Adjuvant Effects of a CC Chemokine for Enhancing the Efficacy of an Inactivated Streptococcus agalactiae Vaccine in Nile Tilapia (Oreochromis niloticus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Preparation of an Inactivated Streptococcus agalactiae Vaccine
2.3. Production of Recombinant rOn-CC1 Protein
2.4. Application of CC Chemokine Adjuvants to Enhance the Efficacy of Inactivated S. agalactiae Vaccines
2.4.1. Experimental Design and Vaccination
2.4.2. Sample Collection
2.4.3. Assessment of the Levels of Serum IgM Antibodies Specific to S. agalactiae Using ELISA
2.4.4. Analysis of Immune-Related Gene Expression
Total RNA Extraction and First-Strand cDNA Synthesis
Quantitative Real-Time PCR (qRT–PCR) Analysis
| Gene | Sequence (5′ to 3′) | Amplicon Size (bp) | References | |
|---|---|---|---|---|
| β-actin | F | ACAGGATGCAGAAGGAGATCACAG | 155 | [32] |
| R | GTACTCCTGCTTGCTGATCCACAT | |||
| Immunoglobulin M (IgM) | F | AGGCACAACGGTCACTGTCA | 108 | [32] |
| R | GCAAGGCAGCCAAGAGTGAC | |||
| Interferon gamma (IFN-γ) | F | CAGCAGAGATGAACTTGA | 93 | [32] |
| R | CACTAGGAAATACGGGTTT | |||
| Interleukin-1β (IL-1β) | F | GTGCTGAGCACAGAATTCCAGGAT | 166 | [32] |
| R | GAAGAACCAAGCTCCTCTTTTGGC | |||
| Tumor necrosis factor alpha (TNF-α) | F | CTGTAGTCACCTCCATTA | 94 | [32] |
| R | TACTTGTTGTTGCTTCTG | |||
| Interleukin-8 (1) (IL-8(1) or CXC1) | F | TGTCTGTGTCACCGTGTCAGGAAT | 151 | [32] |
| R | CCTTCAGCTCAGGGTTCAAGCAAT | |||
| Interleukin-8 (2) (IL-8(2) or CXC2) | F | CAAGCAGGACAACAGTGTCTGTGT | 102 | [32] |
| R | GTTGCAGAATTTGGTTGCTGGGTAG | |||
| CC chemokine1 (On-CC1) | F | ACAGAGCCGATCTTGGGTTACTTG | 228 | [32] |
| R | TGAAGGAGAGGCGGTGGATGTTAT | |||
| CC chemokine2 (On-CC2) | F | TGGGTTCGTGCCAAGATTGTTGCA | 120 | [32] |
| R | TGAAGGAGAGGCGGTGGATGTTAT | |||
2.4.5. Challenge Test
2.4.6. Statistical Analysis
2.5. Transcriptome Analysis
2.5.1. RNA Isolation, cDNA Library Preparation, and Sequencing Analysis
2.5.2. Transcriptomic Bioinformatics
2.5.3. Analysis of Differentially Expressed Genes (DEGs)
3. Results
3.1. Production of Recombinant On-CC1 (rOn-CC1) and Growth Parameters after Vaccination
3.2. Assessment of Serum IgM Specific to S. agalactiae Using ELISA
3.3. Analysis of the Expression of Immune-Related Genes
3.4. Transcriptome Analysis
3.4.1. Transcriptome Sequencing and Annotation
3.4.2. Sample Correlation Coefficient and Gene Set Analysis
3.4.3. Analysis of Differentially Expressed Genes (DEGs)
3.4.4. GO Enrichment Analysis
3.4.5. Analysis of Differential Gene Expression (DGE)
3.5. Challenge Test
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Department of Fisheries (DOF). Fisheries Statistics of Thailand 2022; Fisheries Development Policy and Planning Division, Department of Fisheries, Ministry of Agriculture and Cooperatives: Bangkok, Thailand, 2023; 95p.
- Kannika, K.; Pisuttharachai, D.; Srisapoome, P.; Wongtavatchai, J.; Kondo, H.; Hirono, I.; Unajak, S.; Areechon, N. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR. J. Appl. Microbiol. 2017, 122, 1497–1507. [Google Scholar] [CrossRef]
- Aisyhah, M.A.S.; Amal, M.N.A.; Zamri-Saad, M.; Siti-Zahrah, A.; Shaqinah, N.N. Streptococcus agalactiae isolates from cultured fishes in Malaysia manifesting low resistance pattern towards selected antibiotics. J. Fish Dis. 2015, 38, 1093–1098. [Google Scholar] [CrossRef]
- de Oliveira, T.F.; Queiroz, G.A.; Teixeira, J.P.; Figueiredo, H.C.P.; Leal, C.A.G. Recurrent Streptoccoccus agalactiae infection in Nile tilapia (Oreochromis niloticus) treated with florfenicol. Aquaculture 2018, 493, 51–60. [Google Scholar] [CrossRef]
- Tavares, G.C.; de Queiroz, G.A.; Assis, G.B.N.; Leibowitz, M.P.; Teixeira, J.P.; Figueiredo, H.C.P.; Leal, C.A.G. Disease outbreaks in farmed Amazon catfish (Leiarius marmoratus × Pseudoplatystoma corruscans) caused by Streptococcus agalactiae, S. iniae, and S. dysgalactiae. Aquaculture 2018, 495, 384–392. [Google Scholar] [CrossRef]
- Leal, C.A.G.; Silva, B.A.; Colombo, S.A. Susceptibility profile and epidemiological cut-off values are influenced by serotype in fish pathogenic Streptococcus agalactiae. Antibiotics 2023, 12, 1726. [Google Scholar] [CrossRef]
- Su, H.; Yakovlev, I.A.; van Eerde, A.; Su, J.; Clarke, J.L. Plant-produced vaccines: Future applications in aquaculture. Front. Plant Sci. 2021, 12, 718775. [Google Scholar] [CrossRef]
- Mondal, H.; Thomas, J. A review on the recent advances and application of vaccines against fish pathogens in aquaculture. Aquac. Int. 2022, 30, 1971–2000. [Google Scholar] [CrossRef]
- Du, Y.; Hu, X.; Miao, L.; Chen, J. Current status and development prospects of aquatic vaccines. Front. Immunol. 2022, 13, 1040336. [Google Scholar] [CrossRef]
- Ma, J.; Bruce, T.J.; Jones, E.M.; Cain, K.D. A Review of Fish Vaccine Development Strategies: Conventional Methods and Modern Biotechnological Approaches. Microorganisms 2019, 7, 569. [Google Scholar] [CrossRef]
- Sanina, N. Vaccine adjuvants derived from marine organisms. Biomolecules 2019, 9, 340. [Google Scholar] [CrossRef]
- Monir, M.S.; Yusoff, M.S.M.; Zamri-Saad, M.; Amal, M.N.A.; Mohamad, A.; Azzam-Sayuti, M.; Ina-Salwany, M.Y. Effect of an oral bivalent vaccine on immune response and immune gene profiling in vaccinated red tilapia (Oreochromis spp.) during infections with Streptococcus iniae and Aeromonas hydrophila. Biology 2022, 11, 1268. [Google Scholar] [CrossRef]
- Peatman, E.; Liu, Z. Evolution of CC chemokines in teleost fish: A case study in gene duplication and implications for immune diversity. Immunogenetics 2007, 59, 613–623. [Google Scholar] [CrossRef]
- Xu, H.; Liu, F. Advances in chemokines of teleost fish species. Aquac. Fish. 2024, 9, 115–125. [Google Scholar] [CrossRef]
- Nakharuthai, C.; Areechon, N.; Srisapoome, P. Molecular characterization, functional analysis, and defense mechanisms of two CC chemokines in Nile tilapia (Oreochromis niloticus) in response to severely pathogenic bacteria. Dev. Comp. Immunol. 2016, 59, 207–228. [Google Scholar] [CrossRef]
- Yamano, T.; Kaneda, Y.; Huang, S.; Hiramatsu, S.H.; Hoon, D.S.B. Enhancement of immunity by a DNA melanoma vaccine against TRP2 with CCL21 as an adjuvant. Mol. Ther. 2006, 13, 194–202. [Google Scholar] [CrossRef]
- Kutzler, M.A.; Kraynyak, K.A.; Nagle, S.J.; Parkinson, R.M.; Zharikova, D.; Chattergoon, M.; Maguire, H.; Muthumani, K.; Ugen, K.; Weiner, D.B. Plasmids encoding the mucosal chemokines CCL27 and CCL28 are effective adjuvants in eliciting antigen-specific immunity in vivo. Gene Ther. 2010, 17, 72–82. [Google Scholar] [CrossRef]
- Matsuo, K.; Kitahata, K.; Kawabata, F.; Kamei, M.; Hara, Y.; Takamura, S.; Oiso, N.; Kawada, A.; Yoshie, O.; Nakayama, T. A highly active form of XCL1/lymphotactin functions as an effective adjuvant to recruit cross presenting dendritic cells for induction of effector and memory CD8+ T cells. Front. Immunol. 2018, 9, 2775. [Google Scholar] [CrossRef]
- Xu, H.; Xing, J.; Tang, X.; Sheng, X.; Zhan, W. The effects of CCL3, CCL4, CCL19 and CCL21 as molecular adjuvants on the immune response to VAA DNA vaccine in flounder (Paralichthys olivaceus). Dev. Comp. Immunol. 2020, 103, 103492. [Google Scholar] [CrossRef]
- Guo, M.; Li, C. An overview of cytokine used as adjuvants in fish: Current state and future trends. Rev. Aquac. 2021, 13, 996–1014. [Google Scholar] [CrossRef]
- Mohan, T.; Zhu, W.; Wang, Y.; Wang, B.-Z. Applications of chemokines as adjuvants for vaccine immunotherapy. Immunobiology 2018, 223, 477–485. [Google Scholar] [CrossRef]
- Liu, X.; Zhao, J.; Xue, L.; Zhao, T.; Ding, W.; Han, Y.; Ye, H. A comparison of transcriptome analysis methods with reference genome. BMC Genom. 2022, 23, 232. [Google Scholar] [CrossRef]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA–Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA–Seq, a revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]
- Wu, X.; Li, R.; Li, Q.; Bao, H.; Wu, C. Comparative transcriptome analysis among parental inbred and crosses reveals the role of dominance gene expression in heterosis in Drosophila melanogaster. Sci. Rep. 2016, 6, 21124. [Google Scholar] [CrossRef]
- Silvaraj, S.; Md Yasin, I.S.; Karim, M.M.A.; Saad, M.Z. Transcriptome analysis of immune response in recombinant cell vaccine expressing OmpK vaccinated juvenile seabass (Lates calcarifer) head kidney against Vibrio harveyi infection. Aquac. Rep. 2021, 21, 100799. [Google Scholar] [CrossRef]
- Wu, X.; Xing, J.; Tang, X.; Sheng, X.; Chi, H.; Zhan, W. Splenic protection network revealed by transcriptome analysis in inactivated vaccine-immunized flounder (Paralichthys olivaceus) against Edwardsiella tarda infection. Front. Immunol. 2022, 13, 1058599. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, S.; Sun, X.; Xu, X. Comparative transcriptome analysis reveals the immune response of turbot (Scophthalmus maximus) induced by inactivated bivalent vaccine. Fish Shellfish Immunol. 2023, 132, 108461. [Google Scholar] [CrossRef]
- Kumwan, B.; Bunnoy, A.; Chatchaiphan, S.; Kayansamruaj, P.; Dong, H.T.; Senapin, S.; Srisapoome, P. First investigation of the optimal timing of vaccination of Nile tilapia (Oreochromis niloticus) larvae against Streptococcus agalactiae. Vaccines 2023, 11, 1753. [Google Scholar] [CrossRef]
- Meachasompop, P.; Bunnoy, A.; Keaswejjareansuk, W.; Dechbumroong, P.; Namdee, K.; Srisapoome, P. Development of immersion and oral bivalent nanovaccines for streptococcosis and columnaris disease prevention in fry and fingerling Asian seabass (Lates calcarifer) nursery farms. Vaccines 2024, 12, 17. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Phan-Aram, P.; Mahasri, G.; Kayansamruaj, P.; Amparyup, P.; Srisapoome, P. Immune regulation, but not antibacterial activity, is a crucial function of hepcidins in resistance against pathogenic bacteria in Nile tilapia (Oreochromis niloticus Linn.). Biomolecules 2020, 10, 1132. [Google Scholar] [CrossRef]
- Wang, J.; Lu, D.-Q.; Jiang, B.; Mo, X.-B.; Du, J.-J.; Li, A.-X. Influence of temperature on the vaccine efficacy against Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus). Aquaculture 2020, 521, 734943. [Google Scholar] [CrossRef]
- Wang, B.; Thompson, K.D.; Wangkahart, E.; Yamkasem, J.; Bondad-Reantaso, M.G.; Tattiyapong, P.; Jian, J.; Surachetpong, W. Strategies to enhance tilapia immunity to improve their health in aquaculture. Rev. Aquac. 2023, 15, 41–56. [Google Scholar] [CrossRef]
- Liu, G.; Zhu, J.; Chen, K.; Gao, T.; Yao, H.; Liu, Y.; Zhang, W.; Lu, C. Development of Streptococcus agalactiae vaccines for tilapia. Dis. Aquat. Organ. 2016, 122, 163–170. [Google Scholar] [CrossRef]
- Montecino-Rodriguez, E.; Berent-Maoz, B.; Dorshkind, K. Causes, consequences, and reversal of immune system aging. J. Clin. Investig. 2013, 123, 958–965. [Google Scholar] [CrossRef]
- Gary, E.N.; Tursi, N.J.; Warner, B.; Parzych, E.M.; Ali, A.R.; Frase, D.; Moffat, E.; Embury-Hyatt, C.; Smith, T.R.F.; Broderick, K.E.; et al. Mucosal chemokine adjuvant enhances synDNA vaccine-mediated responses to SARS-CoV-2 and provides heterologous protection in vivo. Cell. Rep. Med. 2022, 3, 100693. [Google Scholar] [CrossRef]
- Aldon, Y.; Kratochvil, S.; Shattock, R.J.; McKay, P.F. Chemokine-adjuvanted plasmid DNA induces homing of antigen-specific and non–antigen-specific B and T cells to the intestinal and genital mucosae. J. Immunol. 2020, 204, 903–913. [Google Scholar] [CrossRef]
- Huo, X.; Fan, C.; Ai, T.; Su, J. The combination of molecular adjuvant CCL35.2 and DNA vaccine significantly enhances the immune protection of Carassius auratus gibelio against CyHV-2 infection. Vaccines 2020, 8, 567. [Google Scholar] [CrossRef]
- Kwon, M.G.; Park, C.I.; Ju-Won, K.; Hwang, S.D. The immune-adjuvant effect and safety of recombinant CC chemokine 1 (rRbCC1) in rock bream, Oplegnathus fasciatus. J. Fish Pathol. 2013, 26, 231–240. [Google Scholar] [CrossRef]
- Li, K.; Wei, X.; Yang, J. Cytokine networks that suppress fish cellular immunity. Dev. Comp. Immunol. 2023, 147, 104769. [Google Scholar] [CrossRef]
- Sakai, M.; Hikima, J.I.; Kono, T. Fish cytokines: Current research and applications. Fish Sci. 2021, 87, 1–9. [Google Scholar] [CrossRef]
- Montecucco, F.; Steffens, S.; Burger, F.; Da Costa, A.; Bianchi, G.; Bertolotto, M.; Mach, F.; Dallegri, F.; Ottonello, L. Tumor necrosis factor-alpha (TNF-α) induces integrin CD11b/CD18 (Mac-1) up-regulation and migration to the CC chemokine CCL3 (MIP-1α) on human neutrophils through defined signalling pathways. Cell Signal. 2008, 20, 557–568. [Google Scholar] [CrossRef]
- Yang, C.-M.; Yang, C.-C.; Hsu, W.-H.; Hsiao, L.-D.; Tseng, H.-C.; Shih, Y.-F. Tumor necrosis factor-α-induced C-C motif chemokine ligand 20 expression through TNF receptor 1-dependent activation of EGFR/p38 MAPK and JNK1/2/FoxO1 or the NF-κB pathway in human cardiac fibroblasts. Int. J. Mol. Sci. 2022, 23, 9086. [Google Scholar] [CrossRef]
- Losana, G.; Bovolenta, C.; Rigamonti, L.; Borghi, I.; Altare, F.; Jouanguy, E.; Forni, G.; Casanova, J.-L.; Sherry, B.; Mengozzi, M.; et al. IFN-gamma and IL-12 differentially regulate CC-chemokine secretion and CCR5 expression in human T lymphocytes. J. Leukoc. Biol. 2002, 72, 735–742. [Google Scholar] [CrossRef]
- Geneva-Popova, M.G.; Popova-Belova, S.D.; Gardzheva, P.N.; Kraev, K.I. A Study of IFN-α-induced chemokines CCL2, CXCL10 and CCL19 in patients with systemic lupus erythematosus. Life 2022, 12, 251. [Google Scholar] [CrossRef]
- O’Gorman, M.T.; Jatoi, N.A.; Lane, S.J.; Mahon, B.P. IL-1β and TNF-α induce increased expression of CCL28 by airway epithelial cells via an NFkB-dependent pathway. Cell. Immunol. 2005, 238, 87–96. [Google Scholar] [CrossRef]
- Clark-Lewis, I.; Dewald, B.; Geiser, T.; Moser, B.; Baggiolini, M. Platelet factor 4 binds to interleukin 8 receptors and activates neutrophils when its N terminus is modified the Glu-Leu-Arg. Proc. Natl. Acad. Sci. USA 1993, 90, 3574–3577. [Google Scholar] [CrossRef]
- Maghazachi, A.A.; Al-Aoukaty, A.; Schall, T.J. CC chemokines induce the generation of killer cells from CD56+ cells. Eur. J. Immunol. 1996, 26, 315–319. [Google Scholar] [CrossRef]
- Sudhagar, A.; Kumar, G.; El-Matbouli, M. Transcriptome analysis based on RNA-seq in understanding pathogenic mechanisms of diseases and the immune system of fish: A Comprehensive review. Int. J. Mol. Sci. 2018, 19, 245. [Google Scholar] [CrossRef]
- Xiao, J.; Zhong, H.; Liu, Z.; Yu, F.; Luo, Y.; Gan, X.; Zhou, Y. Transcriptome analysis revealed positive selection of immune-related genes in tilapia. Fish Shellfish Immunol. 2015, 44, 60–65. [Google Scholar] [CrossRef]
- Zhu, J.; Fu, Q.; Ao, Q.; Tan, Y.; Luo, Y.; Jiang, H.; Li, C.; Gan, X. Transcriptomic profiling analysis of tilapia (Oreochromis niloticus) following Streptococcus agalactiae challenge. Fish Shellfish Immunol. 2017, 62, 202–212. [Google Scholar] [CrossRef]
- Cui, M.; Wang, Z.; Yang, Y.; Liu, R.; Wu, M.; Li, Y.; Zhang, Q.; Xu, D. Comparative transcriptomic analysis reveals the regulated expression profiles in Oreochromis niloticus in response to coinfection of Streptococcus agalactiae and Streptococcus iniae. Front. Genet. 2022, 13, 782957. [Google Scholar] [CrossRef]















Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Soontara, C.; Uchuwittayakul, A.; Kayansamruaj, P.; Amparyup, P.; Wongpanya, R.; Srisapoome, P. Adjuvant Effects of a CC Chemokine for Enhancing the Efficacy of an Inactivated Streptococcus agalactiae Vaccine in Nile Tilapia (Oreochromis niloticus). Vaccines 2024, 12, 641. https://doi.org/10.3390/vaccines12060641
Soontara C, Uchuwittayakul A, Kayansamruaj P, Amparyup P, Wongpanya R, Srisapoome P. Adjuvant Effects of a CC Chemokine for Enhancing the Efficacy of an Inactivated Streptococcus agalactiae Vaccine in Nile Tilapia (Oreochromis niloticus). Vaccines. 2024; 12(6):641. https://doi.org/10.3390/vaccines12060641
Chicago/Turabian StyleSoontara, Chayanit, Anurak Uchuwittayakul, Pattanapon Kayansamruaj, Piti Amparyup, Ratree Wongpanya, and Prapansak Srisapoome. 2024. "Adjuvant Effects of a CC Chemokine for Enhancing the Efficacy of an Inactivated Streptococcus agalactiae Vaccine in Nile Tilapia (Oreochromis niloticus)" Vaccines 12, no. 6: 641. https://doi.org/10.3390/vaccines12060641
APA StyleSoontara, C., Uchuwittayakul, A., Kayansamruaj, P., Amparyup, P., Wongpanya, R., & Srisapoome, P. (2024). Adjuvant Effects of a CC Chemokine for Enhancing the Efficacy of an Inactivated Streptococcus agalactiae Vaccine in Nile Tilapia (Oreochromis niloticus). Vaccines, 12(6), 641. https://doi.org/10.3390/vaccines12060641

