-protection against mismatched variants (e.g., Gamma), but their efficacy against Omicron subvariants (BA.2 and BA.5) significantly diminished [16], underscoring the challenge of VOCs on vaccine efficacy.

2.2. Short Durability of Protective Immune Responses

The duration of protection provided by different COVID-19 vaccines has shown varying degrees of decline over time based on the vaccine type and number of doses administered. For the two-dose mRNA vaccines, BNT162b2 (Pfizer–BioNTech, New York, NY, USA) and mRNA-1273 (Moderna, Cambridge, MA, USA), the effectiveness against COVID-19 infection was 94.5% and 95.9%, respectively, at 2 months post-vaccination, decreasing to 66.6% and 80.3%, respectively, by 7 months. The Ad26.COV2.S (Johnson & Johnson–Janssen, Beerse, Belgium) one-dose vaccine showed a vaccine efficacy of 74.8% at 1 month, dropping to 59.4% by 5 months [10]. For the heterologous AZD1222 and mRNA vaccine regimen, the effectiveness was 89% at 15–30 days and 66% from day 121 onwards. In contrast, the homologous AZD1222 two-dose vaccine showed a reduction in effectiveness from 68% at 15–30 days to undetectable effectiveness from day 121 onwards [17].

2.3. Failure to Prevent Disease Symptoms and Virus Transmission

COVID-19 vaccines have proven highly effective in reducing the severity of symptomatic disease, hospitalizations, and ICU admissions; however, their role in preventing virus transmission remains questionable [18]. A UK cohort study revealed that the transmission rates among vaccinated individuals were similar to those of the unvaccinated, thereby challenging the assumption that vaccination curbs virus spread [19]. Further studies in Israel and the USA discovered that vaccinated individuals could carry viral loads comparable to those of unvaccinated people, raising concerns about virus transmission [20]. Research on secondary attack rates (SARs) showed mixed results since no reduction in infectiousness due to vaccination was observed in a few studies, while others reported a moderate effect [21]. In addition, incorporating nucleocapsid as an antigen to improve vaccine effectiveness demonstrated that vaccines were unable to prevent breakthrough infections in K18-ACE2 mice [22]. These findings suggest that despite the benefits of COVID-19 vaccines in reducing disease severity, virus transmission from vaccinated individuals after infection remains a challenge.

3. Ad Biology, Vector Structure, and Immune Responses

Ads are non-enveloped dsDNA viruses classified under the family Adenoviridae, which comprises six genera: Mastadenovirus, Aviadenovirus, Atadenovirus, Ichtadenovirus, Siadenovirus, and Testadenovirus [23]. The predominantly used Ads for vector development include human Ads (HAds) (over eighty-five types in seven groups; A–G) [24], chimpanzee Ads (six groups; A–F) [25], bovine Ads (ten types), canine Ads (two types), porcine Ads (five types), Ovine Ads (seven types), and fowl Ads (five types) [13,26]. Ads are generally species-specific, and many of them usually cause inapparent-to-mild infections. However, in the presence of predisposing factors like stress and immunosuppression, they instigate various pathologies in humans and animals, ranging from respiratory tract infections, gastroenteritis, enteritis, keratoconjunctivitis, hepatitis, icterus, cystitis, adenitis, nephritis, polyarthritis, hydropericardium syndrome, etc. [27,28].
Ad virions are 90–120 nm in size and comprise an icosahedral capsid with pseudo-triangulation number = 25 [29]. A single molecule of linear dsDNA of 24–48 kbp in size serves as the viral genome (Figure 1). It is flanked by inverted terminal repeats of 26–721 bp in length and has a covalently linked terminal protein at the 5′ end of each strand [30]. The capsid consists of 240 hexons (edges and faces) and 12 penton complexes (vertices), each consisting of the penton base and a projecting trimeric fiber (most Ads) [31]. The N-terminal stem anchors the fiber to the penton base, while the C-terminal knob serves as a ligand for the cellular receptors [31]. For most Ads, including HAds (subgroups A, C, D, E, and F), the initial high-affinity interaction of the fiber knob occurs with the coxsackie–Ad receptor (CAR; primary receptor) on the permissive host cells like epithelial cells, myoblast, endothelial cells, and hepatocytes [32]. A secondary interaction between the penton base and integrins follows, leading to cell entry [33]. CAR also serves as a primary receptor for many nonhuman Ads, including chimpanzee Ads, canine Ads, and avian Ads [34,35,36]. Other primary cell entry receptors used by Ads include CD80/86 and CD46 (subgroup B HAds), α (2,3)-linked and α (2,6)-linked sialic acid (BAds), heparan sulfate proteoglycans (subgroup B HAds), polysialic acid (HAd52), vascular cell adhesion molecule-1 (HAd52), and desmoglein-2 (subgroup B HAds; HAd3,7,11, and 14) [37,38,39].
Ad attachment triggers a signaling cascade, and the virus ultimately enters the cell via clathrin-coated endosomes [40]. In the endosome, the capsid is partly disassembled, the endosomal membrane disintegrates, and the virion escapes into the cytoplasm [41]. The virion is then carried to the nuclear pore complex (NPC) by dynein microtubules, and the viral genome, along with the core proteins, are subsequently delivered to the nucleus [42,43]. The viral genome is transcribed as five early (E1A, E1B, E2, E3, and E4), two intermediate (IX and IVa2), and one late (L) transcriptional unit. The early genes’ products make host cells conducive for virus replication and modulate host immune responses [44]. Intermediate and late gene products take part in viral assembly and maturation [44]. They encode structural proteins, i.e., capsomers and core proteins, which assemble to form empty capsids under the regulation of chaperons or scaffolding proteins [45,46]. The packaging proteins consisting of the packaging motor (IVa2) and small terminates (22K and 33K) interact with cis-acting packaging positioned next to the left ITR and package the viral genome into the empty capsids [47,48]. Mature virions are subsequently released from the host cell following lysis.
Several Ads have been developed for vectored vaccines and gene therapy [49,50]. Ad vector design strategies have evolved to enhance ease in vector recovery, safety, and transgene expression and to modulate innate immune responses (Figure 2A). Different Ad types exhibit varying levels of virulence, with some causing mild respiratory or enteric disease, while others lead to systemic infections. To mitigate potential risks, attenuation strategies such as gene deletions and modifications have been employed to enhance vector safety. There are three generations of vectors based on Ad gene deletion regions [51]. First-generation Ad vectors lack either E1 or both E1 and E3 regions, rendering the vector replication incompetent and increasing the foreign gene insertion capacity (Figure 2B) [52]. However, these vectors can only proliferate in a cell line, like the human embryonic kidney cell line 293 (HEK-293), which continuously expresses E1 proteins [53]. Second-generation Ad vectors were engineered by deleting additional gene regions such as E2 and/or E4, along with E1 and E3, aiming to diminish vector immunogenicity and increase the transgene insertion capacity (Figure 2C) [54]. Third-generation Ad vectors or gutless Ad vectors are devoid of all Ad genes, excluding ITRs and genome packaging sequences, resulting in enhanced safety and reduced immunogenicity to the vector, but their production requires a helper Ad (Figure 2D) [55,56,57].
The adjuvant action of Ad vectors results in enhanced innate immune responses, leading to robust adaptive immune responses [58]. Ad pathogen-associated molecular patterns (PAMPs) interact with multiple endosomal and cell surface pathogen recognition receptors (PRRs) on antigen-presenting cells (dendritic cells and macrophages), culminating in a cascade of immune signaling [59,60]. Following attachment to host cells, viral surface proteins interact with the cellular receptors (e.g., CAR and integrins) and activate Toll-like receptors (TLRs), including TLR2, TLR3, TLR4, TLR7, and TLR9 [58]. TLR-independent cytosolic DNA sensors like cyclic GMP-AMP synthase/stimulator of interferon genes (cGAS/STING) and NLR family pyrin domain-containing 3 (NLRP3) inflammasomes also become activated [61,62].
HAd5 is the most widely used Ad vector in vaccine research due to its well-characterized genome, high transduction efficiency, and ability to elicit both humoral- and cell-mediated immune responses [63,64,65,66]. The HAd5 hexon protein also interacts with the blood coagulation factor X (FX) and activates TLR4 [67]. Various adaptor proteins, like myeloid differentiation primary response 88 (MyD88), interferon regulatory factor 3 (IRF3), TNF receptor-associated factor 6 (TRAF6), and TIR domain-containing adaptor-inducing interferon (TRIF), mediate the downstream signaling of these pathways and ultimately activate nuclear factor-kappa B (NF-κB) [68,69]. Upregulated NF-κB boosts the expression of various proinflammatory cytokines and chemokines, including interferon-gamma (IFN-γ), interleukin (IL)-1, tumor necrosis factor-alpha (TNF-α), IL-1β, IL2, IL8, IL6, macrophage inflammatory protein alpha (MIP-α), MIP-1, MIP-2, C–C chemokine ligand 2 (CCL2), CCL3, CCL4, C-X-C motif chemokine ligand 1 (CXCL1), CXCL2, and others [70,71,72].
Innate immune responses induced by Ad initiate the adaptive immune responses targeted toward the transgene and vector proteins. The expressed antigens are presented to naïve T cells, which subsequently differentiate into effector and memory cells [73]. However, the induction of vector-specific neutralizing antibodies and vector-specific CD4+ and CD8+ T cells wanes vector efficacy, thereby significantly attenuating the expression of the transgene following the re-administration of the same vector [12].

4. Licensed Ad Vector-Based SARS-CoV-2 Vaccines

At the start of the SARS-CoV-2 pandemic, efforts were made to develop Ad vector-based COVID-19 vaccines utilizing human Ad (HAd5 and HAd26) and chimpanzee Ad (ChAd) platforms containing the genetically modified SARS-CoV-2 spike (S) gene [3]. These Ad-vectored vaccines expressed high levels of the S protein, inducing robust S-specific humoral and CMI responses following vaccination [74,75]. Ad-vectored COVID-19 vaccines served a vital role in combating COVID-19-related sickness and deaths worldwide (Table 1).

4.1. AZD1222 Vaccine

AZD1222, a ChAd (ChAdOx1) vector expressing the SARS-CoV-2 S protein, was developed by AstraZeneca in collaboration with the University of Oxford, UK [76]. The Serum Institute of India has developed its version of AZD1222, known as Covishield [77].
The preclinical evaluation of the AZD1222 vaccine in rhesus macaque monkeys (six animals/group) using a one- or two-dose regimen of 2.5 × 1010 virus particles (VPs) administered intramuscularly was pursued [78]. The vaccine showed no adverse events. S-specific neutralizing antibodies appeared within 14 days post-vaccination, with a notable increase following the booster dose. The vaccinated monkeys exhibited lower clinical disease scores and reduced lung viral loads following the challenge with SARS-CoV-2 compared to the control group.
The clinical safety, efficacy, and immunogenicity of the AZD1222 vaccine were further investigated in five key clinical trials: COV001 (UK, Phase 1/2), COV002 (UK, Phase 2/3), COV003 (Brazil, Phase 3), COV004 (Kenya, Phase 1/2), and COV005 (South Africa, Phase 1/2). In COV001, out of 1077 participants, 543 received a standard dose (SD) of AZD1222 (5 × 1010 VP), while the others received a control vaccine. After one dose, S-binding and virus-neutralizing antibodies were detected, with a significant increase in post-boost given 56 days later in a small segment of participants. The immune response was Th1 biased, characterized by an increased production of IFNγ and TNFα [74]. The COV002 trial involved 560 participants divided into three age groups: 18–55, 56–69, and ≥70 years. Two dose regimens were tested: a low dose (LD) (2.2 × 1010 VP) and an SD (3.5–6.5 × 1010 VP). The antibody responses were consistent across all age groups, though slightly lower in the LD group. The vaccine demonstrated better tolerability in older adults. In this trial, AZD1222 achieved an efficacy of 70.4% with two doses. Efficacy increased to 90.0% when the first dose was low, and the second dose was standard. Higher efficacy was observed with longer intervals between doses, with a median interval of 69 days in the SD/SD group [79].
The COV003 trial focused on high-risk participants, including healthcare workers, across six sites in Brazil. Participants received two SDs of AZD1222 (3.5–6.5 × 1010 VP) administered up to 12 weeks apart. The vaccine efficacy in this trial was 62.1% [80]. The COV004 study was a Phase 1/2 randomized controlled trial conducted in Kenya to evaluate the safety and immunogenicity of AZD1222 compared to a rabies vaccine. A total of 400 volunteers participated, with 200 receiving AZD1222 and 200 receiving the rabies vaccine. Results showed that 28 days after the second dose, 99.5% of participants vaccinated with AZD1222 developed anti-S IgG antibodies, compared to 41.2% in the rabies vaccine group [81]. The COV005 trial was conducted at seven sites in South Africa and included adults with and without HIV, who received two doses (3.5–6.5 × 1010 VP) of AZD1222 or a placebo, with dose intervals ranging from less than 4 weeks to a maximum of 12 weeks. Vaccine efficacy against symptomatic and asymptomatic infections was 90.6% for wild type, 77.1% for Delta, and 6.7% for Beta variants [82].
A large, randomized, double-blind, placebo-controlled Phase 3 trial carried out in the United States, Chile, and Peru further evaluated the safety, efficacy, and immunogenicity of two doses (5 × 1010 VP) of AZD1222 in 32,451 participants, including older adults. AZD1222 was safe, with incidences of serious adverse events being low and comparable to those of the placebo group. Most local and systemic reactions were mild to moderate. The overall vaccine efficacy against symptomatic COVID-19 was estimated at 74%. In participants aged 65 years or older, the vaccine efficacy was 83.5%. Severe or critical COVID-19 cases were not observed among fully vaccinated participants, while eight cases occurred in the placebo group. The vaccine efficacy for preventing SARS-CoV-2 infection was 64.3% [80].

4.2. Ad26.COV2.S Vaccine

The HAd26 vector-based COVID-19 vaccine expressing a modified version of the S protein of SARS-CoV-2, Ad26.COV2.S, was developed by the Janssen Pharmaceutical Company of Johnson & Johnson [3]. The S gene modifications included the replacement of amino acids at positions 986 and 987 with two prolines (2Ps) to stabilize the S protein in a pre-fusion conformation. The preclinical studies with a single dose of the Ad26.COV2.S vaccine demonstrated strong humoral and CMI responses and protection efficacy across various species, including mice, rabbits, Syrian hamsters, and nonhuman primates [75,83]. The vaccine significantly reduced the lung viral load following a SARS-CoV-2 challenge in Syrian hamsters, while nonhuman primates showed undetectable viral loads in both the nose and lungs. Six months post-vaccination, most macaques maintained undetectable lung viral loads, indicating long-lasting protection [83,84,85].
The Ad26.COV2.S vaccine was evaluated clinically through five key trials assessing safety, immunogenicity, and efficacy. COV1001 was a multicenter, randomized, placebo-controlled Phase 1–2a study that involved healthy adults aged 18–55 and those 65 years or older. Participants received a 5 × 1010 VP (LD) or 1 × 1011 VP (high dose) of the vaccine in a two-dose or single-dose regimen. Adverse events were mild to moderate and commonly included fatigue, myalgia, headache, and pain at the injection site, while fever was less common. The adverse reactions were lower in older participants and those receiving the LD. Neutralizing antibody responses were robust, with seroconversion rates of 90% or higher by day 29, and T-cell responses showed a skew toward Th1 helper T cells. The second dose significantly boosted antibody titers [86]. COV1002 was conducted in Japan, involving healthy adults aged 20–55 and 65 years or older who received two doses of Ad26.COV2.S 56 days apart. Neutralizing antibody responses observed at 29 days post-vaccination were comparable to those in COV1001 [87]. COV2001, a randomized, placebo-controlled Phase 2a trial, was conducted in Germany, Spain, and the Netherlands. The study involved adults aged 18–55 and those 65 years or older. It evaluated the vaccine’s safety, reactogenicity, and humoral immune response. Participants received higher doses of Ad26.COV2.S, which were found to be more immunogenic and reactogenic than lower doses. Neutralizing antibodies (VNAs) and S-binding antibodies (S-bAbs) were observed to persist for at least six months following a single 5 × 1010 VP dose. Longer intervals between doses were shown to enhance immune responses, suggesting robust immune memory [88]. COV3001, a pivotal Phase 3 trial, evaluated the single-dose regimen of Ad26.COV2.S. The trial enrolled 39,321 SARS-CoV-2-negative participants, who were randomized 1:1 to receive either Ad26.COV2.S (5 × 1010 VP) or the placebo. The vaccine demonstrated an efficacy of 66.9% at ≥14 days and 66.1% at ≥28 days against moderate-to-severe COVID-19 infection. Protection against severe-to-critical cases was 76.7% at ≥14 days and 85.4% at ≥28 days. In South Africa, where the 20H/501Y.V2 variant was predominant, vaccine efficacy ranged from 52% to 64% against moderate-to-severe cases and reached 81.7% for severe cases [89]. COV3009, a Phase 3 trial, evaluated a two-dose regimen with a booster dose at 2 months and enrolled 31,300 participants across 10 countries. Vaccine efficacy against moderate-to-severe COVID-19 was 75.2% (95% CI 54.6–87.3) at least 14 days post-booster, primarily against the alpha and mu variants. Safety analysis in 6067 participants indicated transient, mild-to-moderate adverse events with similar frequencies after primary and booster doses [90].

4.3. Gam-COVID-Vac Vaccine

Gamaleya Research Institute, Russia, developed Sputnik V (Gam-COVID-Vac), employing HAd26 and HAd5 vectors expressing the S protein of SARS-CoV-2 for the prime and boost approach [91]. Preclinical studies were conducted in several animal models to assess the systemic toxicity, immunotoxicity, and allergenicity of Gam-COVID-Vac. Single-dose toxicity studies in mice, rabbits, and primates were pursued with higher doses than those intended for human use. Allergenicity was tested in guinea pigs, and immunotoxicity was evaluated in mice. The results indicated no signs of toxicity, allergenicity, or immunotoxicity. However, these studies have not been published as peer-reviewed articles [91].
In Phase I, nine volunteers received components 1 or 2 of Gam-COVID-Vac and were monitored for 28 days. In Phase II, 20 volunteers were primed with component 1, and at 21 days post-prime, boosted with component 2, and then monitored until day 42. The results from Phase I inferred that both components were safe and immunogenic. Phase II demonstrated a significant increase in humoral immunity, including S-specific and VNAs. In addition, there was a marked increase in CD4/CD8 lymphocyte proliferation and IFN-γ secretion in immunized individuals [92].
A randomized, double-blind, placebo-controlled Phase 3 trial enrolled participants aged 18 and older who were negative for SARS-CoV-2 without a history of recent infections or vaccinations. The trial was conducted at 25 sites in Moscow, Russia, and participants were assigned randomly in a 3:1 ratio to receive either the vaccine or a placebo. Sixteen COVID-19 cases were reported among 18,695 participants who received both doses of the vaccine compared to 62 cases in the placebo group, resulting in a vaccine efficacy of 91.6%. The vaccine provided 100% protection against moderate-to-severe COVID-19, with nearly the same efficacy across age groups or genders. The seroconversion rate of 98.64% was achieved in vaccinated subjects by day 42, indicating the development of strong humoral and CMI responses [93].

4.4. Convidecia Vaccine

The Convidecia (Ad5-nCOV) vaccine, developed by CanSino Biologics Inc., Tianjin, China, was based on HAd5 expressing the SARS-CoV-2 S protein [94]. Preclinical studies with the vaccine demonstrated strong immunogenicity and protection efficacy in animal models, including mice, rats, guinea pigs, ferrets, and cynomolgus monkeys. A dose–response effect in inducing S-specific humoral and CMI responses was observed in mice, guinea pigs, rats, and cynomolgus monkeys, and protection studies were conducted in hACE2 transgenic mice, ferrets, and rhesus monkeys [95,96].
The Phase 1 clinical study of the Ad5-nCoV vaccine was conducted in Wuhan, China, in 108 adults aged 18–60, who received one of three doses (5 × 1010, 1 × 1011, or 1.5 × 1011 VP). All dose groups showed good safety and immunogenicity [14]. The Phase 2 study was conducted in 508 participants immunized with the low (5 × 1010 VP) or medium (1 × 1011 VP) dose. Binding antibodies were elicited in at least 94%, including VNAs in at least 75% of the participants on day 28 [97]. The Phase 3 trial was pursued in 36,982 participants from Argentina, Mexico, Chile, Pakistan, and Russia, and the Ad5-nCoV vaccine elicited significantly higher levels of S- or RBD-specific IgG antibodies and VNAs. There was a 32-fold increase in geometric mean antibody titers, with seroconversion rates of 92% for RBD-specific IgG antibodies and 76% for VNAs [98].
The AZD1222 and Ad26.COV2-S vaccines were developed using a nonhuman Ad (ChAdOx1) or less prevalent HAd26, respectively, to overcome preexisting Ad vector immunity. Similarly, the Sputnik V vaccine employed a prime and boost approach utilizing HAd26 and HAd5 with the objectives of mitigating preexisting Ad vector immunity and inducing higher levels of S-specific immune responses. The use of billions of Ad vector-based vaccine doses in humans led to protection against SARS-CoV-2-associated disease and death.
Table 1. Comparison of adenoviral vector-based COVID-19 vaccines.
Table 1. Comparison of adenoviral vector-based COVID-19 vaccines.
VaccineVector TypeAntigen DesignDosing RegimenStorage ConditionsVariant EfficacyReferences
ASTRAZENECA (AZD1222)ChAd (ChAdOx1)Full-length spike protein with stabilizing changesTwo doses, i.m.−20 °C for long-term storage; 2–8 °C for short-term storageEffective against B.1.1.7; reduced efficacy against B.1.351[82,99,100]
JANSSEN
(Ad26.COV2.S)
HAd26Full-length spike protein with stabilizing mutationsSingle dose, i.m.2–8 °C for up to 3 months; −20 °C for up to 2 yearsEffective against B.1.1.7, B.1.351, and P.2 variants[89,101]
SPUTNIK V
(Gam-COVID-Vac)
HAd26 for prime, HAd5 for boostFull-length spike protein using prime-boost strategyTwo doses, i.m.Available in two formulations: frozen (−18 °C) and lyophilized (2–8 °C)Effective against B.1.1.7, but neutralizing antibody response is significantly reduced against B.1.351, P.1, and B.1.1.28 variants[102,103]
CONVIDECIA
(Ad5-nCoV)
HAd5Full-length spike protein Single dose, i.m.Stored at 2–8 °CLimited data available regarding efficacy against emerging variants[94,97,104,105]

5. Challenges Associated with Ad Vector-Based Vaccines

Certain side effects or challenges are expected with any vaccine platform. Potential challenges associated with Ad vector-based vaccines include preexisting Ad immunity, vaccine-induced thrombotic thrombocytopenia, Guillain–Barré syndrome, and limited protection efficacy against variant strains. In this section, some of the potential challenges are discussed.

5.1. Preexisting Ad Immunity

There are over 85 types of HAds that infect humans, leading to infections ranging from inapparent to severe disease [106]. Due to their high prevalence, individuals are exposed to one or more types of HAds during their childhood and continue to obtain repeated infections later in life. In addition, the immunization of people with Ad-vectored COVID-19 vaccines used during the SARS-CoV-2 pandemic also contributed toward preexisting Ad vector immunity [75,76,91,96]. Sero-surveillance studies have elucidated that 40–90% of individuals harbor VNAs against HAd5, the most extensively studied HAd [106,107]. Preexisting Ad immunity, arising from prior natural Ad infections and vaccination, affects the efficacy of Ad-vectored vaccines by hindering vector uptake and subsequently reducing the development of immunogen-specific adaptive immune responses [108] (Figure 3A). Individuals with preexisting HAd5 immunity showed reduced levels of immunogen-specific antibody responses following immunization with the HAd5-based COVID-19 vaccine compared to those with minimal preexisting HAd5 immunity [97]. A substantial preexisting HAd5 neutralizing antibody titer (>1:200) significantly diminishes the neutralizing antibody titers against SARS-CoV-2 in individuals immunized either by the intranasal or intramuscular route [97]. Additionally, there were reductions in the number of IFN-γ-secreting cells in response to the SARS-CoV-2 spike protein [12,97]. Moreover, in sub-Saharan Africa, approximately 40% of human serum samples show the presence of VNAs against ChAd6, while about 15% show VNAs against ChAd7. This suggests that vaccines based on ChAd6 may have lower efficacy in the region [109].
To investigate the persistence of Ad vector immunity and its influence on the generation of adaptive immune responses against the vaccine immunogen, naïve or HAd5-primed mouse groups were vaccinated with HAd-H5HA [HAd expressing hemagglutinin (HA) of the H5N1 influenza virus] at 1, 3, 6, and 10 months post-HAd5 priming. H5HA-specific immune responses and protective efficacy were monitored [110]. A sufficient decline in HAd5 immunity was observed six months after HAd5 priming, allowing successful protective immunity using the same vector system. This suggests that annual vaccination using the same vector may be feasible due to the significant decline in vector immunity.

5.2. Vaccine-Induced Immune Thrombotic Thrombocytopenia

One of the rare but serious side effects of vaccines is vaccine-induced immune thrombotic thrombocytopenia (VITT), characterized by the formation of blood clots and a decrease in platelet levels after vaccination [111]. VITT and heparin-induced thrombocytopenia (HIT) share similarities in their pathophysiology [112]. For VITT, it has been proposed that the positively charged platelet factor 4 (PF4) protein interacts with the negatively charged inter-hexon spaces of Ad [113]. This interaction creates a platform for subsequent events, including the formation of antibodies against a complex formed by the binding of PF4 to the inter-hexon spaces. These anti-PF4 antibodies then bind to the platelets’ FcγRIIa receptor via their Fc region, leading to the antibody-mediated activation of platelets and the formation of blood clots, especially in cerebral veins (cerebral venous sinus thrombosis) and splanchnic circulation [114,115] (Figure 3B). Similarly, in HIT, platelet activation is triggered by antibodies formed against PF4 when it binds to a substrate, highlighting a shared mechanism in both conditions [111]. While the two conditions share similarities, it is important to note that they have distinct triggers (heparin in HIT and vaccines in VITT). In VITT, anti-PF4 antibodies seem to exhibit greater persistence compared to HIT. Antibodies to the PF4 complex in VITT can continue to stimulate platelet activation for many months after the initial acute phase and are detected for nine months or beyond [116,117,118]. In contrast, antibodies to the PF4 complex have half-lives ranging from 50 to 85 days for HIT [119]. In two studies on VITT, the interval between vaccination and the onset of VITT symptoms was observed after nine days post-Ad26.COV2.S vaccination or fourteen days post-AZD1222 vaccination [120]. Clinical symptoms in patients were chronic headache or pain in the abdomen, sporadic breathing, high blood pressure, discomfort in the chest, limb swelling, or serious cardiopulmonary difficulties. The classical cases showed both blood clot formation and a decrease in platelet levels [111]. It may be advisable not to use Ad vector-based vaccines in people with a history of blood clotting abnormalities.
The incidence of VITT varies significantly across different COVID-19 vaccines. For the AZD1222 vaccine, VITT rates range from 3.2 to 16.1 cases per million doses [121], while for the Ad26.COV2.S vaccine, the incidence is between 1.7 and 3.7 cases per million doses [122]. The Ad5-nCoV vaccine has a notably lower incidence, with only 0.0081 cases per million doses [123]. No VITT cases had been reported following the administration of the Sputnik V vaccine in Russia. However, data from the Argentinian Ministry of Health reported 13 VITT cases, including 11 cases linked to AZD1222 (0.37 cases per million doses), and 2 cases after the administration of over 20 million doses of Sputnik V [123]. The European Medicines Agency has attributed 98.5% of VITT cases to Ad-vectored vaccines, with AZD1222 and Ad26.COV2.S responsible for 90% and 8.5% of cases, respectively [124]. While VITT is extremely rare following mRNA vaccines such as BNT162b2 and mRNA-1273 [120,125], no confirmed VITT cases have been associated with inactivated whole-virion vaccines like CoronaVac and BBV152. However, two VITT cases have been reported with BBIBP-CorV, an inactivated vaccine by Sinopharm [126]. VITT can develop after the first or second vaccine dose, but most cases arise after the initial dose [127]. It has been reported that the average mortality rate for VITT was about 32%, determined by a meta-analysis of 18 studies conducted in 2021 [128,129].

5.3. Guillain–Barré Syndrome

Guillain–Barré syndrome (GBS) is a rare neurological disorder where the immune system targets the peripheral nerves, leading to nerve weakness, sensory irregularities, and autonomic nervous system dysfunction. This happens due to the damage to both peripheral nerves and nerve roots [130]. This condition is likely indicative of an autoimmune disorder arising from molecular mimicry [131]. There are two hypotheses for the elevated risk of GBS following vaccination with Ad vector-based vaccines. The first hypothesis suggests that the production of vector-specific antibodies may cross-react with proteins associated with myelin and axonal functions, contributing to GBS [132]. The second hypothesis assumes that Ad vectors may invade the peripheral nervous system, initiate inflammation, and subsequently lead to neuropathies [132]. The incidence of GBS following COVID-19 vaccination varies depending on the type of vaccine, with the majority of cases associated with the AstraZeneca (AZD1222) vaccine, with 3.8 excess cases per million doses in England [133]. Similarly, in Kerala, India, GBS cases after AstraZeneca vaccination were 1.4- to 10-fold higher than expected [134], and in Australia, the frequency was reported to be 1.6 times higher than usual [135]. The AstraZeneca vaccine was responsible for 56% of the recorded cases, followed by the Pfizer (20%), J&J (7%), Sputnik (7%), Moderna (5%), Sinovac (4%), and Novavax (1%) vaccines, suggesting that all COVID-19 vaccines were linked to GBS. GBS primarily affected males, accounting for 59.4% of cases, with the highest incidence in individuals aged 41–60 [136].

6. Strategies for Developing Next-Generation Ad Vector-Based SARS-CoV-2 Vaccines

6.1. Targeting Other SARS-CoV-2 Immunogens in Addition to S

Most Ad vector-based COVID-19 vaccines induced SARS-CoV-2 S-specific immune responses. For developing the next-generation SARS-CoV-2 vaccines that could elicit broader protection against emerging variants, it may be critical to supplement the S protein with other relatively conserved immunogens of SARS-CoV-2 such as membrane (M), envelope (E), and nucleocapsid (N) [137] (Figure 4A). The immunization of mice with DNA vaccines encoding M and E proteins provided enhanced protection following challenge with SARS-CoV-2 compared to the groups vaccinated with DNA vaccines encoding either M or E proteins [138], suggesting that including additional immunogens in the vaccine formulation is vital for broader protection. An Ad vector expressing both N and S antigens conferred reduced viral titers in both the lungs and brain, whereas the vector expressing only S led to reduced viral titers only in the lungs [22].

6.2. Bivalent or Multivalent S-Based Vaccine Approach

Bivalent S-based vaccines contain the S protein from both the ancestral SARS-CoV-2 and one of the recent variants, like Omicron, aiming to elicit immune responses relevant to the circulating strains [137]. Individuals having S-specific memory B and T cell responses due to vaccination with a monovalent S-based vaccine or SARS-CoV-2 exposure were immunized with a bivalent vaccine formulation, resulting in increased levels of immune responses against ancestral and new variants [139,140]. In addition, it is anticipated that new epitopes of the S protein of the recent variant will elicit S-specific immune responses against the recent strain, leading to stronger protective efficacy against the circulating strains. A ChAd vector-based bivalent vaccine expressing the S proteins of two variants elicited VNAs, serum IgA, and IgG against the ancestral and Omicron strains and conferred protection against the D614G (WA1/2020) variant and Omicron variants (XBB.1.5 and BQ.1.1) in K18-hACE2 transgenic mice and hamsters [141]. Similarly, the chimeric HAd5/35 vaccine platform expressing the S protein of BA.5 and BA.2.75 (bivalent) or the S protein of XBB/BN.1/BQ.1.1 or XBB.1.5/BN.1/BQ.1.1 (trivalent) demonstrated significantly improved cross-neutralization compared to their monovalent counterparts in mice and macaques, suggesting that multivalent approaches are more effective in generating VNAs against a wide range of circulating Omicron subvariants, offering broader protection against SARS-CoV-2 [142]. Moreover, a tetravalent recombinant protein vaccine (SCTV01E) formulated with the S ectodomains of Alpha, Beta, Delta, and Omicron BA.1 variants developed cross-neutralizing immunity against various SARS-CoV-2 strains [143]. In the Phase 3 trial, participants previously vaccinated with BBIBP-CorV (inactivated SARS-CoV-2 vaccine) were administered a booster dose of either BBIBP-CorV or SCTV01E, and the group receiving the booster dose with SCTV01E elicited significantly higher neutralizing antibody titers against the Delta and Omicron (BA.1 and BA.5) variants compared to the BBIBP-CorV group, indicating enhanced cross-variant protection due to the multi-antigen strategy [144].

6.3. Use of Less Prevalent Human or Nonhuman Ads as Vaccine Vectors

Different strategies have been developed to address the issues related to preexisting Ad vector immunity, and one of the approaches involves utilizing uncommon HAd types as delivery vectors. HAd11, 26, 35, 48, 49, and 50 are less prevalent in the human population, and thus are less likely to be impacted by preexisting Ad vector immunity [145,146,147]. HAd35 and HAd26 vaccine vectors targeting Ebola, HIV, malaria, tuberculosis, and COVID-19 elicited high levels of antigen-specific humoral and cellular immune responses in humans [3,148,149,150,151,152]. However, Ebola vaccines based on HAd35 or HAd26 exhibited lower immunogenicity and protection against the Ebola virus in nonhuman primates compared to the HAd5-vectored vaccine [108]. This finding underscores that seroprevalence alone does not determine vector potency factors, such as transgene expression efficiency, dendritic cell targeting, and innate immune activation. However, the vectors based on rare Ad types have demonstrated strong efficacy in prime-boost combinations. In nonhuman primates, HAd26/HAd35 heterologous regimens provided uniform protection against Ebola, with HAd26 showing a clear dose–response relationship and outperforming HAd35 in antibody titers [108].
Moreover, various nonhuman Ads derived from chimpanzee, canine, bovine, ovine, porcine, avian, and others have been engineered as vaccine vector platforms [153] to complement or substitute HAds to circumvent preexisting Ad immunity (Figure 4B). ChAd vectors offer advantages for vaccine development since they can be cultured in certified HEK293 cells with high titers [25]. There is a relatively low prevalence of ChAd cross-VNAs due to preexisting Ad immunity in the human population [154]; therefore, ChAd vector-based vaccines induce robust humoral and CMI responses even in the presence of HAd5 immunity [155,156,157].
Various ChAd vectors expressing diverse immunogens of Ebola virus, HIV, malaria, SARS-CoV-2, and respiratory syncytial virus resulted in antigen-specific immune responses [158,159]. ChAd63, a low seroprevalence ChAd, expressing a fusion protein (ME-TRAP) consisting of a string of multi-epitope (ME) fused to the Plasmodium falciparum pre-erythrocytic thrombospondin-related adhesion protein (TRAP) produced robust immune responses and protection against malaria in nonhuman primates [160]. ChAd3 expressing a distinctive target immunogen (NSmut), derived from conserved sequences spanning the nonstructural genes (NS3-NS5B) of hepatitis C virus genotypes 1b and BK, and the glycoprotein of Ebola virus, elicited excellent antigen-specific immune responses [161]. ChAdOx1, based on ChAd Y25-type vectors expressing immunogens of SARS-CoV-2, influenza, or Mycobacterium tuberculosis, led to antigen-specific robust immune responses [78,82,162,163,164]. The COVID-19 vaccine, ChAdOx1-nCoV-19, is described earlier in this review.
Humans do not have bovine Ad type 3 (BAd3) cross-VNAs [165], HAd5 antibodies do not cross-neutralize BAd3 [166], BAd3 uses α-2,3- and α-2,6-linked sialic acid receptors for virus entry [37], the virus exhibits distinct tissue tropism [167], and it efficiently transduces various human and nonhuman cell types [37]. BAd vectors induce a robust activation of innate immunity [13], leading to enhanced antigen-specific immune responses and protection better than that of HAd5 vectors [168]. Therefore, the BAd3 vector system offers an attractive vaccine platform capable of evading preexisting Ad immunity. CAd2 vectors showed promising results in immunogenicity and protection studies for rabies, rabbit hemorrhagic disease, foot-and-mouth disease, and toxoplasmosis [145,169,170].

6.4. Different Immunization Routes for Prime and Boost with the Same Ad Vector-Based Vaccine

The second inoculation with the same Ad vector-based vaccine results in noticeable inhibition in the immunogen expression due to the vector immunity impacting the booster effect of the second dose [110]. However, a prime and boost approach using two different immunization routes results in enhanced immune responses compared to the group immunized twice with the same route [171]. Low levels of HAd5 vector immunity (below 520 virus-neutralization titer) did not negatively affect the protection efficacy of an HAd5 vector-based influenza vaccine in a mouse model [172]. Conversely, high levels of vector immunity (around 1500 virus-neutralization antibody titer) could be mitigated by either increasing the vaccine dose or using a different vaccination route for booster inoculation. Similarly, the priming of the mouse group with the i.m. route and boosting with the i.n. route using a ChAd-based COVID-19 vaccine expressing broad-spectrum immunogens (modified S and conserved T-cell epitopes) elicited stronger humoral and CMI responses, leading to effective protection against BA.2 compared to other strategies [173] (Figure 4C).

6.5. Enhancing Immunity with Diverse Vaccine Platforms

The heterologous prime-boost or mix-and-match approach, involving Ad vectors and other vaccine platforms, has also been employed to enhance the durability of protection and to address fluctuating vaccine supply. A study involving AZD1222 vaccine prime and BioNTech/Pfizer’s BNT162b2 mRNA vaccine boost resulted in an 11.5-fold increase in the anti-S IgG response when compared to a 2.9-fold increase for homologous AZD1222 vaccination [174]. Another study reported a significant boost in S-specific IgG, neutralizing antibodies, and S-specific CD4+ and CD8+ T cells, following AZD1222 prime and BNT162b2 boost [175]. Additionally, AZD1222 (Covishield) prime and Covaxin (inactivated whole virion BBV152) boost elicited superior IgG and neutralizing antibody responses compared to the homologous boost with either vaccine [176].

6.6. Enhanced Protection Against Respiratory Pathogens by Mucosal Immunization with Ad Vector-Based Vaccines

Most Ad vector vaccines have been administered via the i.m. route, which primarily induces strong systemic immunity characterized by high circulating antibody levels and T-cell responses. However, because SARS-CoV-2 primarily infects the respiratory tract, i.n. administration has been explored as a promising alternative to enhance mucosal immunity. Unlike the i.m. route, which mainly generates systemic protection, i.n. vaccination stimulates immune responses directly at the site of viral entry. Upon i.n. administration, antigen-presenting cells in the respiratory tract capture the vector or expressed antigen, migrate to local lymph nodes, and activate antigen-specific T cells. This process promotes the formation of tissue-resident memory T cells within the respiratory mucosa, offering long-lasting protection against respiratory pathogens [177]. In addition, mucosal immunization helps induce high levels of mucosal and systemic humoral immune responses. A single i.n. dose of HAd5 vectors expressing either the receptor-binding domain of S (HAd5-RBD) or the complete S ectodomain (HAd5-S) successfully induced high levels of anti-S IgA and IgG in serum and bronchoalveolar lavage, along with potent virus VNAs and strong T cell immunity in transgenic mice (HLA class II-humanized) [178]. These findings support the use of mucosal COVID-19 vaccines and offer potential for preventing SARS-CoV-2 transmission. Likewise, the i.n. delivery of the HAd5-S.Mod vaccine expressing a modified SARS-CoV-2 S protein and the genetic adjuvant, human CXCL9, significantly enhanced airways-specific immune responses compared to i.m. vaccines in mice [179]. This approach not only induced superior humoral and T-cell responses in the respiratory tract but also conferred protection against lethal SARS-CoV-2 infection. The first generation i.m. COVID-19 vaccines have demonstrated efficacy in reducing the disease severity, but they do not protect from infection and virus transmission. However, i.n. COVID-19 vaccines have shown effectiveness in preventing individuals from being infected with SARS-CoV-2 [180].

6.7. Ad Vector Modification for Improved Vaccine Efficacy

To reduce the impact of preexisting Ad vector immunity, the hexon hypervariable region (HVR) loops were changed to develop HVR-modified HAd5 vectors [181]. These alterations have also been shown to hinder FX binding [182]. For instance, HAd5 hexon HVR sequences were substituted with the analogous regions of HAd48 to generate a chimeric vector [183], which demonstrated its normal immunogenicity in mice and rhesus monkeys in the presence of high levels of anti-HAd5 VNAs. Likewise, by swapping the HAd5 knob domain with that of HAd3, chimeric Ad vectors showed their improved efficacy to counter preexisting immunity against HAd5 in the mouse model [183]. Additionally, an HAd5 vector incorporating the fiber from BAd4 exhibited reduced innate immune responses and interacted less with blood clotting factors compared to the original HAd5 vector in the mouse model [184]. Inserting peptides into the exposed loops of the Ad fiber or hexon has greatly enhanced the versatility of Ad vectors for targeted delivery and reduced unintended interactions [185,186]. While these modifications have primarily been explored for gene therapy, the approach can be used for targeting specific antigen-presenting cells, thereby boosting immune responses (Figure 4D).

6.8. Encapsulation of Ad Vectors to Elude Vector Immunity

The chemical encapsulation of Ad with inert polymeric materials, such as nano and microparticles, liposomes, or minerals, can shield the antigenic surface epitopes from vector-neutralizing antibodies. The shielding of the Ad vector by PEGylation, which involved the covalent attachment of polyethylene glycol (PEG) at specific positions on the capsid, was effective in evading Ad VNAs [187]. The PEGylation of Ad mitigated the innate immune responses and deterred attachment to platelets and other blood factors, thereby averting potential side effects [188]. The shielding of the Ad vector expressing the receptor-binding domain of SARS-CoV-2 S resulted in more than ten times higher SARS-CoV-2-neutralizing antibody titers compared to the non-shielded vectored vaccines due to reduced levels of anti-vector immunity [189]. This vaccine formulation is under investigation in a clinical trial [189].
Biomineralization is another noteworthy approach where the Ad vector is concealed in a calcium phosphate mineral exterior (CaP). A self-biomineralized simian Ad type 23-based SARS-CoV-2 vaccine (SAd23L-nCoV-S-CaP) retained high immunogenicity, and the vector was shielded from the preexisting anti-SAd23L antibodies in vitro and in vivo [190]. The vaccine was thermostable compared to the non-biomineralized counterpart [190].
Both anionic and cationic liposomes have been utilized for encapsulating Ad vectors. The coating of Ad particles with anionic lecithin cholesterol–PEG liposomes ameliorated transfection efficiency and conferred protection from vector VNAs [191]. Likewise, cationic bilamellar dioleoyltrimethylaminopropane/cholesterol (DOTAP:Chol) liposomes’ encapsulation of the Ad vector led to enhanced transduction efficiency in CAR-deficient cells and protected the vector from VNAs in vitro and in vivo [192]. The PEGylation of DOTAP:Chol liposomes not only bolstered transduction efficiency but also reduced cytotoxicity and interactions with blood cells [193]. Ad vectors coated with PEGylated gold nanoparticles (AuNPs) were shielded from anti-hexon VNAs and showed improved transduction in cells independent of CAR and αvβ3 and αvβ5 integrins [194]. The encapsulation of Ad vectors into poly-gamma-glutamic acid–chitosan (γ-PGA-CH) nanoparticles conferred protection from Ad VNAs [195]. Ad vector’s encapsulation into chitosan–bile salt (sodium deoxycholate) microparticles delayed the vector release—a desirable property for vaccination [196]. Furthermore, Ad coated by biodegradable sodium alginate-based microspheres also evaded Ad-specific mucosal and systemic VNAs [197] (Figure 4E).

6.9. Use of Bispecific Adapters to Enhance Ad Vector-Mediated Immune Responses

Bispecific adapters are molecules that simultaneously bind to two different targets. These adapters are used to bridge interactions between viral vectors, therapeutic molecules, or cell surface receptors (Figure 4F). The adapter molecule CFm40L efficiently facilitated Ad-mediated gene delivery to dendritic cells (DCs), thereby proving crucial in enhancing immune responses [198]. Furthermore, CFm40L-targeted HAd5 induced DCs maturation and the upregulation of IL-12 expression, leading to enhanced immunogenicity [198].

6.10. Use of Signaling Molecules or Peptides to Increase Ad Vector-Mediated Immune Responses

Altering the cellular trafficking of the desired immunogen by including specific domains or peptides can significantly impact the levels of antigen-specific immune responses. An autophagy-inducing peptide C5 (AIP-C5) of Mycobacterium tuberculosis helps in autophagy-mediated antigen processing in lysosomes, leading to an alternative route of MHC-I-dependent and MHC-II-dependent antigen presentation [199] (Figure 4G). The i.n. immunization of mice or golden Syrian hamsters with the HAd5 vector expressing SARS-CoV-2 S and AIP-C5 displayed comparable S-specific humoral responses but significantly elevated levels of S-specific CMI responses compared to the groups vaccinated with the HAd5 vector expressing only SARS-CoV-2 S [200]. Similarly, the immunization of mice with the HAd5 vector expressing the influenza virus nucleoprotein (NP) with AIP-C5 elicited significantly higher levels of NP-specific CD8+ T cell responses compared to the groups vaccinated with the HAd5 vector expressing only NP [201]. These results indicate that including AIP-C5 in the vaccine formulation enhanced the antigen-specific CMI responses against the immunogen of choice.
Signaling peptides or small molecules (~20–30 amino acids) control a specific signaling pathway, its secretion, and post-translational modifications [202]. The inclusion of 20 amino acid (METDTLLLWVLLLWVPGSTG) signal peptides derived from the murine IgG kappa chain, upstream of the transgene in an SAd23 vectored malaria vaccine, augmented antibody avidity and increased IL-2 and IFN-γ production by CD4+ T cells [203]. A TLR signaling molecule, a TRIF-related adaptor molecule (TRAM), when inserted into the HAd5 or ChAd63 vector, led to the increased production of IL-8 in HeLa cells [204]. Mice immunized intradermally (i.d.) or i.m. with the HAd5 vector co-expressing TRAM with the transgene of interest bolstered CD8+ T cell responses with a minimal increase in CD4+ T cell responses [205].
Another interesting concept is to include a short peptide in the gene’s open reading frame to help boost the expression level of the transgene of interest. Various peptide tags can stabilize mRNA, thereby increasing its half-life or preventing protein degradation [198]. A 21-nucleotide-long cis-regulatory motif (Exin21; CAACCGCGGTTCGCGGCCGCT), which encodes a heptapeptide (QPRFAAA), led to significant increases in the expression levels of SARS-CoV-2 E, S, or the M protein when inserted in frame of the transgene [206]. Furthermore, Exin21 also boosted the expression level of anti-SARS-CoV monoclonal antibodies and the SARS-CoV-2 S-based mRNA vaccine [199]. Other such tags, like a 13-amino-acid-long STABILION (KDGKKDKKEEDKK) from the Drosophila 26S proteasome and a 16-amino-acid-long peptide from transcription factor DP-1 (EDDEEDDDFNENDEDD) have also been reported to boost the expression of the transgene [207]. However, this approach has not been employed with Ad-based vaccines. The inclusion of these peptide tags along with the transgene may help boost its expression, thereby increasing immunogenicity and reducing the vaccine dose.

7. Conclusions and Future Directions

Ad vector-based vaccines have played a pivotal role in controlling the COVID-19 pandemic, demonstrating strong clinical efficacy and marking a significant milestone in vaccine development. Their advantages, including rapid scalability, the robust induction of cellular immunity, and established vector technology, make them promising candidates for a broad range of infectious diseases. This review also highlights the preclinical and clinical efficacy of these vaccines, emphasizing their effectiveness in eliciting strong immune responses. However, further optimization is essential to enhance their immunogenicity and address certain limitations. Strategies such as targeting additional SARS-CoV-2 immunogens beyond the S protein, developing bivalent or multivalent S-based vaccines, and utilizing less prevalent human or nonhuman adenoviral vectors could improve immune coverage and durability. Moreover, modifying immunization strategies, including heterologous prime-boost regimens and mucosal delivery, may enhance protection, particularly against respiratory pathogens. Enhancing vector design through modifications, such as encapsulation to evade preexisting immunity, the use of bispecific adapters, and the incorporation of signaling molecules or peptides, could further refine vaccine efficacy. While these approaches offer promising avenues for improvement, future research must focus on achieving broad and durable protection against emerging variants while minimizing side effects. Additionally, implementing targeted vaccination programs for significant animal reservoirs, such as mink and deer, could play a crucial role in preventing zoonotic spillover and limiting the emergence of novel variants—reinforcing global pandemic preparedness.

Author Contributions

M.S.T.M., V.G. and E.E.S. wrote the manuscript and designed the figures; S.K.M. finalized the concept and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Public Health Service (PHS) grant AI158177 from the National Institute of Allergy and Infectious Diseases (NIAID).

Data Availability Statement

Not applicable.

Acknowledgments

We thank all the researchers whose work is referenced in this review article. We apologize to other researchers whose work we failed to mention due to oversight on our part.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sadeghi Dousari, A.; Taati Moghadam, M.; Satarzadeh, N. COVID-19 (Coronavirus Disease 2019): A New Coronavirus Disease. Infect. Drug Resist. 2020, 13, 2819–2828. [Google Scholar] [CrossRef] [PubMed]
  2. Ravi, V.; Saxena, S.; Panda, P.S. Basic virology of SARS-CoV 2. Indian. J. Med. Microbiol. 2022, 40, 182–186. [Google Scholar] [CrossRef] [PubMed]
  3. Mendonça, S.A.; Lorincz, R.; Boucher, P.; Curiel, D.T. Adenoviral vector vaccine platforms in the SARS-CoV-2 pandemic. npj Vac. 2021, 6, 97. [Google Scholar] [CrossRef] [PubMed]
  4. Lenart, K.; Arcoverde Cerveira, R.; Hellgren, F.; Ols, S.; Sheward, D.J.; Kim, C.; Cagigi, A.; Gagne, M.; Davis, B.; Germosen, D.; et al. Three immunizations with Novavax’s protein vaccines increase antibody breadth and provide durable protection from SARS-CoV-2. npj Vac. 2024, 9, 17. [Google Scholar] [CrossRef]
  5. Lamb, Y.N. BNT162b2 mRNA COVID-19 Vaccine: First Approval. Drugs 2021, 81, 495–501. [Google Scholar] [CrossRef]
  6. Blakney, A.K.; Bekker, L.-G. DNA vaccines join the fight against COVID-19. Lancet 2022, 399, 1281–1282. [Google Scholar] [CrossRef]
  7. Elkashif, A.; Alhashimi, M.; Sayedahmed, E.E.; Sambhara, S.; Mittal, S.K. Adenoviral vector-based platforms for developing effective vaccines to combat respiratory viral infections. Clin. Transl. Immunol. 2021, 10, e1345. [Google Scholar] [CrossRef]
  8. Okuyama, R. mRNA and Adenoviral Vector Vaccine Platforms Utilized in COVID-19 Vaccines: Technologies, Ecosystem, and Future Directions. Vaccines 2023, 11, 1737. [Google Scholar] [CrossRef]
  9. Chi, W.-Y.; Li, Y.-D.; Huang, H.-C.; Chan, T.E.H.; Chow, S.-Y.; Su, J.-H.; Ferrall, L.; Hung, C.-F.; Wu, T.C. COVID-19 vaccine update: Vaccine effectiveness, SARS-CoV-2 variants, boosters, adverse effects, and immune correlates of protection. J. Biomed. Sci. 2022, 29, 82. [Google Scholar] [CrossRef]
  10. Lin, D.-Y.; Gu, Y.; Wheeler, B.; Young, H.; Holloway, S.; Sunny, S.-K.; Moore, Z.; Zeng, D. Effectiveness of COVID-19 Vaccines over a 9-Month Period in North Carolina. N. Engl. J. Med. 2022, 386, 933–941. [Google Scholar] [CrossRef]
  11. Chavda, V.P.; Bezbaruah, R.; Valu, D.; Patel, B.; Kumar, A.; Prasad, S.; Kakoti, B.B.; Kaushik, A.; Jesawadawala, M. Adenoviral Vector-Based Vaccine Platform for COVID-19: Current Status. Vaccines 2023, 11, 432. [Google Scholar] [CrossRef] [PubMed]
  12. Wang, W.-C.; Sayedahmed, E.E.; Mittal, S.K. Significance of Preexisting Vector Immunity and Activation of Innate Responses for Adenoviral Vector-Based Therapy. Viruses 2022, 14, 2727. [Google Scholar] [CrossRef]
  13. Mittal, S.K.; Ahi, Y.S.; Vemula, S.V. Xenogenic Adenoviral Vectors. In Adenoviral Vectors for Gene Therapy; Elsevier: Amsterdam, The Netherlands, 2016; pp. 495–528. [Google Scholar]
  14. Zhu, F.-C.; Li, Y.-H.; Guan, X.-H.; Hou, L.-H.; Wang, W.-J.; Li, J.-X.; Wu, S.-P.; Wang, B.-S.; Wang, Z.; Wang, L.; et al. Safety, tolerability, and immunogenicity of a recombinant adenovirus type-5 vectored COVID-19 vaccine: A dose-escalation, open-label, non-randomised, first-in-human trial. Lancet 2020, 395, 1845–1854. [Google Scholar] [CrossRef] [PubMed]
  15. Garcia-Beltran, W.F.; Lam, E.C.; St Denis, K.; Nitido, A.D.; Garcia, Z.H.; Hauser, B.M.; Feldman, J.; Pavlovic, M.N.; Gregory, D.J.; Poznansky, M.C.; et al. Multiple SARS-CoV-2 variants escape neutralization by vaccine-induced humoral immunity. Cell 2021, 184, 2372–2383.e2379. [Google Scholar] [CrossRef] [PubMed]
  16. Vinzón, S.E.; Lopez, M.V.; Cafferata, E.G.A.; Soto, A.S.; Berguer, P.M.; Vazquez, L.; Nusblat, L.; Pontoriero, A.V.; Belotti, E.M.; Salvetti, N.R.; et al. Cross-protection and cross-neutralization capacity of ancestral and VOC-matched SARS-CoV-2 adenoviral vector-based vaccines. npj Vac. 2023, 8, 149. [Google Scholar] [CrossRef]
  17. Nordström, P.; Ballin, M.; Nordström, A. Risk of infection, hospitalisation, and death up to 9 months after a second dose of COVID-19 vaccine: A retrospective, total population cohort study in Sweden. Lancet 2022, 399, 814–823. [Google Scholar] [CrossRef]
  18. Thompson, M.G.; Stenehjem, E.; Grannis, S.; Ball, S.W.; Naleway, A.L.; Ong, T.C.; DeSilva, M.B.; Natarajan, K.; Bozio, C.H.; Lewis, N.; et al. Effectiveness of COVID-19 Vaccines in Ambulatory and Inpatient Care Settings. N. Engl. J. Med. 2021, 385, 1355–1371. [Google Scholar] [CrossRef]
  19. Singanayagam, A.; Hakki, S.; Dunning, J.; Madon, K.J.; Crone, M.A.; Koycheva, A.; Derqui-Fernandez, N.; Barnett, J.L.; Whitfield, M.G.; Varro, R.; et al. Community transmission and viral load kinetics of the SARS-CoV-2 delta (B.1.617.2) variant in vaccinated and unvaccinated individuals in the UK: A prospective, longitudinal, cohort study. Lancet Infect. Dis. 2022, 22, 183–195. [Google Scholar] [CrossRef]
  20. Franco-Paredes, C. Transmissibility of SARS-CoV-2 among fully vaccinated individuals. Lancet Infect. Dis. 2022, 22, 16. [Google Scholar] [CrossRef]
  21. Mongin, D.; Bürgisser, N.; Laurie, G.; Schimmel, G.; Vu, D.-L.; Cullati, S.; Covid-SMC Study Group; Courvoisier, D.S. Effect of SARS-CoV-2 prior infection and mRNA vaccination on contagiousness and susceptibility to infection. Nat. Commun. 2023, 14, 5452. [Google Scholar] [CrossRef]
  22. Dangi, T.; Class, J.; Palacio, N.; Richner, J.M.; Penaloza MacMaster, P. Combining spike- and nucleocapsid-based vaccines improves distal control of SARS-CoV-2. Cell Rep. 2021, 36, 109664. [Google Scholar] [CrossRef] [PubMed]
  23. Benkő, M.; Aoki, K.; Arnberg, N.; Davison, A.J.; Echavarría, M.; Hess, M.; Jones, M.S.; Kaján, G.L.; Kajon, A.E.; Mittal, S.K.; et al. ICTV Virus Taxonomy Profile: Adenoviridae 2022: This article is part of the ICTV Virus Taxonomy Profiles collection. J. Gen. Virol. 2022, 103, 001721. [Google Scholar] [CrossRef] [PubMed]
  24. Dhingra, A.; Hage, E.; Ganzenmueller, T.; Böttcher, S.; Hofmann, J.; Hamprecht, K.; Obermeier, P.; Rath, B.; Hausmann, F.; Dobner, T.; et al. Molecular Evolution of Human Adenovirus (HAdV) Species C. Sci. Rep. 2019, 9, 1039. [Google Scholar] [CrossRef]
  25. Colloca, S.; Barnes, E.; Folgori, A.; Ammendola, V.; Capone, S.; Cirillo, A.; Siani, L.; Naddeo, M.; Grazioli, F.; Esposito, M.L.; et al. Vaccine Vectors Derived from a Large Collection of Simian Adenoviruses Induce Potent Cellular Immunity Across Multiple Species. Sci. Transl. Med. 2012, 4, 115. [Google Scholar] [CrossRef] [PubMed]
  26. Harrach, B.; Tarján, Z.L.; Benkő, M. Adenoviruses across the animal kingdom: A walk in the zoo. FEBS Lett. 2019, 593, 3660–3673. [Google Scholar] [CrossRef]
  27. Liu, L. Fields Virology, 6th Edition. Clin. Infect. Dis. 2014, 59, 613. [Google Scholar] [CrossRef]
  28. Maclachlan, N.J.; Dubovi, E.J. (Eds.) Adenoviridae. In Fenner’s Veterinary Virology; Elsevier: Amsterdam, The Netherlands, 2017; pp. 217–227. [Google Scholar]
  29. San Martín, C. Latest Insights on Adenovirus Structure and Assembly. Viruses 2012, 4, 847–877. [Google Scholar] [CrossRef]
  30. Davison, A.J.; Benkő, M.; Harrach, B. Genetic content and evolution of adenoviruses. J. Gen. Virol. 2003, 84, 2895–2908. [Google Scholar] [CrossRef]
  31. Van Raaij, M.J.; Mitraki, A.; Lavigne, G.; Cusack, S. A triple β-spiral in the adenovirus fibre shaft reveals a new structural motif for a fibrous protein. Nature 1999, 401, 935–938. [Google Scholar] [CrossRef]
  32. Bergelson, J.M.; Cunningham, J.A.; Droguett, G.; Kurt-Jones, E.A.; Krithivas, A.; Hong, J.S.; Horwitz, M.S.; Crowell, R.L.; Finberg, R.W. Isolation of a Common Receptor for Coxsackie B Viruses and Adenoviruses 2 and 5. Science 1997, 275, 1320–1323. [Google Scholar] [CrossRef]
  33. Wickham, T.J.; Mathias, P.; Cheresh, D.A.; Nemerow, G.R. Integrins αvβ3 and αvβ5 promote adenovirus internalization but not virus attachment. Cell 1993, 73, 309–319. [Google Scholar] [CrossRef] [PubMed]
  34. Cohen, C.J.; Xiang, Z.Q.; Gao, G.-P.; Ertl, H.C.J.; Wilson, J.M.; Bergelson, J.M. Chimpanzee adenovirus CV-68 adapted as a gene delivery vector interacts with the coxsackievirus and adenovirus receptor. J. Gen. Virol. 2002, 83, 151–155. [Google Scholar] [CrossRef]
  35. Tan, P.K.; Michou, A.I.; Bergelson, J.M.; Cotten, M. Defining CAR as a cellular receptor for the avian adenovirus CELO using a genetic analysis of the two viral fibre proteins. J. Gen. Virol. 2001, 82, 1465–1472. [Google Scholar] [CrossRef]
  36. Soudais, C.; Boutin, S.; Hong, S.S.; Chillon, M.; Danos, O.; Bergelson, J.M.; Boulanger, P.; Kremer, E.J. Canine adenovirus type 2 attachment and internalization: Coxsackievirus-adenovirus receptor, alternative receptors, and an RGD-independent pathway. J. Virol. 2000, 74, 10639–10649. [Google Scholar] [CrossRef] [PubMed]
  37. Li, X.; Bangari, D.S.; Sharma, A.; Mittal, S.K. Bovine adenovirus serotype 3 utilizes sialic acid as a cellular receptor for virus entry. Virology 2009, 392, 162–168. [Google Scholar] [CrossRef]
  38. Sharma, A.; Li, X.; Bangari, D.S.; Mittal, S.K. Adenovirus receptors and their implications in gene delivery. Virus Res. 2009, 143, 184–194. [Google Scholar] [CrossRef] [PubMed]
  39. Stasiak, A.C.; Stehle, T. Human adenovirus binding to host cell receptors: A structural view. Med. Microbiol. Immunol. 2020, 209, 325–333. [Google Scholar] [CrossRef]
  40. Kremer, E.J.; Nemerow, G.R. Adenovirus Tales: From the Cell Surface to the Nuclear Pore Complex. PLoS Pathog. 2015, 11, e1004821. [Google Scholar] [CrossRef]
  41. Wiethoff, C.M.; Wodrich, H.; Gerace, L.; Nemerow, G.R. Adenovirus Protein VI Mediates Membrane Disruption following Capsid Disassembly. J. Virol. 2005, 79, 1992–2000. [Google Scholar] [CrossRef]
  42. Bremner, K.H.; Scherer, J.; Yi, J.; Vershinin, M.; Gross, S.P.; Vallee, R.B. Adenovirus Transport via Direct Interaction of Cytoplasmic Dynein with the Viral Capsid Hexon Subunit. Cell Host Microbe 2009, 6, 523–535. [Google Scholar] [CrossRef]
  43. Strunze, S.; Engelke, M.F.; Wang, I.H.; Puntener, D.; Boucke, K.; Schleich, S.; Way, M.; Schoenenberger, P.; Burckhardt, C.J.; Greber, U.F. Kinesin-1-Mediated Capsid Disassembly and Disruption of the Nuclear Pore Complex Promote Virus Infection. Cell Host Microbe 2011, 10, 210–223. [Google Scholar] [CrossRef] [PubMed]
  44. Acheson, N.H. Fundamentals of Molecular Virology; John Wiley & Sons: Hoboken, NJ, USA, 2011. [Google Scholar]
  45. Ostapchuk, P.; Hearing, P. Control of adenovirus packaging. J. Cell. Biochem. 2005, 96, 25–35. [Google Scholar] [CrossRef]
  46. Hong, S.S.; Szolajska, E.; Schoehn, G.; Franqueville, L.; Myhre, S.; Lindholm, L.; Ruigrok, R.W.; Boulanger, P.; Chroboczek, J. The 100K-chaperone protein from adenovirus serotype 2 (Subgroup C) assists in trimerization and nuclear localization of hexons from subgroups C and B adenoviruses. J. Mol. Biol. 2005, 352, 125–138. [Google Scholar] [CrossRef] [PubMed]
  47. Ahi, Y.S.; Mittal, S.K. Components of Adenovirus Genome Packaging. Front. Microbiol. 2016, 7, 1503. [Google Scholar] [CrossRef]
  48. Ahi, Y.S.; Hassan, A.O.; Vemula, S.V.; Li, K.; Jiang, W.; Zhang, G.J.; Mittal, S.K. Adenoviral E4 34K protein interacts with virus packaging components and may serve as the putative portal. Sci. Rep. 2017, 7, 7582. [Google Scholar] [CrossRef] [PubMed]
  49. Chang, J. Adenovirus Vectors: Excellent Tools for Vaccine Development. Immune Netw. 2021, 21, e6. [Google Scholar] [CrossRef]
  50. Crenshaw, B.J.; Jones, L.B.; Bell, C.R.; Kumar, S.; Matthews, Q.L. Perspective on Adenoviruses: Epidemiology, Pathogenicity, and Gene Therapy. Biomedicines 2019, 7, 61. [Google Scholar] [CrossRef]
  51. Sayedahmed, E.E.; Kumari, R.; Mittal, S.K. Current Use of Adenovirus Vectors and Their Production Methods. In Viral Vectors for Gene Therapy; Manfredsson, F.P., Benskey, M.J., Eds.; Springer: New York, NY, USA, 2019; Volume 1937, pp. 155–175. [Google Scholar]
  52. Danthinne, X.; Imperiale, M.J. Production of first generation adenovirus vectors: A review. Gene Ther. 2000, 7, 1707–1714. [Google Scholar] [CrossRef]
  53. Russell, W.C.; Graham, F.L.; Smiley, J.; Nairn, R. Characteristics of a Human Cell Line Transformed by DNA from Human Adenovirus Type 5. J. Gen. Virol. 1977, 36, 59–72. [Google Scholar] [CrossRef]
  54. Wen, S.; Schneider, D.B.; Driscoll, R.M.; Vassalli, G.; Sassani, A.B.; Dichek, D.A. Second-Generation Adenoviral Vectors Do Not Prevent Rapid Loss of Transgene Expression and Vector DNA From the Arterial Wall. Atertio. Thromb. Vasc. Biol. 2000, 20, 1452–1458. [Google Scholar] [CrossRef]
  55. Brescia, M.; Janssen, J.M.; Liu, J.; Gonçalves, M.A.F.V. High-Capacity Adenoviral Vectors Permit Robust and Versatile Testing of DMD Gene Repair Tools and Strategies in Human Cells. Cells 2020, 9, 869. [Google Scholar] [CrossRef] [PubMed]
  56. Parks, R.J.; Chen, L.; Anton, M.; Sankar, U.; Rudnicki, M.A.; Graham, F.L. A helper-dependent adenovirus vector system: Removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. USA 1996, 93, 13565–13570. [Google Scholar] [CrossRef] [PubMed]
  57. Sargent, K.; Ng, P.; Evelegh, C.; Graham, F.; Parks, R. Development of a size-restricted pIX-deleted helper virus for amplification of helper-dependent adenovirus vectors. Gene Ther. 2004, 11, 504–511. [Google Scholar] [CrossRef] [PubMed]
  58. Sharma, A.; Bangari, D.S.; Tandon, M.; Hogenesch, H.; Mittal, S.K. Evaluation of innate immunity and vector toxicity following inoculation of bovine, porcine or human adenoviral vectors in a mouse model. Virus Res. 2010, 153, 134–142. [Google Scholar] [CrossRef]
  59. Rhee, E.G.; Blattman, J.N.; Kasturi, S.P.; Kelley, R.P.; Kaufman, D.R.; Lynch, D.M.; La Porte, A.; Simmons, N.L.; Clark, S.L.; Pulendran, B.; et al. Multiple Innate Immune Pathways Contribute to the Immunogenicity of Recombinant Adenovirus Vaccine Vectors. J. Virol. 2011, 85, 315–323. [Google Scholar] [CrossRef]
  60. Kawasaki, T.; Kawai, T. Toll-Like Receptor Signaling Pathways. Front. Immunol. 2014, 5, 461. [Google Scholar] [CrossRef]
  61. Lam, E.; Stein, S.; Falck-Pedersen, E. Adenovirus Detection by the cGAS/STING/TBK1 DNA Sensing Cascade. J. Virol. 2014, 88, 974–981. [Google Scholar] [CrossRef]
  62. Suzuki, M.; Cela, R.; Bertin, T.K.; Sule, G.; Cerullo, V.; Rodgers, J.R.; Lee, B. NOD2 Signaling Contributes to the Innate Immune Response Against Helper-Dependent Adenovirus Vectors Independently of MyD88 In Vivo. Hum. Gene Ther. 2011, 22, 1071–1082. [Google Scholar] [CrossRef]
  63. Reyes-Sandoval, A.; Fitzgerald, J.C.; Grant, R.; Roy, S.; Xiang, Z.Q.; Li, Y.; Gao, G.P.; Wilson, J.M.; Ertl, H.C. Human immunodeficiency virus type 1-specific immune responses in primates upon sequential immunization with adenoviral vaccine carriers of human and simian serotypes. J. Virol. 2004, 78, 7392–7399. [Google Scholar] [CrossRef]
  64. Hensley, S.E.; Cun, A.S.; Giles-Davis, W.; Li, Y.; Xiang, Z.; Lasaro, M.O.; Williams, B.R.; Silverman, R.H.; Ertl, H.C. Type I interferon inhibits antibody responses induced by a chimpanzee adenovirus vector. Mol. Ther. 2007, 15, 393–403. [Google Scholar]
  65. Barouch, D.H.; Pau, M.G.; Custers, J.H.; Koudstaal, W.; Kostense, S.; Havenga, M.J.; Truitt, D.M.; Sumida, S.M.; Kishko, M.G.; Arthur, J.C. Immunogenicity of recombinant adenovirus serotype 35 vaccine in the presence of pre-existing anti-Ad5 immunity. J. Immunol. 2004, 172, 6290–6297. [Google Scholar]
  66. Van Der Lubbe, J.E.M.; Rosendahl Huber, S.K.; Vijayan, A.; Dekking, L.; Van Huizen, E.; Vreugdenhil, J.; Choi, Y.; Baert, M.R.M.; Feddes-de Boer, K.; Izquierdo Gil, A.; et al. Ad26.COV2.S protects Syrian hamsters against G614 spike variant SARS-CoV-2 and does not enhance respiratory disease. npj Vac. 2021, 6, 39. [Google Scholar] [CrossRef]
  67. Doronin, K.; Flatt, J.W.; Di Paolo, N.C.; Khare, R.; Kalyuzhniy, O.; Acchione, M.; Sumida, J.P.; Ohto, U.; Shimizu, T.; Akashi-Takamura, S.; et al. Coagulation Factor X Activates Innate Immunity to Human Species C Adenovirus. Science 2012, 338, 795–798. [Google Scholar] [CrossRef]
  68. Muruve, D.A. The Innate Immune Response to Adenovirus Vectors. Hum. Gene Ther. 2004, 15, 1157–1166. [Google Scholar] [CrossRef]
  69. Nociari, M.; Ocheretina, O.; Schoggins, J.W.; Falck-Pedersen, E. Sensing Infection by Adenovirus: Toll-Like Receptor-Independent Viral DNA Recognition Signals Activation of the Interferon Regulatory Factor 3 Master Regulator. J. Virol. 2007, 81, 4145–4157. [Google Scholar] [CrossRef] [PubMed]
  70. Sharma, A.; Tandon, M.; Ahi, Y.S.; Bangari, D.S.; Vemulapalli, R.; Mittal, S.K. Evaluation of cross-reactive cell-mediated immune responses among human, bovine and porcine adenoviruses. Gene Ther. 2010, 17, 634–642. [Google Scholar] [CrossRef] [PubMed]
  71. Atasheva, S.; Shayakhmetov, D.M. Cytokine Responses to Adenovirus and Adenovirus Vectors. Viruses 2022, 14, 888. [Google Scholar] [CrossRef]
  72. Sayedahmed, E.E.; Elshafie, N.O.; Zhang, G.; Mohammed, S.I.; Sambhara, S.; Mittal, S.K. Enhancement of mucosal innate and adaptive immunity following intranasal immunization of mice with a bovine adenoviral vector. Front. Immunol. 2023, 14, 1305937. [Google Scholar] [CrossRef]
  73. Liu, Q.; Muruve, D.A. Molecular basis of the inflammatory response to adenovirus vectors. Gene Ther. 2003, 10, 935–940. [Google Scholar] [CrossRef]
  74. Ewer, K.J.; Barrett, J.R.; Belij-Rammerstorfer, S.; Sharpe, H.; Makinson, R.; Morter, R.; Flaxman, A.; Wright, D.; Bellamy, D.; Bittaye, M.; et al. T cell and antibody responses induced by a single dose of ChAdOx1 nCoV-19 (AZD1222) vaccine in a phase 1/2 clinical trial. Nat. Med. 2021, 27, 270–278. [Google Scholar] [CrossRef]
  75. Bos, R.; Rutten, L.; Van Der Lubbe, J.E.M.; Bakkers, M.J.G.; Hardenberg, G.; Wegmann, F.; Zuijdgeest, D.; De Wilde, A.H.; Koornneef, A.; Verwilligen, A.; et al. Ad26 vector-based COVID-19 vaccine encoding a prefusion-stabilized SARS-CoV-2 Spike immunogen induces potent humoral and cellular immune responses. npj Vac. 2020, 5, 91. [Google Scholar] [CrossRef]
  76. Liu, Y.; Ye, Q. Safety and Efficacy of the Common Vaccines against COVID-19. Vaccines 2022, 10, 513. [Google Scholar] [CrossRef] [PubMed]
  77. Kumar, V.M.; Pandi-Perumal, S.R.; Trakht, I.; Thyagarajan, S.P. Strategy for COVID-19 vaccination in India: The country with the second highest population and number of cases. npj Vac. 2021, 6, 60. [Google Scholar] [CrossRef]
  78. Van Doremalen, N.; Lambe, T.; Spencer, A.; Belij-Rammerstorfer, S.; Purushotham, J.N.; Port, J.R.; Avanzato, V.A.; Bushmaker, T.; Flaxman, A.; Ulaszewska, M.; et al. ChAdOx1 nCoV-19 vaccine prevents SARS-CoV-2 pneumonia in rhesus macaques. Nature 2020, 586, 578–582. [Google Scholar] [CrossRef]
  79. Ramasamy, M.N.; Minassian, A.M.; Ewer, K.J.; Flaxman, A.L.; Folegatti, P.M.; Owens, D.R.; Voysey, M.; Aley, P.K.; Angus, B.; Babbage, G.; et al. Safety and immunogenicity of ChAdOx1 nCoV-19 vaccine administered in a prime-boost regimen in young and old adults (COV002): A single-blind, randomised, controlled, phase 2/3 trial. Lancet 2021, 396, 1979–1993. [Google Scholar] [CrossRef]
  80. Falsey, A.R.; Sobieszczyk, M.E.; Hirsch, I.; Sproule, S.; Robb, M.L.; Corey, L.; Neuzil, K.M.; Hahn, W.; Hunt, J.; Mulligan, M.J.; et al. Phase 3 Safety and Efficacy of AZD1222 (ChAdOx1 nCoV-19) COVID-19 Vaccine. N. Engl. J. Med. 2021, 385, 2348–2360. [Google Scholar] [CrossRef]
  81. Hamaluba, M.; Sang, S.; Orindi, B.; Njau, I.; Karanja, H.; Kamau, N.; Gitonga, J.N.; Mugo, D.; Wright, D.; Nyagwange, J.; et al. Safety and immunogenicity of ChAdOx1 nCoV-19 (AZD1222) vaccine in adults in Kenya: A phase 1/2 single-blind, randomised controlled trial. Wellcome Open Res. 2023, 8, 182. [Google Scholar] [CrossRef]
  82. Voysey, M.; Clemens, S.A.C.; Madhi, S.A.; Weckx, L.Y.; Folegatti, P.M.; Aley, P.K.; Angus, B.; Baillie, V.L.; Barnabas, S.L.; Bhorat, Q.E.; et al. Safety and efficacy of the ChAdOx1 nCoV-19 vaccine (AZD1222) against SARS-CoV-2: An interim analysis of four randomised controlled trials in Brazil, South Africa, and the UK. Lancet 2021, 397, 99–111. [Google Scholar] [CrossRef]
  83. van der Lubbe, J.E.; Rosendahl Huber, S.K.; Vijayan, A.; Dekking, L.; van Huizen, E.; Vreugdenhil, J.; Choi, Y.; Baert, M.R.; Feddes-de Boer, K.; Gil, A.I.; et al. Ad26. COV2. S-elicited immunity protects against G614 spike variant SARS-CoV-2 infection in Syrian hamsters and does not enhance respiratory disease in challenged animals with breakthrough infection after sub-optimal vaccine dosing. bioRxiv 2021. Available online: https://www.biorxiv.org/content/10.1101/2021.01.08.425915v1 (accessed on 7 April 2025).
  84. He, X.; Chandrashekar, A.; Zahn, R.; Wegmann, F.; Yu, J.; Mercado, N.B.; McMahan, K.; Martinot, A.J.; Piedra-Mora, C.; Beecy, S. Low-dose Ad26. COV2. S protection against SARS-CoV-2 challenge in rhesus macaques. Cell 2021, 184, 3467–3473.e3411. [Google Scholar]
  85. Solforosi, L.; Kuipers, H.; Huber, S.K.R.; van der Lubbe, J.E.; Dekking, L.; Czapska-Casey, D.N.; Gil, A.I.; Baert, M.R.; Drijver, J.; Vaneman, J.; et al. Immunogenicity and protective efficacy of one-and two-dose regimens of the Ad26. COV2. S COVID-19 vaccine candidate in adult and aged rhesus macaques. bioRxiv 2021. Available online: https://www.biorxiv.org/content/10.1101/2020.11.17.368258v2 (accessed on 7 April 2025).
  86. Sadoff, J.; Le Gars, M.; Shukarev, G.; Heerwegh, D.; Truyers, C.; de Groot, A.M.; Stoop, J.; Tete, S.; Van Damme, W.; Leroux-Roels, I. Interim results of a phase 1–2a trial of Ad26. COV2. S COVID-19 vaccine. N. Engl. J. Med. 2021, 384, 1824–1835. [Google Scholar]
  87. Tsuchiya, Y.; Tamura, H.; Fujii, K.; Numaguchi, H.; Toyoizumi, K.; Liu, T.; Le Gars, M.; Cárdenas, V.; Eto, T. Safety, reactogenicity, and immunogenicity of Ad26.COV2.S: Results of a phase 1, randomized, double-blind, placebo-controlled COVID-19 vaccine trial in Japan. Vaccine 2023, 41, 1602–1610. [Google Scholar] [CrossRef] [PubMed]
  88. Cárdenas, V.; Le Gars, M.; Truyers, C.; Ruiz-Guiñazú, J.; Struyf, F.; Colfer, A.; Bonten, M.; Borobia, A.; Reisinger, E.C.; Kamerling, I.M.C.; et al. Safety and immunogenicity of Ad26.COV2.S in adults: A randomised, double-blind, placebo-controlled Phase 2a dose-finding study. Vaccine 2024, 42, 3536–3546. [Google Scholar] [CrossRef] [PubMed]
  89. Sadoff, J.; Gray, G.; Vandebosch, A.; Cárdenas, V.; Shukarev, G.; Grinsztejn, B.; Goepfert, P.A.; Truyers, C.; Fennema, H.; Spiessens, B. Safety and efficacy of single-dose Ad26. COV2. S vaccine against COVID-19. N. Engl. J. Med. 2021, 384, 2187–2201. [Google Scholar]
  90. Hardt, K.; Vandebosch, A.; Sadoff, J.; Le Gars, M.; Truyers, C.; Lowson, D.; Van Dromme, I.; Vingerhoets, J.; Kamphuis, T.; Scheper, G.; et al. Efficacy, safety, and immunogenicity of a booster regimen of Ad26.COV2.S vaccine against COVID-19 (ENSEMBLE2): Results of a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Infect. Dis. 2022, 22, 1703–1715. [Google Scholar] [CrossRef]
  91. Balakrishnan, V.S. The arrival of Sputnik V. Lancet Infect. Dis. 2020, 20, 1128. [Google Scholar] [CrossRef] [PubMed]
  92. Logunov, D.Y.; Dolzhikova, I.V.; Zubkova, O.V.; Tukhvatulin, A.I.; Shcheblyakov, D.V.; Dzharullaeva, A.S.; Grousova, D.M.; Erokhova, A.S.; Kovyrshina, A.V.; Botikov, A.G.; et al. Safety and immunogenicity of an rAd26 and rAd5 vector-based heterologous prime-boost COVID-19 vaccine in two formulations: Two open, non-randomised phase 1/2 studies from Russia. Lancet 2020, 396, 887–897. [Google Scholar] [CrossRef]
  93. Logunov, D.Y.; Dolzhikova, I.V.; Shcheblyakov, D.V.; Tukhvatulin, A.I.; Zubkova, O.V.; Dzharullaeva, A.S.; Kovyrshina, A.V.; Lubenets, N.L.; Grousova, D.M.; Erokhova, A.S.; et al. Safety and efficacy of an rAd26 and rAd5 vector-based heterologous prime-boost COVID-19 vaccine: An interim analysis of a randomised controlled phase 3 trial in Russia. Lancet 2021, 397, 671–681. [Google Scholar] [CrossRef]
  94. Zhu, Y.; Tang, R.; Li, X.; Chen, X.; Wang, X.; Wang, Y.; Wang, R.; Zhu, F.; Li, J. Vaccination with Adenovirus Type 5 Vector-Based COVID-19 Vaccine as the Primary Series in Adults: A Randomized, Double-Blind, Placebo-Controlled Phase 1/2 Clinical Trial. Vaccines 2024, 12, 292. [Google Scholar] [CrossRef]
  95. Wu, S.; Zhong, G.; Zhang, J.; Shuai, L.; Zhang, Z.; Wen, Z.; Wang, B.; Zhao, Z.; Song, X.; Chen, Y.; et al. A single dose of an adenovirus-vectored vaccine provides protection against SARS-CoV-2 challenge. Nat. Commun. 2020, 11, 4081. [Google Scholar] [CrossRef] [PubMed]
  96. Feng, L.; Wang, Q.; Shan, C.; Yang, C.; Feng, Y.; Wu, J.; Liu, X.; Zhou, Y.; Jiang, R.; Hu, P.; et al. An adenovirus-vectored COVID-19 vaccine confers protection from SARS-CoV-2 challenge in rhesus macaques. Nat. Commun. 2020, 11, 4207. [Google Scholar] [CrossRef]
  97. Zhu, F.-C.; Guan, X.-H.; Li, Y.-H.; Huang, J.-Y.; Jiang, T.; Hou, L.-H.; Li, J.-X.; Yang, B.-F.; Wang, L.; Wang, W.-J.; et al. Immunogenicity and safety of a recombinant adenovirus type-5-vectored COVID-19 vaccine in healthy adults aged 18 years or older: A randomised, double-blind, placebo-controlled, phase 2 trial. Lancet 2020, 396, 479–488. [Google Scholar] [CrossRef]
  98. Halperin, S.A.; Ye, L.; MacKinnon-Cameron, D.; Smith, B.; Cahn, P.E.; Ruiz-Palacios, G.M.; Ikram, A.; Lanas, F.; Lourdes Guerrero, M.; Muñoz Navarro, S.R.; et al. Final efficacy analysis, interim safety analysis, and immunogenicity of a single dose of recombinant novel coronavirus vaccine (adenovirus type 5 vector) in adults 18 years and older: An international, multicentre, randomised, double-blinded, placebo-controlled phase 3 trial. Lancet 2022, 399, 237–248. [Google Scholar] [CrossRef] [PubMed]
  99. Emary, K.R.W.; Golubchik, T.; Aley, P.K.; Ariani, C.V.; Angus, B.; Bibi, S.; Blane, B.; Bonsall, D.; Cicconi, P.; Charlton, S.; et al. Efficacy of ChAdOx1 nCoV-19 (AZD1222) vaccine against SARS-CoV-2 variant of concern 202012/01 (B.1.1.7): An exploratory analysis of a randomised controlled trial. Lancet 2021, 397, 1351–1362. [Google Scholar] [CrossRef]
  100. Folegatti, P.M.; Ewer, K.J.; Aley, P.K.; Angus, B.; Becker, S.; Belij-Rammerstorfer, S.; Bellamy, D.; Bibi, S.; Bittaye, M.; Clutterbuck, E.A.; et al. Safety and immunogenicity of the ChAdOx1 nCoV-19 vaccine against SARS-CoV-2: A preliminary report of a phase 1/2, single-blind, randomised controlled trial. Lancet 2020, 396, 467–478. [Google Scholar] [CrossRef] [PubMed]
  101. Oliver, S.E.; Wallace, M.; See, I.; Mbaeyi, S.; Godfrey, M.; Hadler, S.C.; Jatlaoui, T.C.; Twentyman, E.; Hughes, M.M.; Rao, A.K.; et al. Use of the Janssen (Johnson & Johnson) COVID-19 Vaccine: Updated Interim Recommendations from the Advisory Committee on Immunization Practices-United States, December 2021. MMWR Morb. Mortal. Wkly. Rep. 2022, 71, 90–95. [Google Scholar] [CrossRef]
  102. Ikegame, S.; Siddiquey, M.N.A.; Hung, C.T.; Haas, G.; Brambilla, L.; Oguntuyo, K.Y.; Kowdle, S.; Vilardo, A.E.; Edelstein, A.; Perandones, C.; et al. Neutralizing activity of Sputnik V vaccine sera against SARS-CoV-2 variants. medRxiv Prepr. Serv. Health Sci. 2021. [Google Scholar] [CrossRef]
  103. Fiolet, T.; Kherabi, Y.; MacDonald, C.J.; Ghosn, J.; Peiffer-Smadja, N. Comparing COVID-19 vaccines for their characteristics, efficacy and effectiveness against SARS-CoV-2 and variants of concern: A narrative review. Clin. Microbiol. Infect. 2022, 28, 202–221. [Google Scholar] [CrossRef]
  104. Huang, Z.; Xu, S.; Liu, J.; Wu, L.; Qiu, J.; Wang, N.; Ren, J.; Li, Z.; Guo, X.; Tao, F.; et al. Effectiveness of inactivated and Ad5-nCoV COVID-19 vaccines against SARS-CoV-2 Omicron BA. 2 variant infection, severe illness, and death. BMC Med. 2022, 20, 400. [Google Scholar] [CrossRef]
  105. Richardson, V.L.; Camacho Franco, M.A.; Bautista Márquez, A.; Martínez Valdez, L.; Castro Ceronio, L.E.; Cruz Cruz, V.; Gharpure, R.; Lafond, K.E.; Yau, T.S.; Azziz-Baumgartner, E.; et al. Vaccine Effectiveness of CanSino (Adv5-nCoV) Coronavirus Disease 2019 (COVID-19) Vaccine Among Childcare Workers-Mexico, March-December 2021. Clin. Infect. Dis. 2022, 75, S167–S173. [Google Scholar] [CrossRef]
  106. Mennechet, F.J.D.; Paris, O.; Ouoba, A.R.; Salazar Arenas, S.; Sirima, S.B.; Takoudjou Dzomo, G.R.; Diarra, A.; Traore, I.T.; Kania, D.; Eichholz, K.; et al. A review of 65 years of human adenovirus seroprevalence. Expert. Rev. Vaccines 2019, 18, 597–613. [Google Scholar] [CrossRef] [PubMed]
  107. Schilham, M.W.; Claas, E.C.; Van Zaane, W.; Heemskerk, B.; Vossen, J.M.; Lankester, A.C.; Toes, R.E.; Echavarria, M.; Kroes, A.C.; Van Tol, M.J. High Levels of Adenovirus DNA in Serum Correlate with Fatal Outcome of Adenovirus Infection in Children after Allogeneic Stem-Cell Transplantation. Clin. Infect. Dis. 2002, 35, 526–532. [Google Scholar] [CrossRef] [PubMed]
  108. Fausther-Bovendo, H.; Kobinger, G.P. Pre-existing immunity against Ad vectors: Humoral, cellular, and innate response, what’s important? Hum. Vaccin. Immunother. 2014, 10, 2875–2884. [Google Scholar] [CrossRef]
  109. Zhang, Q.; Seto, D. Chimpanzee Adenovirus Vector Ebola Vaccine--Preliminary Report. N. Engl. J. Med. 2015, 373, 775–776. [Google Scholar] [CrossRef]
  110. Sayedahmed, E.E.; Kumari, R.; Shukla, S.; Hassan, A.O.; Mohammed, S.I.; York, I.A.; Gangappa, S.; Sambhara, S.; Mittal, S.K. Longevity of adenovirus vector immunity in mice and its implications for vaccine efficacy. Vaccine 2018, 36, 6744–6751. [Google Scholar] [CrossRef]
  111. Kanack, A.J.; Padmanabhan, A. Vaccine-induced immune thrombotic thrombocytopenia. Best. Pract. Res. Clin. Haematol. 2022, 35, 101381. [Google Scholar] [CrossRef] [PubMed]
  112. Greinacher, A.; Selleng, K.; Warkentin, T.E. Autoimmune heparin-induced thrombocytopenia. J. Thromb. Haemost. 2017, 15, 2099–2114. [Google Scholar] [CrossRef]
  113. Baker, A.T.; Boyd, R.J.; Sarkar, D.; Teijeira-Crespo, A.; Chan, C.K.; Bates, E.; Waraich, K.; Vant, J.; Wilson, E.; Truong, C.D.; et al. ChAdOx1 interacts with CAR and PF4 with implications for thrombosis with thrombocytopenia syndrome. Sci. Adv. 2021, 7, eabl8213. [Google Scholar] [CrossRef]
  114. Kanack, A.J.; Bayas, A.; George, G.; Abou-Ismail, M.Y.; Singh, B.; Kohlhagen, M.C.; Splinter, N.P.; Christ, M.; Naumann, M.; Moser, K.A.; et al. Monoclonal and oligoclonal anti-platelet factor 4 antibodies mediate VITT. Blood 2022, 140, 73–77. [Google Scholar] [CrossRef]
  115. Padmanabhan, A.; Jones, C.G.; Bougie, D.W.; Curtis, B.R.; McFarland, J.G.; Wang, D.; Aster, R.H. Heparin-independent, PF4-dependent binding of HIT antibodies to platelets: Implications for HIT pathogenesis. Blood 2015, 125, 155–161. [Google Scholar] [CrossRef] [PubMed]
  116. Craven, B.; Lester, W.; Boyce, S.; Thomas, W.; Kanny, A.; Davies, C.; Pavord, S.; Hermans, J.; Makris, M.; Bart-Smith, E.; et al. Natural history of PF4 antibodies in vaccine-induced immune thrombocytopenia and thrombosis. Blood 2022, 139, 2553–2560. [Google Scholar] [CrossRef] [PubMed]
  117. Gabarin, N.; Arnold, D.M.; Nazy, I.; Warkentin, T.E. Treatment of vaccine-induced immune thrombotic thrombocytopenia (VITT). Semin. Hematol. 2022, 59, 89–96. [Google Scholar] [CrossRef] [PubMed]
  118. Kanack, A.J.; Singh, B.; George, G.; Gundabolu, K.; Koepsell, S.A.; Abou-Ismail, M.Y.; Moser, K.A.; Smock, K.J.; Green, D.; Major, A.; et al. Persistence of Ad26.COV2.S-associated vaccine-induced immune thrombotic thrombocytopenia (VITT) and specific detection of VITT antibodies. Am. J. Hematol. 2022, 97, 519–526. [Google Scholar] [CrossRef]
  119. Warkentin, T.E.; Kelton, J.G. Temporal aspects of heparin-induced thrombocytopenia. N. Engl. J. Med. 2001, 344, 1286–1292. [Google Scholar] [CrossRef]
  120. See, I.; Lale, A.; Marquez, P.; Streiff, M.B.; Wheeler, A.P.; Tepper, N.K.; Woo, E.J.; Broder, K.R.; Edwards, K.M.; Gallego, R.; et al. Case Series of Thrombosis With Thrombocytopenia Syndrome After COVID-19 Vaccination—United States, December 2020 to August 2021. Ann. Intern. Med. 2022, 175, 513–522. [Google Scholar] [CrossRef]
  121. Andrews, N.J.; Stowe, J.; Ramsay, M.E.; Miller, E. Risk of venous thrombotic events and thrombocytopenia in sequential time periods after ChAdOx1 and BNT162b2 COVID-19 vaccines: A national cohort study in England. Lancet Reg. Health. Eur. 2022, 13, 100260. [Google Scholar] [CrossRef]
  122. Buoninfante, A.; Andeweg, A.; Baker, A.T.; Borad, M.; Crawford, N.; Dogné, J.M.; Garcia-Azorin, D.; Greinacher, A.; Helfand, R.; Hviid, A.; et al. Understanding thrombosis with thrombocytopenia syndrome after COVID-19 vaccination. npj Vac. 2022, 7, 141. [Google Scholar] [CrossRef]
  123. Herrera-Comoglio, R.; Lane, S. Vaccine-Induced Immune Thrombocytopenia and Thrombosis after the Sputnik V Vaccine. N. Engl. J. Med. 2022, 387, 1431–1432. [Google Scholar] [CrossRef]
  124. Van De Munckhof, A.; Krzywicka, K.; Aguiar De Sousa, D.; Sánchez Van Kammen, M.; Heldner, M.R.; Jood, K.; Lindgren, E.; Tatlisumak, T.; Putaala, J.; Kremer Hovinga, J.A.; et al. Declining mortality of cerebral venous sinus thrombosis with thrombocytopenia after SARS-CoV-2 vaccination. Eur. J. Neurol. 2022, 29, 339–344. [Google Scholar] [CrossRef]
  125. Thiele, T.; Weisser, K.; Schönborn, L.; Funk, M.B.; Weber, G.; Greinacher, A.; Keller-Stanislawski, B. Laboratory confirmed vaccine-induced immune thrombotic thrombocytopenia: Retrospective analysis of reported cases after vaccination with ChAdOx-1 nCoV-19 in Germany. Lancet Reg. Health—Eur. 2022, 12, 100270. [Google Scholar] [CrossRef] [PubMed]
  126. Hosseinzadeh, R.; Barary, M.; Mehdinezhad, H.; Sio, T.T.; Langer, F.; Khosravi, S. Thrombotic thrombocytopenia After Sinopharm BBIBP-CorV COVID-19 vaccination. Res. Pract. Thromb. Haemost. 2022, 6, e12750. [Google Scholar] [CrossRef]
  127. Roytenberg, R.; García-Sastre, A.; Li, W. Vaccine-induced immune thrombotic thrombocytopenia: What do we know hitherto? Front. Med. 2023, 10, 1155727. [Google Scholar] [CrossRef]
  128. Kim, A.Y.; Woo, W.; Yon, D.K.; Lee, S.W.; Yang, J.W.; Kim, J.H.; Park, S.; Koyanagi, A.; Kim, M.S.; Lee, S.; et al. Thrombosis patterns and clinical outcome of COVID-19 vaccine-induced immune thrombotic thrombocytopenia: A Systematic Review and Meta-Analysis. Int. J. Infect. Dis. 2022, 119, 130–139. [Google Scholar] [CrossRef]
  129. Abrignani, M.G.; Murrone, A.; De Luca, L.; Roncon, L.; Di Lenarda, A.; Valente, S.; Caldarola, P.; Riccio, C.; Oliva, F.; Gulizia, M.M.; et al. COVID-19, Vaccines, and Thrombotic Events: A Narrative Review. JCM 2022, 11, 948. [Google Scholar] [CrossRef] [PubMed]
  130. Hughes, R.A.C.; Cornblath, D.R. Guillain-Barré syndrome. Lancet 2005, 366, 1653–1666. [Google Scholar] [CrossRef]
  131. Van Den Berg, B.; Walgaard, C.; Drenthen, J.; Fokke, C.; Jacobs, B.C.; Van Doorn, P.A. Guillain–Barré syndrome: Pathogenesis, diagnosis, treatment and prognosis. Nat. Rev. Neurol. 2014, 10, 469–482. [Google Scholar] [CrossRef] [PubMed]
  132. Rzymski, P. Guillain-Barré syndrome and COVID-19 vaccines: Focus on adenoviral vectors. Front. Immunol. 2023, 14, 1183258. [Google Scholar] [CrossRef] [PubMed]
  133. Patone, M.; Handunnetthi, L.; Saatci, D.; Pan, J.; Katikireddi, S.V.; Razvi, S.; Hunt, D.; Mei, X.W.; Dixon, S.; Zaccardi, F.; et al. Neurological complications after first dose of COVID-19 vaccines and SARS-CoV-2 infection. Nat. Med. 2021, 27, 2144–2153. [Google Scholar] [CrossRef]
  134. Maramattom, B.V.; Krishnan, P.; Paul, R.; Padmanabhan, S.; Cherukudal Vishnu Nampoothiri, S.; Syed, A.A.; Mangat, H.S. Guillain-Barré Syndrome following ChAdOx1-S/nCoV-19 Vaccine. Ann. Neurol. 2021, 90, 312–314. [Google Scholar] [CrossRef]
  135. Osowicki, J.; Morgan, H.; Harris, A.; Crawford, N.W.; Buttery, J.P.; Kiers, L. Guillain-Barré Syndrome in an Australian State Using Both mRNA and Adenovirus-Vector SARS-CoV-2 Vaccines. Ann. Neurol. 2021, 90, 856–858. [Google Scholar] [CrossRef] [PubMed]
  136. Ogunjimi, O.B.; Tsalamandris, G.; Paladini, A.; Varrassi, G.; Zis, P. Guillain-Barré Syndrome Induced by Vaccination Against COVID-19: A Systematic Review and Meta-Analysis. Cureus 2023, 15, e37578. [Google Scholar] [CrossRef] [PubMed]
  137. Callaway, E. The next generation of coronavirus vaccines: A graphical guide. Nature 2023, 614, 22–25. [Google Scholar] [CrossRef] [PubMed]
  138. Chen, J.; Deng, Y.; Huang, B.; Han, D.; Wang, W.; Huang, M.; Zhai, C.; Zhao, Z.; Yang, R.; Zhao, Y.; et al. DNA Vaccines Expressing the Envelope and Membrane Proteins Provide Partial Protection Against SARS-CoV-2 in Mice. Front. Immunol. 2022, 13, 827605. [Google Scholar] [CrossRef]
  139. Liu, J.; Wang, L.; Kurtesi, A.; Budylowski, P.; Potts, K.G.; Menon, H.; Tan, Y.; Samaan, P.; Liu, X.; Wang, Y.; et al. A bivalent COVID-19 mRNA vaccine elicited broad immune responses and protection against Omicron subvariants infection. npj Vac. 2025, 10, 4. [Google Scholar] [CrossRef]
  140. Shrestha, L.B.; Tungatt, K.; Aggarwal, A.; Stubis, A.; Fewings, N.L.; Fichter, C.; Akerman, A.; Rodrigo, C.; Tedla, N.; Lee, S.; et al. Bivalent Omicron BA.1 vaccine booster increases memory B cell breadth and neutralising antibodies against emerging SARS-CoV-2 variants. eBioMedicine 2024, 110, 105461. [Google Scholar] [CrossRef]
  141. Ying, B.; Darling, T.L.; Desai, P.; Liang, C.-Y.; Dmitriev, I.P.; Soudani, N.; Bricker, T.; Kashentseva, E.A.; Harastani, H.; Raju, S.; et al. Mucosal vaccine-induced cross-reactive CD8+ T cells protect against SARS-CoV-2 XBB.1.5 respiratory tract infection. Nat. Immunol. 2024, 25, 537–551. [Google Scholar] [CrossRef] [PubMed]
  142. Chang, S.; Shin, K.-S.; Park, B.; Park, S.; Shin, J.; Park, H.; Jung, I.K.; Kim, J.H.; Bae, S.E.; Kim, J.-O.; et al. Strategy to develop broadly effective multivalent COVID-19 vaccines against emerging variants based on Ad5/35 platform. Proc. Natl. Acad. Sci. USA 2024, 121, e2313681121. [Google Scholar] [CrossRef]
  143. Wang, R.; Huang, H.; Yu, C.; Sun, C.; Ma, J.; Kong, D.; Lin, Y.; Zhao, D.; Zhou, S.; Lu, J.; et al. A spike-trimer protein-based tetravalent COVID-19 vaccine elicits enhanced breadth of neutralization against SARS-CoV-2 Omicron subvariants and other variants. Sci. China. Life Sci. 2023, 66, 1818–1830. [Google Scholar] [CrossRef]
  144. Hannawi, S.; Yan, L.; Saf Eldin, L.; Abuquta, A.; Alamadi, A.; Mahmoud, S.A.; Hassan, A.; Zhang, M.; Gao, C.; Chen, Y.; et al. Safety and immunogenicity of multivalent SARS-CoV-2 protein vaccines: A randomized phase 3 trial. eClinicalMedicine 2023, 64, 102195. [Google Scholar] [CrossRef]
  145. Abbink, P.; Lemckert, A.A.C.; Ewald, B.A.; Lynch, D.M.; Denholtz, M.; Smits, S.; Holterman, L.; Damen, I.; Vogels, R.; Thorner, A.R.; et al. Comparative Seroprevalence and Immunogenicity of Six Rare Serotype Recombinant Adenovirus Vaccine Vectors from Subgroups B and D. J. Virol. 2007, 81, 4654–4663. [Google Scholar] [CrossRef] [PubMed]
  146. Seshidhar Reddy, P.; Ganesh, S.; Limbach, M.P.; Brann, T.; Pinkstaff, A.; Kaloss, M.; Kaleko, M.; Connelly, S. Development of adenovirus serotype 35 as a gene transfer vector. Virology 2003, 311, 384–393. [Google Scholar] [CrossRef] [PubMed]
  147. Stone, D.; Ni, S.; Li, Z.-Y.; Gaggar, A.; DiPaolo, N.; Feng, Q.; Sandig, V.; Lieber, A. Development and assessment of human adenovirus type 11 as a gene transfer vector. J. Virol. 2005, 79, 5090–5104. [Google Scholar] [CrossRef]
  148. Baden, L.R.; Walsh, S.R.; Seaman, M.S.; Tucker, R.P.; Krause, K.H.; Patel, A.; Johnson, J.A.; Kleinjan, J.; Yanosick, K.E.; Perry, J.; et al. First-in-Human Evaluation of the Safety and Immunogenicity of a Recombinant Adenovirus Serotype 26 HIV-1 Env Vaccine (IPCAVD 001). J. Infect. Dis. 2013, 207, 240–247. [Google Scholar] [CrossRef]
  149. Keefer, M.C.; Gilmour, J.; Hayes, P.; Gill, D.; Kopycinski, J.; Cheeseman, H.; Cashin-Cox, M.; Naarding, M.; Clark, L.; Fernandez, N.; et al. A Phase I Double Blind, Placebo-Controlled, Randomized Study of a Multigenic HIV-1 Adenovirus Subtype 35 Vector Vaccine in Healthy Uninfected Adults. PLoS ONE 2012, 7, e41936. [Google Scholar] [CrossRef]
  150. Ouédraogo, A.; Tiono, A.B.; Kargougou, D.; Yaro, J.B.; Ouédraogo, E.; Kaboré, Y.; Kangoye, D.; Bougouma, E.C.; Gansane, A.; Henri, N.; et al. A Phase 1b Randomized, Controlled, Double-Blinded Dosage-Escalation Trial to Evaluate the Safety, Reactogenicity and Immunogenicity of an Adenovirus Type 35 Based Circumsporozoite Malaria Vaccine in Burkinabe Healthy Adults 18 to 45 Years of Age. PLoS ONE 2013, 8, e78679. [Google Scholar] [CrossRef]
  151. Tameris, M.; Hokey, D.A.; Nduba, V.; Sacarlal, J.; Laher, F.; Kiringa, G.; Gondo, K.; Lazarus, E.M.; Gray, G.E.; Nachman, S.; et al. A double-blind, randomised, placebo-controlled, dose-finding trial of the novel tuberculosis vaccine AERAS-402, an adenovirus-vectored fusion protein, in healthy, BCG-vaccinated infants. Vaccine 2015, 33, 2944–2954. [Google Scholar] [CrossRef]
  152. Matz, K.M.; Marzi, A.; Feldmann, H. Ebola vaccine trials: Progress in vaccine safety and immunogenicity. Expert. Rev. Vaccines 2019, 18, 1229–1242. [Google Scholar] [CrossRef] [PubMed]
  153. Alhashimi, M.; Elkashif, A.; Sayedahmed, E.E.; Mittal, S.K. Nonhuman Adenoviral Vector-Based Platforms and Their Utility in Designing Next Generation of Vaccines for Infectious Diseases. Viruses 2021, 13, 1493. [Google Scholar] [CrossRef]
  154. Xiang, Z.; Li, Y.; Cun, A.; Yang, W.; Ellenberg, S.; Switzer, W.M.; Kalish, M.L.; Ertl, H.C.J. Chimpanzee adenovirus antibodies in humans, sub-Saharan Africa. Emerg. Infect. Dis. 2006, 12, 1596–1599. [Google Scholar] [CrossRef]
  155. Fitzgerald, J.C.; Gao, G.-P.; Reyes-Sandoval, A.; Pavlakis, G.N.; Xiang, Z.Q.; Wlazlo, A.P.; Giles-Davis, W.; Wilson, J.M.; Ertl, H.C.J. A Simian Replication-Defective Adenoviral Recombinant Vaccine to HIV-1 Gag. J. Immunol. 2003, 170, 1416–1422. [Google Scholar] [CrossRef] [PubMed]
  156. Ledgerwood, J.E.; DeZure, A.D.; Stanley, D.A.; Coates, E.E.; Novik, L.; Enama, M.E.; Berkowitz, N.M.; Hu, Z.; Joshi, G.; Ploquin, A.; et al. Chimpanzee Adenovirus Vector Ebola Vaccine. N. Engl. J. Med. 2017, 376, 928–938. [Google Scholar] [CrossRef]
  157. Quinn, K.M.; Da Costa, A.; Yamamoto, A.; Berry, D.; Lindsay, R.W.B.; Darrah, P.A.; Wang, L.; Cheng, C.; Kong, W.-P.; Gall, J.G.D.; et al. Comparative Analysis of the Magnitude, Quality, Phenotype, and Protective Capacity of Simian Immunodeficiency Virus Gag-Specific CD8+ T Cells following Human-, Simian-, and Chimpanzee-Derived Recombinant Adenoviral Vector Immunization. J. Immunol. 2013, 190, 2720–2735. [Google Scholar] [CrossRef]
  158. Tapia, M.D.; Sow, S.O.; Lyke, K.E.; Haidara, F.C.; Diallo, F.; Doumbia, M.; Traore, A.; Coulibaly, F.; Kodio, M.; Onwuchekwa, U.; et al. Use of ChAd3-EBO-Z Ebola virus vaccine in Malian and US adults, and boosting of Malian adults with MVA-BN-Filo: A phase 1, single-blind, randomised trial, a phase 1b, open-label and double-blind, dose-escalation trial, and a nested, randomised, double-blind, placebo-controlled trial. Lancet Infect. Dis. 2016, 16, 31–42. [Google Scholar] [CrossRef]
  159. Rampling, T.; Ewer, K.J.; Bowyer, G.; Bliss, C.M.; Edwards, N.J.; Wright, D.; Payne, R.O.; Venkatraman, N.; De Barra, E.; Snudden, C.M.; et al. Safety and High Level Efficacy of the Combination Malaria Vaccine Regimen of RTS,S/AS01 B with Chimpanzee Adenovirus 63 and Modified Vaccinia Ankara Vectored Vaccines Expressing ME-TRAP. J. Infect. Dis. 2016, 214, 772–781. [Google Scholar] [CrossRef] [PubMed]
  160. Capone, S.; Reyes-Sandoval, A.; Naddeo, M.; Siani, L.; Ammendola, V.; Rollier, C.S.; Nicosia, A.; Colloca, S.; Cortese, R.; Folgori, A.; et al. Immune responses against a liver-stage malaria antigen induced by simian adenoviral vector AdCh63 and MVA prime–boost immunisation in non-human primates. Vaccine 2010, 29, 256–265. [Google Scholar] [CrossRef]
  161. Barnes, E.; Folgori, A.; Capone, S.; Swadling, L.; Aston, S.; Kurioka, A.; Meyer, J.; Huddart, R.; Smith, K.; Townsend, R.; et al. Novel Adenovirus-Based Vaccines Induce Broad and Sustained T Cell Responses to HCV in Man. Sci. Transl. Med. 2012, 4, 115ra1. [Google Scholar] [CrossRef] [PubMed]
  162. Antrobus, R.D.; Coughlan, L.; Berthoud, T.K.; Dicks, M.D.; Hill, A.V.; Lambe, T.; Gilbert, S.C. Clinical Assessment of a Novel Recombinant Simian Adenovirus ChAdOx1 as a Vectored Vaccine Expressing Conserved Influenza A Antigens. Mol. Ther. 2014, 22, 668–674. [Google Scholar] [CrossRef]
  163. Von Delft, A.; Donnison, T.A.; Lourenço, J.; Hutchings, C.; Mullarkey, C.E.; Brown, A.; Pybus, O.G.; Klenerman, P.; Chinnakannan, S.; Barnes, E. The generation of a simian adenoviral vectored HCV vaccine encoding genetically conserved gene segments to target multiple HCV genotypes. Vaccine 2018, 36, 313–321. [Google Scholar] [CrossRef]
  164. Wilkie, M.; Satti, I.; Minhinnick, A.; Harris, S.; Riste, M.; Ramon, R.L.; Sheehan, S.; Thomas, Z.-R.M.; Wright, D.; Stockdale, L.; et al. A phase I trial evaluating the safety and immunogenicity of a candidate tuberculosis vaccination regimen, ChAdOx1 85A prime–MVA85A boost in healthy UK adults. Vaccine 2020, 38, 779–789. [Google Scholar] [CrossRef]
  165. Tandon, M.; Sharma, A.; Vemula, S.V.; Bangari, D.S.; Mittal, S.K. Sequential administration of bovine and human adenovirus vectors to overcome vector immunity in an immunocompetent mouse model of breast cancer. Virus Res. 2012, 163, 202–211. [Google Scholar] [CrossRef]
  166. Moffatt, S.; Hays, J.; HogenEsch, H.; Mittal, S.K. Circumvention of vector-specific neutralizing antibody response by alternating use of human and non-human adenoviruses: Implications in gene therapy. Virology 2000, 272, 159–167. [Google Scholar] [CrossRef] [PubMed]
  167. Bangari, D.S.; Sharma, A.; Mittal, S.K. Bovine adenovirus type 3 internalization is independent of primary receptors of human adenovirus type 5 and porcine adenovirus type 3. Biochem. Biophys. Res. Commun. 2005, 331, 1478–1484. [Google Scholar] [CrossRef]
  168. Sayedahmed, E.E.; Hassan, A.O.; Kumari, R.; Cao, W.; Gangappa, S.; York, I.; Sambhara, S.; Mittal, S.K. A Bovine Adenoviral Vector-Based H5N1 Influenza -Vaccine Provides Enhanced Immunogenicity and Protection at a Significantly Low Dose. Mol. Ther. Methods Clin. Dev. 2018, 10, 210–222. [Google Scholar] [CrossRef] [PubMed]
  169. Bouet-Cararo, C.; Contreras, V.; Fournier, A.; Jallet, C.; Guibert, J.M.; Dubois, E.; Thiery, R.; Bréard, E.; Tordo, N.; Richardson, J.; et al. Canine adenoviruses elicit both humoral and cell-mediated immune responses against rabies following immunisation of sheep. Vaccine 2011, 29, 1304–1310. [Google Scholar] [CrossRef] [PubMed]
  170. Hu, R.L.; Liu, Y.; Zhang, S.F.; Zhang, F.; Fooks, A.R. Experimental immunization of cats with a recombinant rabies-canine adenovirus vaccine elicits a long-lasting neutralizing antibody response against rabies. Vaccine 2007, 25, 5301–5307. [Google Scholar] [CrossRef]
  171. Xiang, Z.Q.; Gao, G.P.; Reyes-Sandoval, A.; Li, Y.; Wilson, J.M.; Ertl, H.C.J. Oral Vaccination of Mice with Adenoviral Vectors Is Not Impaired by Preexisting Immunity to the Vaccine Carrier. J. Virol. 2003, 77, 10780–10789. [Google Scholar] [CrossRef]
  172. Pandey, A.; Singh, N.; Vemula, S.V.; Couëtil, L.; Katz, J.M.; Donis, R.; Sambhara, S.; Mittal, S.K. Impact of Preexisting Adenovirus Vector Immunity on Immunogenicity and Protection Conferred with an Adenovirus-Based H5N1 Influenza Vaccine. PLoS ONE 2012, 7, e33428. [Google Scholar] [CrossRef]
  173. Xing, M.; Wang, Y.; Wang, X.; Liu, J.; Dai, W.; Hu, G.; He, F.; Zhao, Q.; Li, Y.; Sun, L.; et al. Broad-spectrum vaccine via combined immunization routes triggers potent immunity to SARS-CoV-2 and its variants. J. Virol. 2023, 97, e00723–e00724. [Google Scholar] [CrossRef]
  174. Barros-Martins, J.; Hammerschmidt, S.I.; Cossmann, A.; Odak, I.; Stankov, M.V.; Morillas Ramos, G.; Dopfer-Jablonka, A.; Heidemann, A.; Ritter, C.; Friedrichsen, M.; et al. Immune responses against SARS-CoV-2 variants after heterologous and homologous ChAdOx1 nCoV-19/BNT162b2 vaccination. Nat. Med. 2021, 27, 1525–1529. [Google Scholar] [CrossRef]
  175. Schmidt, T.; Klemis, V.; Schub, D.; Mihm, J.; Hielscher, F.; Marx, S.; Abu-Omar, A.; Ziegler, L.; Guckelmus, C.; Urschel, R.; et al. Immunogenicity and reactogenicity of heterologous ChAdOx1 nCoV-19/mRNA vaccination. Nat. Med. 2021, 27, 1530–1535. [Google Scholar] [CrossRef] [PubMed]
  176. Kant, R.; Dwivedi, G.; Zaman, K.; Sahay, R.R.; Sapkal, G.; Kaushal, H.; Nyayanit, D.A.; Yadav, P.D.; Deshpande, G.; Singh, R.; et al. Serendipitous COVID-19 Vaccine-Mix in Uttar Pradesh, India: Safety and Immunogenicity Assessment of a Heterologous Regime. medRxiv Prepr. Serv. Health Sci. 2021. [Google Scholar] [CrossRef]
  177. Santosuosso, M.; McCormick, S.; Xing, Z. Adenoviral Vectors for Mucosal Vaccination Against Infectious Diseases. Viral Immunol. 2005, 18, 283–291. [Google Scholar] [CrossRef]
  178. Freitag, T.L.; Fagerlund, R.; Karam, N.L.; Leppänen, V.-M.; Ugurlu, H.; Kant, R.; Mäkinen, P.; Tawfek, A.; Jha, S.K.; Strandin, T.; et al. Intranasal administration of adenoviral vaccines expressing SARS-CoV-2 spike protein improves vaccine immunity in mouse models. Vaccine 2023, 41, 3233–3246. [Google Scholar] [CrossRef] [PubMed]
  179. Jung, H.E.; Ku, K.B.; Kang, B.H.; Park, J.H.; Kim, H.C.; Kim, K.-D.; Lee, H.K. Intranasal delivery of an adenovirus-vector vaccine co-expressing a modified spike protein and a genetic adjuvant confers lasting mucosal immunity against SARS-CoV-2. Antivir. Res. 2023, 216, 105656. [Google Scholar] [CrossRef]
  180. Hassan, A.O.; Kafai, N.M.; Dmitriev, I.P.; Fox, J.M.; Smith, B.K.; Harvey, I.B.; Chen, R.E.; Winkler, E.S.; Wessel, A.W.; Case, J.B.; et al. A Single-Dose Intranasal ChAd Vaccine Protects Upper and Lower Respiratory Tracts against SARS-CoV-2. Cell 2020, 183, 169–184.e13. [Google Scholar] [CrossRef] [PubMed]
  181. Roberts, D.M.; Nanda, A.; Havenga, M.J.E.; Abbink, P.; Lynch, D.M.; Ewald, B.A.; Liu, J.; Thorner, A.R.; Swanson, P.E.; Gorgone, D.A.; et al. Hexon-chimaeric adenovirus serotype 5 vectors circumvent pre-existing anti-vector immunity. Nature 2006, 441, 239–243. [Google Scholar] [CrossRef]
  182. Ma, J.; Duffy, M.R.; Deng, L.; Dakin, R.S.; Uil, T.; Custers, J.; Kelly, S.M.; McVey, J.H.; Nicklin, S.A.; Baker, A.H. Manipulating Adenovirus Hexon Hypervariable Loops Dictates Immune Neutralisation and Coagulation Factor X-dependent Cell Interaction In Vitro and In Vivo. PLoS Path. 2015, 11, e1004673. [Google Scholar] [CrossRef]
  183. Särkioja, M.; Pesonen, S.; Raki, M.; Hakkarainen, T.; Salo, J.; Ahonen, M.T.; Kanerva, A.; Hemminki, A. Changing the adenovirus fiber for retaining gene delivery efficacy in the presence of neutralizing antibodies. Gene Ther. 2008, 15, 921–929. [Google Scholar] [CrossRef]
  184. Rogée, S.; Grellier, E.; Bernard, C.; Jouy, N.; Loyens, A.; Beauvillain, J.C.; Fender, P.; Corjon, S.; Hong, S.S.; Boulanger, P.; et al. Influence of chimeric human-bovine fibers on adenoviral uptake by liver cells and the antiviral immune response. Gene Ther. 2010, 17, 880–891. [Google Scholar] [CrossRef]
  185. Nguyen, T.V.; Anguiano-Zarate, S.S.; Matchett, W.E.; Barry, M.E.; Barry, M.A. Retargeted and detargeted adenovirus for gene delivery to the muscle. Virology 2018, 514, 118–123. [Google Scholar] [CrossRef] [PubMed]
  186. Nicklin, S.A.; Von Seggern, D.J.; Work, L.M.; Pek, D.C.K.; Dominiczak, A.F.; Nemerow, G.R.; Baker, A.H. Ablating Adenovirus Type 5 Fiber–CAR Binding and HI Loop Insertion of the SIGYPLP Peptide Generate an Endothelial Cell-Selective Adenovirus. Mol. Ther. 2001, 4, 534–542. [Google Scholar] [CrossRef] [PubMed]
  187. O’Riordan, C.R.; Lachapelle, A.; Delgado, C.; Parkes, V.; Wadsworth, S.C.; Smith, A.E.; Francis, G.E. PEGylation of Adenovirus with Retention of Infectivity and Protection from Neutralizing Antibody in Vitro and in Vivo. Hum. Gene Ther. 1999, 10, 1349–1358. [Google Scholar] [CrossRef] [PubMed]
  188. Croyle, M.A.; Le, H.T.; Linse, K.D.; Cerullo, V.; Toietta, G.; Beaudet, A.; Pastore, L. PEGylated helper-dependent adenoviral vectors: Highly efficient vectors with an enhanced safety profile. Gene Ther. 2005, 12, 579–587. [Google Scholar] [CrossRef]
  189. Dicks, M.D.J.; Rose, L.M.; Russell, R.A.; Bowman, L.A.H.; Graham, C.; Jimenez-Guardeño, J.M.; Doores, K.J.; Malim, M.H.; Draper, S.J.; Howarth, M.; et al. Modular capsid decoration boosts adenovirus vaccine-induced humoral immunity against SARS-CoV-2. Mol. Ther. 2022, 30, 3639–3657. [Google Scholar] [CrossRef]
  190. Luo, S.; Zhang, P.; Zou, P.; Wang, C.; Liu, B.; Wu, C.; Li, T.; Zhang, L.; Zhang, Y.; Li, C. A Self-Biomineralized Novel Adenovirus Vectored COVID-19 Vaccine for Boosting Immunization of Mice. Virol. Sin. 2021, 36, 1113–1123. [Google Scholar] [CrossRef]
  191. Mendez, N.; Herrera, V.; Zhang, L.; Hedjran, F.; Feuer, R.; Blair, S.L.; Trogler, W.C.; Reid, T.R.; Kummel, A.C. Encapsulation of adenovirus serotype 5 in anionic lecithin liposomes using a bead-based immunoprecipitation technique enhances transfection efficiency. Biomaterials 2014, 35, 9554–9561. [Google Scholar] [CrossRef]
  192. Yotnda, P.; Chen, D.-H.; Chiu, W.; Piedra, P.A.; Davis, A.; Templeton, N.S.; Brenner, M.K. Bilamellar Cationic Liposomes Protect Adenovectors from Preexisting Humoral Immune Responses. Mol. Ther. 2002, 5, 233–241. [Google Scholar] [CrossRef]
  193. Vupputuri, S.; Tayebi, L.; Hikkaduwa Koralege, R.S.; Nigatu, A.; Mozafari, M.; Mishra, A.; Liu, L.; Ramsey, J.D. Polyethylene glycol–modified DOTAP:cholesterol/adenovirus hybrid vectors have improved transduction efficiency and reduced immunogenicity. J. Nanopart. Res. 2021, 23, 37. [Google Scholar] [CrossRef]
  194. Gonzalez-Pastor, R.; Hernandez, Y.; Gimeno, M.; De Martino, A.; Man, Y.K.S.; Hallden, G.; Quintanilla, M.; De La Fuente, J.M.; Martin-Duque, P. Coating an adenovirus with functionalized gold nanoparticles favors uptake, intracellular trafficking and anti-cancer therapeutic efficacy. Acta Biomater. 2021, 134, 593–604. [Google Scholar] [CrossRef]
  195. Khalil, I.R.; Khechara, M.P.; Kurusamy, S.; Armesilla, A.L.; Gupta, A.; Mendrek, B.; Khalaf, T.; Scandola, M.; Focarete, M.L.; Kowalczuk, M.; et al. Poly-Gamma-Glutamic Acid (γ-PGA)-Based Encapsulation of Adenovirus to Evade Neutralizing Antibodies. Molecules 2018, 23, 2565. [Google Scholar] [CrossRef] [PubMed]
  196. Lameiro, M.H.; Malpique, R.; Silva, A.C.; Alves, P.M.; Melo, E. Encapsulation of adenoviral vectors into chitosan–bile salt microparticles for mucosal vaccination. J. Biotechnol. 2006, 126, 152–162. [Google Scholar] [CrossRef] [PubMed]
  197. Sailaja, G.; HogenEsch, H.; North, A.; Hays, J.; Mittal, S.K. Encapsulation of recombinant adenovirus into alginate microspheres circumvents vector-specific immune response. Gene Ther. 2002, 9, 1722–1729. [Google Scholar] [CrossRef]
  198. Pereboev, A.V.; Nagle, J.M.; Shakhmatov, M.A.; Triozzi, P.L.; Matthews, Q.L.; Kawakami, Y.; Curiel, D.T.; Blackwell, J.L. Enhanced Gene Transfer to Mouse Dendritic Cells Using Adenoviral Vectors Coated with a Novel Adapter Molecule. Mol. Ther. 2004, 9, 712–720. [Google Scholar] [CrossRef]
  199. Khan, A.; Sayedahmed, E.E.; Singh, V.K.; Mishra, A.; Dorta-Estremera, S.; Nookala, S.; Canaday, D.H.; Chen, M.; Wang, J.; Sastry, K.J.; et al. A recombinant bovine adenoviral mucosal vaccine expressing mycobacterial antigen-85B generates robust protection against tuberculosis in mice. Cell Rep. Med. 2021, 2, 100372. [Google Scholar] [CrossRef]
  200. Sayedahmed, E.E.; Araújo, M.V.; Silva-Pereira, T.T.; Chothe, S.K.; Elkashif, A.; Alhashimi, M.; Wang, W.-C.; Santos, A.P.; Nair, M.S.; Gontu, A.; et al. Impact of an autophagy-inducing peptide on immunogenicity and protection efficacy of an adenovirus-vectored SARS-CoV-2 vaccine. Mol. Ther. Methods Clin. Dev. 2023, 30, 194–207. [Google Scholar] [CrossRef] [PubMed]
  201. Sayedahmed, E.E.; Elshafie, N.O.; Dos Santos, A.P.; Jagannath, C.; Sambhara, S.; Mittal, S.K. Development of NP-Based Universal Vaccine for Influenza A Viruses. Vaccines 2024, 12, 157. [Google Scholar] [CrossRef]
  202. Hegde, R.S.; Bernstein, H.D. The surprising complexity of signal sequences. Trends Biochem. Sci. 2006, 31, 563–571. [Google Scholar] [CrossRef]
  203. Fonseca, J.A.; McCaffery, J.N.; Caceres, J.; Kashentseva, E.; Singh, B.; Dmitriev, I.P.; Curiel, D.T.; Moreno, A. Inclusion of the murine IgGκ signal peptide increases the cellular immunogenicity of a simian adenoviral vectored Plasmodium vivax multistage vaccine. Vaccine 2018, 36, 2799–2808. [Google Scholar] [CrossRef]
  204. Rollier, C.S.; Spencer, A.J.; Sogaard, K.C.; Honeycutt, J.; Furze, J.; Bregu, M.; Gilbert, S.C.; Wyllie, D.; Hill, A.V.S. Modification of Adenovirus vaccine vector-induced immune responses by expression of a signalling molecule. Sci. Rep. 2020, 10, 5716. [Google Scholar] [CrossRef]
  205. Szvetnik, A.; Tubak, V. The Production of Complement Inhibitor Proteins in Mammalian Cell Lines—Light at the End of the Tunnel? Biomedicines 2024, 12, 646. [Google Scholar] [CrossRef] [PubMed]
  206. Zhu, Y.; Saribas, A.S.; Liu, J.; Lin, Y.; Bodnar, B.; Zhao, R.; Guo, Q.; Ting, J.; Wei, Z.; Ellis, A.; et al. Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization. Mol. Ther. 2023, 31, 1136–1158. [Google Scholar] [CrossRef] [PubMed]
  207. Rethi-Nagy, Z.; Abraham, E.; Udvardy, K.; Klement, E.; Darula, Z.; Pal, M.; Katona, R.L.; Tubak, V.; Pali, T.; Kota, Z.; et al. STABILON, a Novel Sequence Motif That Enhances the Expression and Accumulation of Intracellular and Secreted Proteins. Int. J. Mol. Sci. 2022, 23, 8168. [Google Scholar] [CrossRef] [PubMed]
Figure 1. (A) Diagrammatic representation of adenovirus, illustrating its key proteins and genomes. (B) Schematic representation of the adenoviral genome, gene transcription units, and key proteins. (C) Overview of the adenoviral genome with annotated open reading frames (ORFs) and their functions in viral replication. E1, early region (shown as red arrows); E2 (shown as green arrows); E3 (shown as yellow arrows); E4 (shown as pink arrows); L, late region (shown as bluearrows); L’-ITR, left inverted terminal repeat; R’-ITR, right inverted terminal repeat; Ψ, packaging signal; Pol, adenovirus DNA polymerase; pTP, terminal protein; DBP, DNA-binding protein. The figure was created using https://BioRender.com.
Figure 1. (A) Diagrammatic representation of adenovirus, illustrating its key proteins and genomes. (B) Schematic representation of the adenoviral genome, gene transcription units, and key proteins. (C) Overview of the adenoviral genome with annotated open reading frames (ORFs) and their functions in viral replication. E1, early region (shown as red arrows); E2 (shown as green arrows); E3 (shown as yellow arrows); E4 (shown as pink arrows); L, late region (shown as bluearrows); L’-ITR, left inverted terminal repeat; R’-ITR, right inverted terminal repeat; Ψ, packaging signal; Pol, adenovirus DNA polymerase; pTP, terminal protein; DBP, DNA-binding protein. The figure was created using https://BioRender.com.
Vaccines 13 00406 g001
Figure 2. Schematic representation of adenoviral vector generations. (A) Wild-type adenovirus genome. (B) First-generation adenoviral vector with deletions in the E1 and E3 genes. (C) Second-generation adenoviral vector with all early genes (E1, E2, E3, and E4) removed. (D) Third-generation adenoviral vector, retaining only the inverted terminal repeat (ITR) regions while the rest of the genome is deleted. The packaging signal (Ψ) is located immediately downstream of the ITR sequence. The figure was created using https://BioRender.com.
Figure 2. Schematic representation of adenoviral vector generations. (A) Wild-type adenovirus genome. (B) First-generation adenoviral vector with deletions in the E1 and E3 genes. (C) Second-generation adenoviral vector with all early genes (E1, E2, E3, and E4) removed. (D) Third-generation adenoviral vector, retaining only the inverted terminal repeat (ITR) regions while the rest of the genome is deleted. The packaging signal (Ψ) is located immediately downstream of the ITR sequence. The figure was created using https://BioRender.com.
Vaccines 13 00406 g002
Figure 3. Challenges associated with adenoviral vector-based vaccines. (A) Immune responses in individuals to adenoviral vector vaccines following the first and second inoculation. (B) Potential mechanism of vaccine-induced thrombotic thrombocytopenia. TLR, Toll-like receptor; PAMP, pathogen-associated molecular patterns; PF4, platelet factor 4. The figure was created using https://BioRender.com.
Figure 3. Challenges associated with adenoviral vector-based vaccines. (A) Immune responses in individuals to adenoviral vector vaccines following the first and second inoculation. (B) Potential mechanism of vaccine-induced thrombotic thrombocytopenia. TLR, Toll-like receptor; PAMP, pathogen-associated molecular patterns; PF4, platelet factor 4. The figure was created using https://BioRender.com.
Vaccines 13 00406 g003
Figure 4. Strategies for developing next-generation adenoviral vector vaccines for SARS-CoV-2. (A) Use of rare and nonhuman adenoviruses as vectors. (B) Varied immunization routes and prime-boost approach. (C) Targeting proteins other than spike. (D) Chemical encapsulation. (E) Use of bispecific adapters. (F) Use of chimeric vector. (G) Use of peptides to increase the immune response. HAd, human adenovirus; ChAd, chimpanzee adenovirus; BAd, bovine adenovirus; PAd, porcine adenovirus; OAd, ovine adenovirus; CAd, canine adenovirus; AIP, autophagy-inducing peptide C5. The figure was created using https://BioRender.com.
Figure 4. Strategies for developing next-generation adenoviral vector vaccines for SARS-CoV-2. (A) Use of rare and nonhuman adenoviruses as vectors. (B) Varied immunization routes and prime-boost approach. (C) Targeting proteins other than spike. (D) Chemical encapsulation. (E) Use of bispecific adapters. (F) Use of chimeric vector. (G) Use of peptides to increase the immune response. HAd, human adenovirus; ChAd, chimpanzee adenovirus; BAd, bovine adenovirus; PAd, porcine adenovirus; OAd, ovine adenovirus; CAd, canine adenovirus; AIP, autophagy-inducing peptide C5. The figure was created using https://BioRender.com.
Vaccines 13 00406 g004
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Murala, M.S.T.; Gairola, V.; Sayedahmed, E.E.; Mittal, S.K. Next-Generation Adenoviral Vector-Based Vaccines for Severe Acute Respiratory Syndrome Coronavirus-2. Vaccines 2025, 13, 406. https://doi.org/10.3390/vaccines13040406

AMA Style

Murala MST, Gairola V, Sayedahmed EE, Mittal SK. Next-Generation Adenoviral Vector-Based Vaccines for Severe Acute Respiratory Syndrome Coronavirus-2. Vaccines. 2025; 13(4):406. https://doi.org/10.3390/vaccines13040406

Chicago/Turabian Style

Murala, Muralimanohara S. T., Vivek Gairola, Ekramy E. Sayedahmed, and Suresh K. Mittal. 2025. "Next-Generation Adenoviral Vector-Based Vaccines for Severe Acute Respiratory Syndrome Coronavirus-2" Vaccines 13, no. 4: 406. https://doi.org/10.3390/vaccines13040406

APA Style

Murala, M. S. T., Gairola, V., Sayedahmed, E. E., & Mittal, S. K. (2025). Next-Generation Adenoviral Vector-Based Vaccines for Severe Acute Respiratory Syndrome Coronavirus-2. Vaccines, 13(4), 406. https://doi.org/10.3390/vaccines13040406

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop