Efficacy of Feed-Based Genome-Free Bacterial Vaccine Against Aeromonas hydrophila Infection in Red Tilapia (Oreochromis sp.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of Bacteria
2.2. Feed-Based Vaccine Preparation
2.3. Fish Vaccination and Challenge Experiments
2.4. Immunological Assessments
2.5. Statistical Analysis
3. Results
3.1. Vaccines Efficacy and Comparison
3.2. Immune-Related Gene Expression
3.3. Serum Lysozyme Production
3.4. Immunoglobulin M (IgM) Production
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2024: Blue Transformation in Action; Food and Agriculture Organization of the United Nations: Rome, Italy, 2024. [Google Scholar]
- Shinn, A.P.; Avenant-Oldewage, A.; Bondad-Reantaso, M.G.; Cruz-Laufer, A.J.; García-Vásquez, A.; Hernández-Orts, J.S.; Kuchta, R.; Longshaw, M.; Metselaar, M.; Pariselle, A.; et al. A global review of problematic and pathogenic parasites of farmed tilapia. Rev. Aquac. 2023, 15, 92–153. [Google Scholar] [CrossRef]
- Abdel-Latif, H.M.R.; Khafaga, A. Natural co-infection of cultured Nile tilapia Oreochromis niloticus with Aeromonas hydrophila and Gyrodactylus cichlidarum experiencing high mortality during summer. Aquac. Res. 2020, 51, 1880–1892. [Google Scholar] [CrossRef]
- Sherif, A.H.; Kassab, A.S. Multidrug-resistant Aeromonas bacteria prevalence in Nile tilapia broodstock. BMC Microbiol. 2023, 23, 80. [Google Scholar] [CrossRef] [PubMed]
- Saleh, A.; Elkenany, R.; Younis, G. Virulent and multiple antimicrobial resistance Aeromonas hydrophila isolated from diseased Nile tilapia fish (Oreochromis niloticus) in Egypt with sequencing of some virulence-associated genes. Biocontrol Sci. 2021, 26, 167–176. [Google Scholar] [CrossRef]
- Chiew, I.K.M.; Salter, A.M.; Lim, Y.S. The significance of major viral and bacterial diseases in Malaysian aquaculture industry. Pertanika J. Trop. Agric. 2019, 42, 1023–1047. [Google Scholar]
- Stratev, D.; Odeyemi, O.A. An overview of motile Aeromonas septicaemia management. Aquac. Int. 2017, 25, 1095–1105. [Google Scholar] [CrossRef]
- Assis, G.B.N.; Tavares, G.C.; Pereira, F.L.; Figueiredo, H.C.P.; Leal, C.A.G. Natural coinfection by Streptococcus agalactiae and Francisella noatunensis subsp. orientalis in farmed Nile tilapia (Oreochromis niloticus L.). J. Fish Dis. 2017, 40, 51–63. [Google Scholar] [CrossRef]
- Laith, A.R.; Najiah, M. Aeromonas hydrophila: Antimicrobial susceptibility and histopathology of isolates from diseased catfish, Clarias gariepinus (Burchell). J. Aquac. Res. Dev. 2014, 5, 215. [Google Scholar]
- Haenen, O.L.; Dong, H.T.; Hoai, T.D.; Crumlish, M.; Karunasagar, I.; Barkham, T.; Chen, S.L.; Zadoks, R.; Kiermeier, A.; Wang, B.; et al. Bacterial diseases of tilapia, their zoonotic potential and risk of antimicrobial resistance. Rev. Aquac. 2023, 15, 154–185. [Google Scholar] [CrossRef]
- Mondal, H.; Thomas, J. A review on the recent advances and application of vaccines against fish pathogens in aquaculture. Aquac. Int. 2022, 30, 1971–2000. [Google Scholar] [CrossRef]
- Mohd Ali, N.S.; Saad, M.Z.; Azmai, M.N.A.; Salleh, A.; Zulperi, Z.M.; Manchanayake, T.; Zahaludin, M.A.D.; Basri, L.; Mohamad, A.; Md Yasin, I.S. Immunogenicity and efficacy of a feed-based bivalent vaccine against streptococcosis and motile aeromonad septicemia in red hybrid tilapia (Oreochromis sp.). Animals 2023, 13, 1346. [Google Scholar] [CrossRef]
- Ali, N.S.M.; Ngalimat, M.S.; Saad, M.Z.; Azmai, M.N.A.; Salleh, A.; Zulperi, Z.; Md Yasin, I.S. Expression of immuno-transcriptome response in red hybrid tilapia (Oreochromis sp.) hindgut following vaccination with feed-based bivalent vaccine. J. Fish Dis. 2024, 47, e13943. [Google Scholar] [CrossRef]
- Ridzuan, M.S.M.; Abdullah, A.; Ramly, R.; Mansor, N.N.; Ramli, N.; Firdaus-Nawi, M. Current status and advances of fish vaccines in Malaysia. Vet. World 2022, 15, 465–482. [Google Scholar] [CrossRef]
- Du, Y.; Hu, X.; Miao, L.; Chen, J. Current status and development prospects of aquatic vaccines. Front. Immunol. 2022, 13, 1040336. [Google Scholar] [CrossRef]
- Fan, C.; Davison, P.A.; Habgood, R.; Zeng, H.; Decker, C.M.; Gesell Salazar, M.; Lueangwattanapong, K.; Townley, H.E.; Yang, A.; Thompson, I.P.; et al. Chromosome-free bacterial cells are safe and programmable platforms for synthetic biology. Proc. Natl. Acad. Sci. USA 2020, 117, 6752–6761. [Google Scholar] [CrossRef]
- Lesterlin, C.; Ball, G.; Schermelleh, L.; Sherratt, D.J. RecA bundles mediate homology pairing between distant sisters during DNA break repair. Nature 2014, 506, 249–253. [Google Scholar] [CrossRef]
- Lim, B. Molecular Diagnosis of Infectious Disease and Cancer via Synthetic Biological Methods. Ph.D. Thesis, University of Oxford, Oxford, UK, 2021. [Google Scholar]
- Matusin, S. Molecular Characterization of Aeromonas hydrophila and Development of Recombinant Cells Vaccine Expressing Outer Membrane Proteins against Its in African Catfish (Clarias gariepinus Burchell). Master’s Thesis, Universiti Putra Malaysia, Serdang, Malaysia, 2015. [Google Scholar]
- Lim, B.; Yin, Y.; Ye, H.; Cui, Z.; Papachristodoulou, A.; Huang, W.E. Reprogramming synthetic cells for targeted cancer therapy. ACS Synth. Biol. 2022, 11, 1349–1360. [Google Scholar] [CrossRef] [PubMed]
- Yanez, M.A.; Catalán, V.; Apráiz, D.; Figueras, M.J.; Martínez-Murcia, A.J. Phylogenetic analysis of members of the genus Aeromonas based on gyrB gene sequences. Int. J. Syst. Evol. Microbiol. 2003, 53, 875–883. [Google Scholar] [CrossRef] [PubMed]
- Qiang, J.; He, J.; Yang, H.; Xu, P.; Habte-Tsion, H.M.; Ma, X.Y.; Zhu, Z.X. The changes in cortisol and expression of immune genes of GIFT tilapia Oreochromis niloticus (L.) at different rearing densities under Streptococcus iniae infection. Aquac. Int. 2016, 24, 1365–1378. [Google Scholar] [CrossRef]
- Yao, Y.Y.; Chen, D.D.; Cui, Z.W.; Zhang, X.Y.; Zhou, Y.Y.; Guo, X.; Li, A.H.; Zhang, Y.A. Oral vaccination of tilapia against Streptococcus agalactiae using Bacillus subtilis spores expressing Sip. Fish Shellfish Immunol. 2019, 86, 999–1008. [Google Scholar] [CrossRef]
- Lu, C.L.; Wangkahart, E.; Huang, J.W.; Huang, Y.X.; Huang, Y.; Cai, J.; Jian, J.C.; Wang, B. Immune response and protective efficacy of Streptococcus agalactiae vaccine coated with chitosan oligosaccharide for different immunization strategy in nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2024, 145, 109353. [Google Scholar] [CrossRef]
- Wrubel, R.P.; Krimsky, S.; Anderson, M.D. Regulatory oversight of genetically engineered. Environ. Manag. 1997, 21, 571–586. [Google Scholar] [CrossRef]
- Monir, M.S.; Yusoff, M.S.M.; Zamri-Saad, M.; Amal, M.N.A.; Mohamad, A.; Azzam-Sayuti, M.; Ina-Salwany, M.Y. Effect of an oral bivalent vaccine on immune response and immune gene profiling in vaccinated red tilapia (Oreochromis spp.) during infections with Streptococcus iniae and Aeromonas hydrophila. Biology 2022, 11, 1268. [Google Scholar] [CrossRef]
- Wangkahart, E.; Jumpalueang, S.; Ardprachan, S.; Phudkliang, J.; Sunthamala, P.; Pholchamat, S.; Qi, Z. Molecular characterization and expression analysis of novel interleukin-1 family member (nIL-1Fm) gene in Nile Tilapia (Oreochromis niloticus). J. Mar. Sci. Eng. 2022, 10, 1272. [Google Scholar] [CrossRef]
- Al-Qahtani, A.A.; Alhamlan, F.S.; Al-Qahtani, A.A. Pro-inflammatory and anti-inflammatory interleukins in infectious diseases: A comprehensive review. Trop. Med. Infect. 2024, 9, 13. [Google Scholar] [CrossRef]
- Linh, N.V.; Sangpo, P.; Senapin, S.; Thapinta, A.; Panphut, W.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Pre-treatment of Nile tilapia (Oreochromis niloticus) with ozone nanobubbles improve efficacy of heat-killed Streptococcus agalactiae immersion vaccine. Fish Shellfish Immunol. 2022, 123, 229–237. [Google Scholar] [CrossRef]
- Yang, M.J.; Xu, D.; Yang, D.X.; Li, L.; Peng, X.X.; Chen, Z.G.; Li, H. Malate enhances survival of zebrafish against Vibrio alginolyticus infection in the same manner as taurine. Virulence 2020, 11, 349–364. [Google Scholar] [CrossRef]
- Tanpichai, P.; Chaweepack, S.; Senapin, S.; Piamsomboon, P.; Wongtavatchai, J. Immune activation following vaccination of Streptococcus iniae bacterin in Asian seabass (Lates calcarifer, Bloch 1790). Vaccines 2023, 11, 351. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, Z.; Zhang, J.; Huang, Y.; Jian, J.; Cai, S. A live attenuated strain of HY9901ΔdctP provides protection against Vibrio alginolyticus to the pearl gentian grouper (♀Epinephelus fuscoguttatus × ♂Epinephelus lanceolatus). Front. Mar. Sci. 2022, 9, 907407. [Google Scholar] [CrossRef]
- Jiang, S.; Huang, X.; Li, T.; Zhang, Y.; Zhang, J. Immune response of large yellow croaker Larimichthys crocea towards a recombinant vaccine candidate targeting the parasitic ciliate Cryptocaryon irritans. Aquac. Int. 2023, 31, 3383–3402. [Google Scholar] [CrossRef]
- Gao, Y.; Tang, X.; Sheng, X.; Xing, J.; Zhan, W. Antigen uptake and expression of antigen presentation-related immune genes in flounder (Paralichthys olivaceus) after vaccination with an inactivated Edwardsiella tarda immersion vaccine, following hyperosmotic treatment. Fish Shellfish Immunol. 2016, 55, 274–280. [Google Scholar] [CrossRef]
- Wang, B.; Thompson, K.D.; Wangkahart, E.; Yamkasem, J.; Bondad-Reantaso, M.G.; Tattiyapong, P.; Jian, J.; Surachetpong, W. Strategies to enhance tilapia immunity to improve their health in aquaculture. Rev. Aquac. 2023, 15, 41–56. [Google Scholar] [CrossRef]
- Younis, N.A.; Thabit, H.; El-Samannoudy, S.I.; Attia, M.M. The immune responses of Oreochromis niloticus against Prohemistomum vivax encysted metacercariae infection with the evaluation of different biomarkers stressors. Sci. Rep. 2023, 13, 11885. [Google Scholar] [CrossRef] [PubMed]
- Velázquez, J.; Rodríguez, A.; Aragón, H.; Haidar, A.; González, M.; Valdés, R.; Garay, H.E.; Abreu, D.D.; Ramos, Y.; Cabrales, A.; et al. Monoclonal antibody against Nile tilapia (Oreochromis niloticus) IgM heavy chain: A valuable tool for detection and quantification of IgM and IgM+ cells. Fish Shellfish Immunol. 2021, 110, 44–54. [Google Scholar] [CrossRef] [PubMed]
- El-daim, A.; Abdel Gawad, E.A.; El Asely, A.M.; Abbass, A.A.; Shaheen, A.A. Immune responses and protective efficacy against streptococcosis following polyvalent inactivated vaccine injection in the Nile tilapia, Oreochromis niloticus. Egypt. J. Aquat. Biol. Fish. 2023, 27, 625–642. [Google Scholar] [CrossRef]
- Altun, S.; Kubilay, A.; Ekici, S.; BI, D.; Diler, O. Oral vaccination against lactococcosis in rainbow trout (Oncorhynchus mykiss) using sodium alginate and poly (lactide-co-glycolide) carrier. Kafkas Univ. Vet. Fak. Derg. 2010, 16, S211–S217. [Google Scholar]
- Chokmangmeepisarn, P.; Senapin, S.; Taengphu, S.; Thompson, K.D.; Srisapoome, P.; Uchuwittayakul, A.; Rodkhum, C. Protective efficiency and immune responses to single and booster doses of formalin-inactivated scale drop disease virus (SDDV) vaccine in Asian seabass (Lates calcarifer). BMC Vet. Res. 2024, 20, 267. [Google Scholar] [CrossRef]
Gene Name | Gene Description | Sequence (5′ to 3′) | GenBank Accession Number | PCR Efficiency (%) | R-Squared (R²) | Product Size (bp) | Ref. |
---|---|---|---|---|---|---|---|
IL-1β | A pro-inflammatory cytokine involved in early innate immune response | F: CAAGGATGACGACAAGCCAACC | XM_003460625.2 | 107.52 | 0.9828 | 149 | [22] |
R: AGCGGACAGACATGAGAGTGC | |||||||
MHCII | Play roles in adaptive immunity by helping to present antigens to CD4+ T lymphocytes | F: AGTGTGGGGAAGTTTGTTGGAT | JN967618.1 | 100.12 | 0.9846 | 207 | [23] |
R: ATGGTGACTGGAGAGAGGCG | |||||||
CD4 | A T-cell co-receptor that can be found on APCs associated with antigen recognition | F: TTCAGTGGCACTTTGCTCCTAA | XM031744220 | 98.88 | 0.9849 | 277 | [23] |
R: TGGGCGATGATTTCCAACA | |||||||
IgT | Play roles in the defense mechanisms against pathogens in the mucosal compartments | F: GTGTCTGGTCTCCAGTCGTG | KY499641 | 91.39 | 0.9784 | 169 | [24] |
R: TGTGCTCCACTTGTCCTTGG | |||||||
IgM | Play roles in host defense against pathogen infection | F: ACGAGGAAGCAGACTCAAGTTAT | XM_025906581.1 | 97.16 | 0.9975 | 175 | [23] |
R: ACAATAGCTCTAGTTGTGTTAACC | |||||||
ACTB | A highly conserved protein with the function of producing filaments that form cross-linked networks in the cell cytoplasm | F: CCACACAGTGCCCATCTACGA | EU887951.1 | 99.23 | 0.9835 | 111 | [22] |
R: CCACGCTCTGTCAGGATCTTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ali, N.S.M.; Ngalimat, M.S.; Lim, B.C.; Hsu, C.-C.; Salleh, A.; Nazarudin, M.F.; Yasin, I.S.M.; Azmai, M.N.A. Efficacy of Feed-Based Genome-Free Bacterial Vaccine Against Aeromonas hydrophila Infection in Red Tilapia (Oreochromis sp.). Vaccines 2024, 12, 1271. https://doi.org/10.3390/vaccines12111271
Ali NSM, Ngalimat MS, Lim BC, Hsu C-C, Salleh A, Nazarudin MF, Yasin ISM, Azmai MNA. Efficacy of Feed-Based Genome-Free Bacterial Vaccine Against Aeromonas hydrophila Infection in Red Tilapia (Oreochromis sp.). Vaccines. 2024; 12(11):1271. https://doi.org/10.3390/vaccines12111271
Chicago/Turabian StyleAli, Nur Shidaa Mohd, Mohamad Syazwan Ngalimat, Boon Chuan Lim, Chia-Chen Hsu, Annas Salleh, Muhammad Farhan Nazarudin, Ina Salwany Md Yasin, and Mohammad Noor Amal Azmai. 2024. "Efficacy of Feed-Based Genome-Free Bacterial Vaccine Against Aeromonas hydrophila Infection in Red Tilapia (Oreochromis sp.)" Vaccines 12, no. 11: 1271. https://doi.org/10.3390/vaccines12111271
APA StyleAli, N. S. M., Ngalimat, M. S., Lim, B. C., Hsu, C.-C., Salleh, A., Nazarudin, M. F., Yasin, I. S. M., & Azmai, M. N. A. (2024). Efficacy of Feed-Based Genome-Free Bacterial Vaccine Against Aeromonas hydrophila Infection in Red Tilapia (Oreochromis sp.). Vaccines, 12(11), 1271. https://doi.org/10.3390/vaccines12111271