Exogenous Alpha-Ketoglutaric Acid Alleviates the Rabbit Dermal Papilla Cell Oxidative Damage Caused by Hydrogen Peroxide Through the ERK/Nrf2 Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Cell Culture and Experimental Design
2.3. Cell Viability Assay
2.4. Determination of Antioxidant Enzyme Activity
2.5. ROS Assay
2.6. Mitochondrial Membrane Potential Assessment (Early Apoptosis Detection)
2.7. RNA Extraction and Quantification
2.8. Western Blotting
2.9. Data Statistics and Analysis
3. Results
3.1. AKG Alleviated H2O2-Induced Decrease in Cell Viability
3.2. AKG Reduced ROS Production
3.3. AKG Restores Mitochondrial Membrane Potential Impaired by Oxidative Stress
3.4. AKG Enhances Cellular Resistance to Apoptosis
3.5. AKG Downregulates Expression of Inflammatory Factors and Apoptotic Proteins
3.6. AKG Enhances Cellular Antioxidant Capacity
3.7. H2O2 Activates the Nrf2 Signaling Pathway
3.8. AKG Regulates Nrf2 Expression
3.9. H2O2 and AKG Perturb MAPK Signaling Pathway Dynamics
3.10. ERK1/2 Regulates Nrf2 Protein Expression
3.11. ERK1/2 Regulates ROS Generation
3.12. ERK1/2 Inhibitor Reduced Cell Viability
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sies, H.; Berndt, C.; Jones, D.P. Oxidative Stress. Annu. Rev. Biochem. 2017, 86, 715–748. [Google Scholar] [CrossRef] [Scilit]
- Rogers, L.K. Cellular targets of oxidative stress. Curr. Opin. Toxicol. 2020, 20–21, 48–54. [Google Scholar] [CrossRef] [Scilit]
- Dossena, S.; Marino, A. Cellular Oxidative Stress. Antioxidants 2021, 10, 399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S. From Challenge to Opportunity: Addressing Oxidative Stress in Animal Husbandry. Antioxidants 2023, 12, 1543. [Google Scholar] [CrossRef] [Scilit]
- Pintus, E.; Ros-Santaella, J.L. Impact of Oxidative Stress on Male Reproduction in Domestic and Wild Animals. Antioxidants 2021, 10, 1154. [Google Scholar] [CrossRef] [Scilit]
- Robinson, N.B.; Krieger, K.; Khan, F.M.; Huffman, W.; Chang, M.; Naik, A.; Yongle, R.; Hameed, I.; Krieger, K.; Girardi, L.N.; et al. The current state of animal models in research: A review. Int. J. Surg. 2019, 72, 9–13. [Google Scholar] [CrossRef] [Scilit]
- Susanti, L.; Mustarichie, R.; Halimah, E.; Kurnia, D.; Setiawan, A.; Maladan, Y. Anti-Alopecia Activity of Alkaloids Group from Noni Fruit against Dihydrotestosterone-Induced Male Rabbits and Its Molecular Mechanism: In Vivo and In Silico Studies. Pharmaceuticals 2022, 15, 1557. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.H.; Xu, J.H.; Ren, Q.C.; Duan, T.; Mo, F.; Zhang, W. Melatonin promotes secondary hair follicle development of early postnatal cashmere goat and improves cashmere quantity and quality by enhancing antioxidant capacity and suppressing apoptosis. J. Pineal Res. 2019, 67, e12569. [Google Scholar] [CrossRef] [Scilit]
- Du, F.; Li, J.; Zhang, S.; Zeng, X.; Nie, J.; Li, Z. Oxidative stress in hair follicle development and hair growth: Signalling pathways, intervening mechanisms and potential of natural antioxidants. J. Cell. Mol. Med. 2024, 28, e18486. [Google Scholar] [CrossRef] [Scilit]
- Ungvari, A.; Kiss, T.; Gulej, R.; Tarantini, S.; Csik, B.; Yabluchanskiy, A.; Mukli, P.; Csiszar, A.; Harris, M.L.; Ungvari, Z. Irradiation-induced hair graying in mice: An experimental model to evaluate the effectiveness of interventions targeting oxidative stress, DNA damage prevention, and cellular senescence. Geroscience 2024, 46, 3105–3122. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.Y.; Huang, Y.C.; Huang, K.S.; Chan, C.C.; Chiu, H.Y.; Tsai, R.Y.; Chan, J.Y.; Lin, S.J. Stress-induced premature senescence of dermal papilla cells compromises hair follicle epithelial-mesenchymal interaction. J. Dermatol. Sci. 2017, 86, 114–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, D.; Zeng, L.; Yao, K.; Kong, X.; Wu, G.; Yin, Y. The glutamine-alpha-ketoglutarate (AKG) metabolism and its nutritional implications. Amino Acids 2016, 48, 2067–2080. [Google Scholar] [CrossRef] [Scilit]
- Liu, G.; Lu, J.; Sun, W.; Jia, G.; Zhao, H.; Chen, X.; Wang, J. Alpha-ketoglutaric acid attenuates oxidative stress and modulates mitochondrial dynamics and autophagy of spleen in a piglet model of lipopolysaccharide-induced sepsis. Free Radic. Biol. Med. 2024, 214, 80–86. [Google Scholar] [CrossRef] [Scilit]
- Jia, Y.; Yin, C.; Ke, W.; Liu, J.; Guo, B.; Wang, X.; Zhao, P.; Hu, S.; Zhang, C.; Li, X.; et al. Alpha-ketoglutarate alleviates cadmium-induced inflammation by inhibiting the HIF1A-TNFAIP3 pathway in hepatocytes. Sci. Total Environ. 2023, 878, 163069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; He, L.; Yao, K. The Antioxidative Function of Alpha-Ketoglutarate and Its Applications. BioMed Res. Int. 2018, 2018, 3408467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baracco, E.E.; Castoldi, F.; Durand, S.; Enot, D.P.; Tadic, J.; Kainz, K.; Madeo, F.; Chery, A.; Izzo, V.; Maiuri, M.C.; et al. α-Ketoglutarate inhibits autophagy. Aging 2019, 11, 3418–3431. [Google Scholar] [CrossRef] [Scilit]
- Sheng, Y.; Liu, G.; Wang, M.; Lv, Z.; Du, P. A selenium polysaccharide from Platycodon grandiflorum rescues PC12 cell death caused by H2O2 via inhibiting oxidative stress. Int. J. Biol. Macromol. 2017, 104, 393–399. [Google Scholar] [CrossRef] [Scilit]
- Cheng, D.; Zhang, M.; Zheng, Y.; Wang, M.; Gao, Y.; Wang, X.; Liu, X.; Lv, W.; Zeng, X.; Belosludtsev, K.N.; et al. α-Ketoglutarate prevents hyperlipidemia-induced fatty liver mitochondrial dysfunction and oxidative stress by activating the AMPK-pgc-1α/Nrf2 pathway. Redox Biol. 2024, 74, 103230. [Google Scholar] [CrossRef] [Scilit]
- Ward, J.F.; Evans, J.W.; Limoli, C.L.; Calabro-Jones, P.M. Radiation and hydrogen peroxide induced free radical damage to DNA. Br. J. Cancer Suppl. 1987, 8, 105–112. [Google Scholar]
- Havens, C.G.; Ho, A.; Yoshioka, N.; Dowdy, S.F. Regulation of late G1/S phase transition and APC Cdh1 by reactive oxygen species. Mol. Cell. Biol. 2006, 26, 4701–4711. [Google Scholar] [CrossRef] [Scilit]
- Heo, S.; Kim, S.; Kang, D. The Role of Hydrogen Peroxide and Peroxiredoxins throughout the Cell Cycle. Antioxidants 2020, 9, 280. [Google Scholar] [CrossRef] [Scilit]
- Ransy, C.; Vaz, C.; Lombès, A.; Bouillaud, F. Use of H2O2 to Cause Oxidative Stress, the Catalase Issue. Int. J. Mol. Sci. 2020, 21, 9149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, T.; Sun, L.; Zhang, Y.; Wang, Y.; Zheng, J. Imbalanced GSH/ROS and sequential cell death. J. Biochem. Mol. Toxicol. 2022, 36, e22942. [Google Scholar] [CrossRef] [Scilit]
- An, D.; Zeng, Q.; Zhang, P.; Ma, Z.; Zhang, H.; Liu, Z.; Li, J.; Ren, H.; Xu, D. Alpha-ketoglutarate ameliorates pressure overload-induced chronic cardiac dysfunction in mice. Redox Biol. 2021, 46, 102088. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Xiao, X.; Wang, L.; Fu, Y.; Yao, S.; Liu, X.; Chen, B.; Gao, J.; Zhai, Y.; Shen, Z.; et al. The dose-dependent dual effects of alpha-ketoglutarate (AKG) on cumulus oocyte complexes during in vitro maturation. Cell Commun. Signal. 2024, 22, 472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaweł, S.; Wardas, M.; Niedworok, E.; Wardas, P. Malondialdehyde (MDA) as a lipid peroxidation marker. Wiad. Lek. 2004, 57, 453–455. [Google Scholar]
- Kroemer, G.; Dallaporta, B.; Resche-Rigon, M. The mitochondrial death/life regulator in apoptosis and necrosis. Annu. Rev. Physiol. 1998, 60, 619–642. [Google Scholar] [CrossRef] [Scilit]
- Fan, T.J.; Han, L.H.; Cong, R.S.; Liang, J. Caspase family proteases and apoptosis. Acta Biochim. Biophys. Sin. 2005, 37, 719–727. [Google Scholar] [CrossRef] [Scilit]
- Czabotar, P.E.; Garcia-Saez, A.J. Mechanisms of BCL-2 family proteins in mitochondrial apoptosis. Nat. Rev. Mol. Cell Biol. 2023, 24, 732–748. [Google Scholar] [CrossRef] [Scilit]
- Peña-Blanco, A.; García-Sáez, A.J. Bax, Bak and beyond-mitochondrial performance in apoptosis. FEBS J. 2018, 285, 416–431. [Google Scholar] [CrossRef] [Scilit]
- Song, J.; Guo, D.; Bi, H. Chlorogenic acid attenuates hydrogen peroxide-induced oxidative stress in lens epithelial cells. Int. J. Mol. Med. 2018, 41, 765–772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bibo-Verdugo, B.; Salvesen, G.S. Caspase mechanisms in the regulation of inflammation. Mol. Asp. Med. 2022, 88, 101085. [Google Scholar] [CrossRef] [Scilit]
- Ma, L.; Liu, J.; Liu, A.; Wang, Y. Cytoprotective effect of selenium polysaccharide from Pleurotus ostreatus against H2O2-induced oxidative stress and apoptosis in PC12 cells. Arab. J. Chem. 2022, 15, 103686. [Google Scholar] [CrossRef] [Scilit]
- Oberst, A.; Dillon, C.P.; Weinlich, R.; McCormick, L.L.; Fitzgerald, P.; Pop, C.; Hakem, R.; Salvesen, G.S.; Green, D.R. Catalytic activity of the caspase-8–FLIPL complex inhibits RIPK3-dependent necrosis. Nature 2011, 471, 363–367. [Google Scholar] [CrossRef] [Scilit]
- Kaiser, W.J.; Upton, J.W.; Long, A.B.; Livingston-Rosanoff, D.; Daley-Bauer, L.P.; Hakem, R.; Caspary, T.; Mocarski, E.S. RIP3 mediates the embryonic lethality of caspase-8-deficient mice. Nature 2011, 471, 368–372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Turner, M.D.; Nedjai, B.; Hurst, T.; Pennington, D.J. Cytokines and chemokines: At the crossroads of cell signalling and inflammatory disease. Biochim. Et Biophys. Acta-Mol. Cell Res. 2014, 1843, 2563–2582. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, T.; Narazaki, M.; Kishimoto, T. IL-6 in inflammation, immunity, and disease. Cold Spring Harb. Perspect. Biol. 2014, 6, a016295. [Google Scholar] [CrossRef] [Scilit]
- Jadoon, S.; Malik, A. A review article on the formation, mechanism and biochemistry of MDA and MDA as a biomarker of oxidative stress. Int. J. Adv. Res. 2017, 5, 811–818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Si, X.; Jia, H.; Liu, N.; Li, J.; Pan, L.; Wang, J.; Wu, Z. Alpha-Ketoglutarate Attenuates Colitis in Mice by Increasing Lactobacillus Abundance and Regulating Stem Cell Proliferation via Wnt-Hippo Signaling. Mol. Nutr. Food Res. 2022, 66, e2100955. [Google Scholar] [CrossRef] [Scilit]
- Cao, Y.; Feng, Z.; Hoos, A.; Klimberg, V.S. Glutamine enhances gut glutathione production. JPEN J. Parenter. Enter. Nutr. 1998, 22, 224–227. [Google Scholar] [CrossRef] [Scilit]
- Borgstahl, G.E.O.; Oberley-Deegan, R.E. Superoxide Dismutases (SODs) and SOD Mimetics. Antioxidants 2018, 7, 156. [Google Scholar] [CrossRef] [Scilit]
- He, R.; Wei, Y.; Peng, Z.; Yang, J.; Zhou, Z.; Li, A.; Wu, Y.; Wang, M.; Li, X.; Zhao, D.; et al. α-Ketoglutarate alleviates osteoarthritis by inhibiting ferroptosis via the ETV4/SLC7A11/GPX4 signaling pathway. Cell. Mol. Biol. Lett. 2024, 29, 88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ross, D.; Siegel, D. The diverse functionality of NQO1 and its roles in redox control. Redox Biol. 2021, 41, 101950. [Google Scholar] [CrossRef] [Scilit]
- Covas, G.; Marinho, H.S.; Cyrne, L.; Antunes, F. Activation of Nrf2 by H2O2: De novo synthesis versus nuclear translocation. Methods Enzym. 2013, 528, 157–171. [Google Scholar] [CrossRef] [Scilit]
- Ishii, T.; Warabi, E.; Mann, G.E. Mechanisms underlying Nrf2 nuclear translocation by non-lethal levels of hydrogen peroxide: p38 MAPK-dependent neutral sphingomyelinase2 membrane trafficking and ceramide/PKCζ/CK2 signaling. Free Radic. Biol. Med. 2022, 191, 191–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fourquet, S.; Guerois, R.; Biard, D.; Toledano, M.B. Activation of NRF2 by nitrosative agents and H2O2 involves KEAP1 disulfide formation. J. Biol. Chem. 2010, 285, 8463–8471. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Lv, Y.-F.; Zhao, J.-L.; You, Q.-D.; Jiang, Z.-Y. Regulation of Nrf2 by phosphorylation: Consequences for biological function and therapeutic implications. Free Radic. Biol. Med. 2021, 168, 129–141. [Google Scholar] [CrossRef] [Scilit]
- Cheng, D.; Liu, X.; Gao, Y.; Cui, L.; Wang, M.; Zheng, Y.; Lv, W.; Zhao, L.; Liu, J. α-Ketoglutarate Attenuates Hyperlipidemia-Induced Endothelial Damage by Activating the Erk-Nrf2 Signaling Pathway to Inhibit Oxidative Stress and Mitochondrial Dysfunction. Antioxid. Redox Signal. 2023, 39, 777–793. [Google Scholar] [CrossRef] [Scilit]
- Wong, S.Y.; Tan, M.G.K.; Wong, P.T.H.; Herr, D.R.; Lai, M.K.P. Andrographolide induces Nrf2 and heme oxygenase 1 in astrocytes by activating p38 MAPK and ERK. J. Neuroinflammation 2016, 13, 251. [Google Scholar] [CrossRef] [Scilit]
- Qi, Z.; Ci, X.; Huang, J.; Liu, Q.; Yu, Q.; Zhou, J.; Deng, X. Asiatic acid enhances Nrf2 signaling to protect HepG2 cells from oxidative damage through Akt and ERK activation. Biomed. Pharmacother. 2017, 88, 252–259. [Google Scholar] [CrossRef] [Scilit] [PubMed]












| Gene | Sequences (5′→3′) | Accession No. | Product Size/bp |
|---|---|---|---|
| Keap1 | F: CCTCAACCGCCTGCTCTATGC R: ATCCGCCACTCGTTCCTCTCC | XM_008251549.4 | 96 |
| Nrf2 | F: AAGCAACTCAGCACCTTGTATCTGG R: GAATACATTGCCGTCCCTCGTCTG | XM_051849400.2 | 114 |
| NQO1 | F: AGCGGCTCCATGTACTCTCTCC R: GGAGTGTGCCCGATGCTGTATG | XM_070062671.1 | 137 |
| Cas3 | F: CTAAGCCACGGTGATGAAGGAGTC R: CACTGTCTGTCTCGATGCCACTG | NM_001354777.2 | 175 |
| Cas8 | F: CTGTCCAGGGGAGCCAGTGAG R: GCGGTGTCTGGGCATTTCTCTC | XM_051849294.2 | 136 |
| ALP | F: TGCACAGAGCAAGAGAAGGA R: TCTCCCAGGAACAGGATGAC | XM_017346489.1 | 146 |
| GPX4 | F: CAGGAGAACGCCAAGAATGAGGAG R: GTTCACCTCGCACTTCTGGAAGAG | NM_001085444.1 | 105 |
| SOD | F: TTTCTGGACAAACCTGAGCCCTAAC R: CCGTCAGCCTCTCCTTGAACTTG | XM_051854201.1 | 110 |
| CAT | F: CAGCCAGCGACCAGATGAAGAAG R: CTGCCGTGATGATGTTCAGTTTGTC | XM_002709045.4 | 114 |
| Bcl2 | F: GTTCGGTGGGGTCATGTGTGTG R: AGGTGCCGGTTCAGGTACTCAG | XM_008261439.3 | 99 |
| Bax | F: TATGGGCTGGACGCTGGACTTC R: AGATGGTGAGTGAGGCGGTGAG | XM_002723696.4 | 155 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Li, S.; Chen, J.; Liu, L.; Li, F. Exogenous Alpha-Ketoglutaric Acid Alleviates the Rabbit Dermal Papilla Cell Oxidative Damage Caused by Hydrogen Peroxide Through the ERK/Nrf2 Signaling Pathway. Antioxidants 2025, 14, 455. https://doi.org/10.3390/antiox14040455
Wang X, Li S, Chen J, Liu L, Li F. Exogenous Alpha-Ketoglutaric Acid Alleviates the Rabbit Dermal Papilla Cell Oxidative Damage Caused by Hydrogen Peroxide Through the ERK/Nrf2 Signaling Pathway. Antioxidants. 2025; 14(4):455. https://doi.org/10.3390/antiox14040455
Chicago/Turabian StyleWang, Xiaosong, Shu Li, Jiali Chen, Lei Liu, and Fuchang Li. 2025. "Exogenous Alpha-Ketoglutaric Acid Alleviates the Rabbit Dermal Papilla Cell Oxidative Damage Caused by Hydrogen Peroxide Through the ERK/Nrf2 Signaling Pathway" Antioxidants 14, no. 4: 455. https://doi.org/10.3390/antiox14040455
APA StyleWang, X., Li, S., Chen, J., Liu, L., & Li, F. (2025). Exogenous Alpha-Ketoglutaric Acid Alleviates the Rabbit Dermal Papilla Cell Oxidative Damage Caused by Hydrogen Peroxide Through the ERK/Nrf2 Signaling Pathway. Antioxidants, 14(4), 455. https://doi.org/10.3390/antiox14040455

