The Significant Enhancing Effect of Vitamin B6-Fortified Feed on the Intestinal Digestive Efficiency, Immunity, and Antioxidant Defense Mechanisms of Juvenile Largemouth Bass (Micropterus salmoides)
Abstract
1. Introduction
2. Materials and Methods
2.1. Diet Preparation
2.2. Experimental Procedure
2.3. Sample Collection
2.4. Chemical Analysis
2.5. RNA Extraction and Real-Time PCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Activities of Intestinal Digestive Enzymes and Brush Border Enzymes, and Relative Expression of mRNA for Related Genes
3.2. Relative Expression of mRNA for Intestinal Tight Junction Proteins Genes and Immune-Related Genes
3.3. Activities of Antioxidant-Related Enzymes, the Levels of T-AOC, GSH, and MDA, and Relative Expression of mRNA for Antioxidant-Related Genes
4. Discussion
4.1. Effect of Vitamin B6 on Intestinal Digestibility of Largemouth Bass
4.2. Effect of Vitamin B6 on Intestinal Immunity of Largemouth Bass
4.3. Effect of Vitamin B6 on Intestinal Antioxidant Capacity of Largemouth Bass
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, Y.; Chen, Z.; Dai, J.; Yang, P.; Xu, W.; Ai, Q.; Zhang, W.; Zhang, Y.; Zhang, Y. Sodium butyrate supplementation in high-soybean meal diets for turbot (Scophthalmus maximus L.): Effects on inflammatory status, mucosal barriers and microbiota in the intestine. Fish Shellfish Immunol. 2019, 88, 65–75. [Google Scholar] [CrossRef]
- Mccracken, V.; Lorenz, R. The gastrointestinal ecosystem: A precarious alliance among epithelium, immunity and microbiota. Cell. Microbiol. 2001, 3, 1–11. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, D.; Nelson, L.; Huang, F.; Warner, B. Intestinal Adaptation: Structure, Function, and Regulation. Semin. Pediatr. Surg. 2001, 10, 56–64. [Google Scholar] [CrossRef]
- Li, P.; Hou, D.; Zhao, H.; Peng, K.; Chen, B.; Guo, H.; Cao, J. Effects of dietary arginine levels on intestinal morphology, digestive enzyme activity, antioxidant capacity and intestinal flora of hybrid snakehead (Channa maculata ♀ × Channa argus ♂). Aquacult. Rep. 2022, 25, 101244. [Google Scholar] [CrossRef]
- Suzuki, T. Regulation of the intestinal barrier by nutrients: The role of tight junctions. Anim. Sci. J. 2020, 91, e13357. [Google Scholar] [CrossRef] [PubMed]
- An, J.; Liu, Y.; Wang, Y.; Fan, R.; Hu, X.; Zhang, F.; Yang, J.; Chen, J. The Role of Intestinal Mucosal Barrier in Autoimmune Disease: A Potential Target. Front. Immunol. 2022, 13, 871713. [Google Scholar] [CrossRef]
- Gómez Atria, D.; Sunyer, J.; Salinas, I. The mucosal immune system of fish: The evolution of tolerating commensals while fighting pathogens. Fish Shellfish Immunol. 2013, 35, 1729–1739. [Google Scholar] [CrossRef]
- Bogard, J.R.; Farmery, A.K.; Little, D.C.; Fulton, E.A.; Cook, M. Will fish be part of future healthy and sustainable diets? Lancet Planet. Health 2019, 3, e159–e160. [Google Scholar] [CrossRef]
- Duan, Y.; Zhang, Y.; Dong, H.; Yun, W.; Zhang, J. Effect of the dietary probiotic Clostridium butyricum on growth, intestine antioxidant capacity and resistance to high temperature stress in kuruma shrimp Marsupenaeus japonicus. J. Therm. Biol. 2017, 66, 93–100. [Google Scholar] [CrossRef]
- Dawood, M.; Koshio, S. Application of fermentation strategy in aquafeed for sustainable aquaculture. Rev. Aquac. 2019, 12, 987–1002. [Google Scholar] [CrossRef]
- Gao, S.; Zhao, X.; Niu, B.; Chang, K.; Chen, W. Dietary Sodium Butyrate Supplementation Attenuates the Detrimental Effects of High-Fat Diets on Growth Performance, Liver Health, and Disease Resistance in Grass Carp. N. Am. J. Aquac. 2022, 84, 392–401. [Google Scholar] [CrossRef]
- Zhao, Y.; Yan, M.; Jiang, Q.; Yin, L.; Zhou, X.; Feng, L.; Liu, Y.; Jiang, W.; Wu, P.; Zhao, J.; et al. Isoleucine improved growth performance, and intestinal immunological and physical barrier function of hybrid catfish Pelteobagrus vachelli × Leiocassis longirostris. Fish Shellfish Immunol. 2020, 109, 20–33. [Google Scholar] [CrossRef] [PubMed]
- Yu, C.; Zhang, J.; Qin, Q.; Liu, J.; Xu, J.; Xu, W. Berberine improved intestinal barrier function by modulating the intestinal microbiota in blunt snout bream (Megalobrama amblycephala) under dietary high-fat and high-carbohydrate stress. Fish Shellfish Immunol. 2020, 102, 336–349. [Google Scholar] [CrossRef]
- Liu, B.; Zhou, Q.; Miao, L.; Liang, H.; Sun, C.; Zheng, X.; Lin, Y.; Ren, M.; Zhu, L.; Ge, X. Research progress in nutrition and immunity of aquatic animals. J. Fish. China 2022, 46, 1761–1775. [Google Scholar] [CrossRef]
- Fan, Y.; Pedersen, O. Gut microbiota in human metabolic health and disease. Nat. Rev. Microbiol. 2020, 19, 55–71. [Google Scholar] [CrossRef]
- Yang, L.; Xu, H.; Liu, C.; Wang, G.; Ai, Y.; Jiang, W.; Luo, Q.; Li, H.; Luo, L.; Xiang, X. Effects of vitamin C on the structure and function of the digestive system of Andrias davidianus. J. Fish. China 2023, 47, 109614. [Google Scholar] [CrossRef]
- Mitra, G.; Mukhopadhyay, P.K.M.; Ayyappan, S. Modulation of digestive enzyme activities during ontogeny of Labeo rohita larvae fed ascorbic acid enriched zooplankton. Comp. Biochem. Physiol.—Part A Mol. Integr. Physiol. 2008, 149, 341–350. [Google Scholar] [CrossRef]
- Priyadarsani, L.; Abraham, T.J.; Adikesavalu, H.; Dash, G.; Talagunda Srinivasan, N. Effects of dietary supplementation of vitamin-E and commercial probiotics on the innate immunity of Labeo rohita against Aeromonas hydrophila infection. Fish Shellfish. Immunol. Rep. 2021, 2, 100013. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Zhang, S.; Du, T.; Yang, Q.; Chi, S.; Liu, H.; Yang, Y.; Dong, X.; Tan, B. Effects of dietary vitamin E on growth, immunity and oxidation resistance related to the Nrf2/Keap1 signaling pathway in juvenile Sillago sihama. Anim. Feed Sci. Technol. 2020, 262, 114403. [Google Scholar] [CrossRef]
- Giri, N.; Teshima, S.; Kanazawa, A.; Ishikawa, M. Effects of dietary pyridoxine and protein levels on growth, vitamin B6 content, and free amino acid profile of juvenile Penaeus japonicus. Aquaculture 1997, 157, 263–275. [Google Scholar] [CrossRef]
- Shiau, S.; Wu, M. Dietary vitamin B 6 requirement of grass shrimp, Penaeus monodon. Aquaculture 2003, 225, 397–404. [Google Scholar] [CrossRef]
- Zehra, S.; Khan, M. Dietary pyridoxine requirement of fingerling Channa punctatus (Bloch) based on growth performance, liver pyridoxine concentration and carcass composition. J. Appl. Aquac. 2018, 30, 238–255. [Google Scholar] [CrossRef]
- Javanmardi, S.; Rezaei Tavabe, K.; Rosentrater, K.; Solgi, M.; Bahadori, R. Effects of different levels of vitamin B6 in tank water on the Nile tilapia (Oreochromis niloticus): Growth performance, blood biochemical parameters, intestine and liver histology, and intestinal enzyme activity. Fish Physiol. Biochem. 2020, 46, 1909–1920. [Google Scholar] [CrossRef]
- Huang, Q.; Lin, H.; Wang, R.; Huang, Z.; Zhou, C.; Yu, W.; Xun, P.; Tan, L.; Wang, Y.; Wang, J. Effect of dietary vitamin B6 supplementation on growth and intestinal microflora of juvenile golden pompano (Trachinotus ovatus). Aquac. Res. 2019, 50, 2359–2370. [Google Scholar] [CrossRef]
- Zheng, X.; Feng, L.; Jiang, W.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.; Tang, L.; Tang, W.; Zhang, Y.; et al. Dietary pyridoxine deficiency reduced growth performance and impaired intestinal immune function associated with TOR and NF-κB signaling of young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2017, 70, 682–700. [Google Scholar] [CrossRef]
- Shan, M.R.; Zhou, S.N.; Fu, C.N.; Song, J.W.; Wang, X.Q.; Bai, W.; Li, P.; Song, P.; Zhu, M.; Ma, Z.M.; et al. Vitamin B6 inhibits macrophage activation to prevent lipopolysaccharide-induced acute pneumonia in mice. J. Cell. Mol. Med. 2020, 24, 3139–3148. [Google Scholar] [CrossRef]
- Hu, K.; He, W.; Feng, L.; Jiang, J.; Liu, Y.; Jiang, W.; Li, S.H.; Zhou, X.Q. Effects of pyridoxine on antioxidative parameters in juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Nutr. 2010, 17, e226–e232. [Google Scholar] [CrossRef]
- Taysi, S. Oxidant/antioxidant status in liver tissue of vitamin B6 deficient rats. Clin. Nutr. 2005, 24, 385–389. [Google Scholar] [CrossRef]
- Huang, D.; Wu, Y.; Lin, Y.; Chen, J.; Karrow, N.; Xing, R.; Wang, Y. Dietary Protein and Lipid Requirements for Juvenile Largemouth Bass, Micropterus salmoides. J. World Aquac. Soc. 2017, 48, 782–790. [Google Scholar] [CrossRef]
- Rahman, M.; Li, X.; He, M.; Poolsawat, L.; Yang, H.; Leng, X. Dietary threonine requirement of juvenile largemouth bass, Micropterus salmoides. Aquaculture 2021, 543, 736884. [Google Scholar] [CrossRef]
- Yusuf, A.; Huang, X.; Chen, N.; Apraku, A.; Wang, W.; Cornel, A.; Rahman, M. Impact of dietary vitamin c on plasma metabolites, antioxidant capacity and innate immunocompetence in juvenile largemouth bass, Micropterus salmoides. Aquac. Rep. 2020, 17, 100383. [Google Scholar] [CrossRef]
- Wang, Y. Changing paradigms in fish nutrition and feed research using largemouth bass and greater amberjack as examples. J. Fish. China 2024, 48, 222–240. [Google Scholar] [CrossRef]
- Ministry of Agriculture of the People’s Republic of China. Chinese Fisheries Yearbook; Chinese Agricultural Press: Beijing, China, 2024. [Google Scholar]
- Gu, J.; Liang, H.; Ge, X.; Xia, D.; Pan, L.; Mi, H.; Ren, M. A study of the potential effect of yellow mealworm (Tenebrio molitor) substitution for fish meal on growth, immune and antioxidant capacity in juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2021, 120, 214–221. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Liang, H.; Ge, X.; Zhu, J.; Wang, Y.; Ren, M.; Chen, X. Dietary chlorella (Chlorella vulgaris) supplementation effectively improves body color, alleviates muscle inflammation and inhibits apoptosis in largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2022, 127, 140–147. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Liang, H.; Ge, X.; Zhu, J.; Li, S.; Wang, Y.; Ren, M.; Chen, X. Effects of Dietary Lysine Levels on Growth Performance and Glycolipid Metabolism via the AKT/FoxO1 Pathway in Juvenile Largemouth Bass, Micropterus salmoides. Aquac. Nutr. 2022, 2022, 1372819. [Google Scholar] [CrossRef]
- Ren, M.; Liao, Y.; Xie, J.; Bo, L.; Zhou, Q.; Ge, X.; Cui, H.; Pan, L.; Chen, R. Dietary arginine requirement of juvenile blunt snout bream, Megalobrama amblycephala. Aquaculture 2013, 414–145, 229–234. [Google Scholar] [CrossRef]
- Shao, M.; Liang, H.; Xu, G.; Zhu, J.; Li, S.; Ren, M. Dietary leucine supplementation improves growth performance, metabolic responses of liver via GCN2/ATF4, and insulin signaling pathways in largemouth bass (Micropterus salmoides). Fish Physiol. Biochem. 2022, 50, 331–347. [Google Scholar] [CrossRef]
- Yang, P.; Wang, W.; Chi, S.; Mai, K.; Song, F.; Wang, L. Effects of dietary lysine on regulating GH-IGF system, intermediate metabolism and immune response in largemouth bass (Micropterus salmoides). Aquac. Rep. 2020, 17, 100323. [Google Scholar] [CrossRef]
- Kuz Mina, V. Specific Features of Nutrient Transport in the Digestive Tract of Fish. J. Evol. Biochem. Physiol. 2021, 57, 175–184. [Google Scholar] [CrossRef]
- Shan, X.; Xiao, Z.; Huang, W.; Dou, S. Effects of photoperiod on growth, mortality and digestive enzymes in miiuy croaker larvae and juveniles. Aquaculture 2008, 281, 70–76. [Google Scholar] [CrossRef]
- Moraes, G.; Almeida, L. Nutrition and functional aspects of digestion in fish. In Biology and Physiology of Freshwater Neotropical Fish; Academic Press: Cambridge, MA, USA, 2020; pp. 251–271. ISBN 9780128158722. [Google Scholar]
- Xu, C.; Huang, X.; Guan, J.; Chen, Z.; Ma, Y.; Xie, D.; Ning, L.; Li, Y. Effects of dietary leucine and valine levels on growth performance, glycolipid metabolism and immune response in Tilapia GIFT Oreochromis niloticus. Fish Shellfish Immunol. 2022, 121, 395–403. [Google Scholar] [CrossRef] [PubMed]
- Williams, M. Vitamin B6 and Amino Acids—Recent Research in Animals. Vitam. Horm. 1964, 22, 561–579. [Google Scholar] [CrossRef] [PubMed]
- Sauberlich, H. Vitamin B-6 Status Assessment: Past and Present. In Methods in Vitamin B-6 Nutrition; Springer: Berlin/Heidelberg, Germany, 1981; pp. 203–239. [Google Scholar] [CrossRef]
- Tang, L.; Feng, L.; Sun, C.; Chen, G.; Jiang, W.; Hu, K.; Liu, Y.; Jiang, J.; Li, S.; Kuang, S.; et al. Effect of tryptophan on growth, intestinal enzyme activities and TOR gene expression in juvenile Jian carp (Cyprinus carpio var. Jian): Studies in vivo and in vitro. Aquaculture 2013, 412–413, 23–33. [Google Scholar] [CrossRef]
- Hakim, Y.; Harpaz, S.; Uni, Z. Expression of brush border enzymes and transporters in the intestine of European sea bass (Dicentrarchus labrax) following food deprivation. Aquaculture 2009, 290, 110–115. [Google Scholar] [CrossRef]
- Poritz, L.; Garver, K.; Tilberg, A.; Koltun, W. Tumor necrosis factor alpha disrupts tight junction assembly. J. Surg. Res. 2004, 116, 14–18. [Google Scholar] [CrossRef]
- Li, X.; Akhtar, S.; Choudhry, M. Alteration in intestine tight junction protein phosphorylation and apoptosis is associated with increase in IL-18 levels following alcohol intoxication and burn injury. Biochim. Biophys. Acta 2012, 1822, 196–203. [Google Scholar] [CrossRef]
- Zhao, L.; Liang, J.; Chen, F.; Tang, X.; Liao, L.; Liu, Q.; Luo, J.; Du, Z.; Li, Z.; Luo, W.; et al. High carbohydrate diet induced endoplasmic reticulum stress and oxidative stress, promoted inflammation and apoptosis, impaired intestinal barrier of juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2021, 119, 308–317. [Google Scholar] [CrossRef]
- Liu, C.; Zhu, X.; Wang, M.; Zhang, J.; Cai, Q.; Xu, Z.; Ren, D.; Li, H. Pancreatin on Growth Performance, Liver, and Intestinal Health of Juvenile Largemouth Bass (Micropterus salmoides). Acta Hydrobiol. Sin. 2024, 48, 1993–2005. [Google Scholar] [CrossRef]
- Calder, P.; Carr, A.; Gombart, A.; Eggersdorfer, M. Optimal Nutritional Status for a Well-Functioning Immune System Is an Important Factor to Protect against Viral Infections. Nutrients 2020, 12, 1181. [Google Scholar] [CrossRef]
- Jung, Y.; Wen, T.; Mingler, M.; Caldwell, J.; Wang, Y.H.; Chaplin, D.; Lee, E.; Jang, M.; Woo, S.; Seoh, J.; et al. IL-1β in eosinophil-mediated small intestinal homeostasis and IgA production. Mucosal Immunol. 2015, 8, 930–942. [Google Scholar] [CrossRef]
- Yanaka, N.; Koyama, T.; Komatsu, S.; Nakamura, E.; Kanda, M.; Kato, N. Vitamin B6 suppresses NF-κB activation in LPS-stimulated mouse macrophages. Int. J. Mol. Med. 2006, 16, 1071–1075. [Google Scholar] [CrossRef]
- Dolinger, M.; Spencer, E.; Lai, J.; Dunkin, D.; Dubinsky, M. Dual Biologic and Small Molecule Therapy for the Treatment of Refractory Pediatric Inflammatory Bowel Disease. Inflamm. Bowel Dis. 2020, 27, 1210–1214. [Google Scholar] [CrossRef]
- Hering, N.; Fromm, M.; Schulzke, J. Determinants of colonic barrier function in inflammatory bowel disease and potential therapeutics. J. Physiol. 2012, 590, 1035–1044. [Google Scholar] [CrossRef]
- Tokes, A.; Schaff, Z.; Szász, A.; Kulka, J. The Distribution of Tight Junctions and Junctional Proteins in the Human Body. In Tight Junctions in Cancer Metastasis; Springer: Berlin/Heidelberg, Germany, 2013; Volume 19, pp. 29–64. ISBN 978-94-007-6027-1. [Google Scholar]
- Feng, L.; He, W.; Jiang, J.; Liu, Y.; Zhou, X.Q. Effects of dietary pyridoxine on disease resistance, immune responses and intestinal microflora in juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Nutr. 2010, 16, 254–261. [Google Scholar] [CrossRef]
- Pilström, L.; Bengten, E. Immunoglobulin in fish—Genes, expression and structure. Fish Shellfish Immunol. 1996, 6, 243–262. [Google Scholar] [CrossRef]
- Doñate, C.; Roher, N.; Balasch, J.; Ribas, L.; Goetz, F.; Planas, J.; Mackenzie, S. CD83 expression in sea bream macrophages is a marker for the LPS-induced inflammatory response. Fish Shellfish Immunol. 2007, 23, 877–885. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Ju, X.; Silveira, P.; Abadir, E.; Hsu, W.; Hart, D.; Clark, G. CD83: Activation Marker for Antigen Presenting Cells and Its Therapeutic Potential. Front. Immunol. 2019, 10, 1312. [Google Scholar] [CrossRef]
- Wei, L.L. Effects of Vitamin B6 Deficiency on Lymphoid Tissues and Humoral Immune Response in Rats (Immunity, Pyridoxine). Doctoral Dissertation, Purdue University, West Lafayette, IN, USA, 1986. [Google Scholar]
- Bai, K.; Huang, Q.; Zhang, J.; He, J.; Zhang, L.; Wang, T. Supplemental effects of probiotic Bacillus subtilis fmbJ on growth performance, antioxidant capacity, and meat quality of broiler chickens. Poult. Sci. 2016, 96, pew246. [Google Scholar] [CrossRef]
- Martínez-Alvarez, R.; Morales, A.E.; Sanz, A. Antioxidant Defenses in Fish: Biotic and Abiotic Factors. Rev. Fish Biol. Fish. 2005, 15, 75–88. [Google Scholar] [CrossRef]
- Gliszczyńska-Świgło, A. Antioxidant activity of water soluble vitamins in the TEAC (Trolox equivalent antioxidant capacity) and the FRAP (ferric reducing antioxidant power) assays. Food Chem. 2006, 96, 131–136. [Google Scholar] [CrossRef]
- Matxain, J.; Padro, D.; Ristilä, M.; Strid, Å.; Eriksson, L. Evidence of High •OH Radical Quenching Efficiency by Vitamin B6. J. Phys. Chem. B 2009, 113, 9629–9632. [Google Scholar] [CrossRef] [PubMed]
- Tovar-Ramírez, D.; Mazurais, D.; Gatesoupe, J.; Patrick, Q.; Cahu, C.; Zambonino-Infante, J. Dietary probiotic live yeast modulates antioxidant enzyme activities and gene expression of sea bass (Dicentrarchus labrax) larvae. Aquaculture 2010, 300, 142–147. [Google Scholar] [CrossRef]
- Huang, J.; Tian, L.; Du, Z.; Yang, H.; Liu, Y. Pyridoxine deficiency of grouper, Epinephelus coioides. Fish Physiol. Biochem. 2005, 31, 331–337. [Google Scholar] [CrossRef]
- Pizzimenti, S.; Ciamporcero, E.; Daga, M.; Pettazzoni, P.; Arcaro, A.; Cetrangolo, G.; Minelli, R.; Dianzani, C.; Lepore, A.; Gentile, F.; et al. Interaction of aldehydes derived from lipid peroxidation and membrane proteins. Front. Physiol. 2013, 4, 242. [Google Scholar] [CrossRef]
- Ayala, A.; Muñoz, M.; Argüelles, S. Lipid Peroxidation: Production, Metabolism, and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal. Oxidative. Med. Cell. Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; Shen, H. The Effect of Vitamine B6 on the Lipid Metabolism of Grass Carp (Ctenopharyngodon idella). Acta Hydrobiol. Sin. 1992, 16, 315–321. [Google Scholar] [CrossRef]
- Tao, X.; Zhu, T.; Li, M.; Lu, J.; Jin, M.; Liu, W.; Zhou, Q. Dietary vitamin B6 could improve the utilization of high carbohydrate diet by promoting carbohydrate degradation and lipid synthesis in Pacific white shrimp (Litopenaeus vannamei). Anim. Feed Sci. Technol. 2024, 316, 116083. [Google Scholar] [CrossRef]
- Hadanny, A.; Meir, O.; Bechor, Y.; Fishlev, G.; Bergan, J.; Efrati, S. Seizures during hyperbaric oxygen therapy: Retrospective analysis of 62,614 treatment sessions. Undersea Hyperb. Med. 2016, 43, 21–28. [Google Scholar]
- Ostrowski, R.; Stepien, K.; Pucko, E.; Matyja, E. Hyperbaric oxygen modalities are differentially effective in distinct brain ischemia models. Med. Gas Res. 2016, 6, 39. [Google Scholar] [CrossRef]
- De Haan, J. Nrf2 Activators as Attractive Therapeutics or Diabetic Nephropathy. Diabetes 2011, 60, 2683–2684. [Google Scholar] [CrossRef]
- Bird, R. The Emerging Role of Vitamin B6 in Inflammation and Carcinogenesis. Adv. Food Nutr. Res. 2018, 83, 151–194. [Google Scholar] [CrossRef] [PubMed]
- Cellini, B.; Zelante, T.; Dindo, M.; Bellet, M.M.; Renga, G.; Romani, L.; Costantini, C. Pyridoxal 5′-Phosphate-Dependent Enzymes at the Crossroads of Host-Microbe Tryptophan Metabolism. Int. J. Mol. Sci. 2020, 21, 5823. [Google Scholar] [CrossRef] [PubMed]
- Yan, L.C.; Feng, L.; Jiang, W.; Wu, P.; Liu, Y.; Jiang, J.; Tang, L.; Tang, W.N.; Zhang, Y.; Yang, J.; et al. Dietary taurine supplementation to a plant protein source-based diet improved the growth and intestinal immune function of young grass carp (Ctenopharyngodon idella). Aquac. Nutr. 2019, 25, 873–896. [Google Scholar] [CrossRef]
- Pires, N.; Magalhães, R.; Castro, C.; Couto, A.; Díaz-Rosales, P.; Oliva-Teles, A.; Peres, H. Taurine modulates hepatic oxidative status and gut inflammatory markers of European seabass (Dicentrarchus labrax) fed plant feedstuffs-based diets. Amino Acids 2019, 51, 1307–1321. [Google Scholar] [CrossRef]
- Ji, K.; Liang, H.; Ren, M.; Ge, X.; Bo, L.; Xi, B.; Pan, L.; Yu, H. Effects of dietary tryptophan levels on antioxidant status and immunity for juvenile blunt snout bream (Megalobrama amblycephala) involved in Nrf2 and TOR signaling pathway. Fish Shellfish Immunol. 2019, 93, 474–483. [Google Scholar] [CrossRef]
Ingredients | Level (%) | Ingredients | Level (%) |
---|---|---|---|
Fish meal 1 | 20 | Vitamin premix (without vitamin B6) 4 | 1 |
Casein 2 | 28 | ||
Gelatin 3 | 7 | Mineral premix 5 | 1 |
Wheat Flour 1 | 16 | Monocalcium phosphate | 4 |
Fish oil | 4 | Microcrystalline cellulose | 14.45 |
Soybean oil | 4 | Vitamin C | 0.05 |
Choline chloride | 0.5 | ||
Analyzed proximate composition | |||
Crude protein (%) | 46.93 ± 0.07 | ||
Crude lipid (%) | 9.45 ± 0.15 | ||
Energy (KJ/g) | 17.83 ± 0.02 |
Items | Methods | Testing Equipment/Assay Kits |
---|---|---|
AMY 1 | Microplate method (Model C016-1-2) | Assay kits purchased from Jiancheng Bioengineering Institute (Nanjing, China); Spectrophotometer (Thermo Fisher Multiskan GO, Shanghai, China). |
LPS 2 | Microplate method (Model A054-2-1) | |
TRY 3 | Ultraviolet colorimetry (Model A080-2-2 | |
AKP 4 | Microplate method (Model A059-2-2) | |
Na+/K+ ATPase 5 | Microplate method (Model A070-2-2) | |
CAT 6 | Visible light method (Model A007-1-1) | |
T-AOC 7 | ABTS method (Model A015-2-1) | |
SOD 8 | WST-1 method (Model A001-3-2) | |
GSH 9 | Microplate method (Model A006-2-1) | |
GSH-Px 10 | Colorimetric method (Model A005-1-2) | |
MDA 11 | TBA method (Model A003-1-2) | |
TP 12 | Coomassie Brilliant Blue method (Model A045-2-2) |
Genes | Forward (5′-3′) | Reverse (5′-3′) | Primer Source |
---|---|---|---|
zo-1 1 | ATCTCAGCAGGGATTCGACG | CTTTTGCGGTGGCGTTGG | XM_038701018.1 |
occ 2 | GATATGGTGGCAGCTACGGT | TCCTACTGCGGACAGTGTTG | XM_038715419.1 |
clau 3 | CCAGGGAAGGGGAGCAATG | GCTCTTTGAACCAGTGCGAC | XM_038713307.1 |
akp 4 | GGTTTTCCGGAACAGCACAC | GGCAGTTTGTGTAGGGCTCT | XM_038715644.1 |
amy 5 | ATGGGTGTGGCTGGATTCAG | GTCTGGTCTGGGTTGATGGG | XM_038717543.1 |
il-10 6 | CGGCACAGAAATCCCAGAGC | CAGCAGGCTCACAAAATAAACATCT | XM_038696252.1 |
tgf-β 7 | CACCAAGGAGATGCTGATT | CGTATGTTAGAGATGCTGAAG | XM_038693206.1 |
igm 8 | GCGTCCTTCAGTGTTCAT | TGCTTCCTCGTCATCAAC | >MN871984.1 |
cd83 9 | CACTGTTGTGCCTTGCTG | GGAGCCTCTTTGACCTTGT | XM_038710390.1 |
il-8 10 | GAGGGTACATGTCTGGGGGA | CCTTGAAGGTTTGTTCTTCATCGT | [39] |
nf-κb 11 | CCACTCAGGTGTTGGAGCTT | TCCAGAGCACGACACACTTC | XP_027136364.1 |
tnf-α 12 | CTTCGTCTACAGCCAGGCATCG | TTTGGCACACCGACCTCACC | XM_038710731.1 |
nrf2 13 | CACAGCAGCAGCAGGAAAAG | AAGATGCTGCCGTCTGTTGA | XM_038720536.1 |
keap1 14 | CGTACGTCCAGGCCTTACTC | TGACGGAAATAACCCCCTGC | XP_018520553.1 |
cat 15 | CTATGGCTCTCACACCTTC | TCCTCTACTGGCAGATTCT | MK614708.1 |
Cu-Zn sod 16 | GGTGTTTAAAGCCGTTTGTGTT | CCTCTGATTTCTCCTGTCACCT | XM_038708943.1 |
Mn sod 17 | ACCATGCCACTTATGTCAACAAC | AAAGTCCCGCTTAATGGCCTC | XM_038727054.1 |
gpx 18 | ATGGCTCTCATGACTGATCCAAA | GACCAACCAGGAACTTCTCAAA | XM_038697220.1 |
gapdh 19 | ACTGTCACTCCTCCATCTT | CACGGTTGCTGTATCCAA | AZA04761.1 |
Parameters | Dietary Vitamin B6 Levels (mg/kg) | p1 | p2 | |||||
---|---|---|---|---|---|---|---|---|
2.03 | 2.91 | 3.30 | 6.03 | 9.53 | 21.79 | |||
AMS 1 (U/mgprot) | 0.70 ± 0.09 b | 0.75 ± 0.10 ab | 0.95 ± 0.09 ab | 0.83 ± 0.16 ab | 1.07 ± 0.09 a | 0.93 ± 0.09 ab | 0.516 | 0.053 |
LPS 2 (U/gprot) | 8.83 ± 0.96 c | 11.85 ± 0.96 bc | 15.52 ± 1.13 ab | 15.34 ± 0.73 ab | 18.01 ± 1.57 a | 14.48 ± 1.92 ab | 0.198 | 0.151 |
TRY 3 (U/mgprot) | 40.77 ± 7.26 b | 56.38 ± 7.68 ab | 46.74 ± 1.61 ab | 71.91 ± 10.60 a | 68.48 ± 9.38 a | 57.50 ± 9.09 ab | 0.497 | 0.254 |
AKP 4 (μmol/gprot) | 0.57 ± 0.04 b | 0.66 ± 0.03 ab | 0.75 ± 0.03 a | 0.70 ± 0.04 a | 0.66 ± 0.03 ab | 0.67 ± 0.04 ab | 0.368 | 0.601 |
Na+/K+ ATPase 5 (U/mgprot) | 0.71 ± 0.12 b | 0.83 ± 0.31 ab | 1.44 ± 0.29 ab | 1.65 ± 0.25 a | 1.03 ± 0.27 ab | 0.91 ± 0.25 ab | 0.488 | 0.342 |
TP 6 (g/L) | 2.60 ± 0.12 | 2.63 ± 0.07 | 2.41 ± 0.13 | 2.49 ± 0.08 | 2.64 ± 0.03 | 2.53 ± 0.07 | 0.451 | 0.332 |
Parameters | Dietary Vitamin B6 Levels (mg/kg) | p1 | p2 | |||||
---|---|---|---|---|---|---|---|---|
2.03 | 2.91 | 3.30 | 6.03 | 9.53 | 21.79 | |||
CAT 1 (U/mgprot) | 35.56 ± 6.73 b | 46.66 ± 5.08 ab | 48.92 ± 5.31 ab | 56.77 ± 10.35 a | 48.40 ± 6.20 ab | 46.33 ± 3.35 ab | 0.397 | 0.425 |
T-AOC 2 (mmol/gprot) | 0.17 ± 0.01 b | 0.26 ± 0.02 a | 0.24 ± 0.04 ab | 0.26 ± 0.02 a | 0.22 ± 0.03 ab | 0.24 ± 0.01 ab | 0.388 | 0.203 |
SOD 3 (U/mgprot) | 8.21 ± 0.23 c | 8.74 ± 0.31 abc | 9.41 ± 0.34 ab | 9.58 ± 0.42 a | 8.51 ± 0.17 bc | 8.91 ± 0.22 abc | 0.512 | 0.205 |
GSH 4 (μmol/gprot) | 163.28 ± 18.34 | 153.53 ± 14.66 | 174.92 ± 17.02 | 184.52 ± 10.71 | 177.99 ± 8.53 | 165.95 ± 19.78 | 0.286 | 0.239 |
GSH-Px 5 (U/mgprot) | 218.44 ± 29.64 c | 191.82 ± 18.78 c | 398.74 ± 14.71 a | 429.35 ± 27.36 a | 454.01 ± 34.43 a | 302.96 ± 35.59 b | 0.598 | 0.221 |
MDA 6 (nmol/mgprot) | 21.85 ± 2.79 a | 14.49 ± 1.66 b | 15.23 ± 1.34 b | 15.28 ± 1.41 b | 16.35 ± 0.36 b | 13.36 ± 1.31 b | 0.380 | 0.078 |
TP 7 (g/L) | 2.60 ± 0.12 | 2.63 ± 0.07 | 2.41 ± 0.13 | 2.49 ± 0.08 | 2.64 ± 0.03 | 2.53 ± 0.07 | 0.451 | 0.332 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Huang, D.; Gu, J.; Liang, H.; Ren, M. The Significant Enhancing Effect of Vitamin B6-Fortified Feed on the Intestinal Digestive Efficiency, Immunity, and Antioxidant Defense Mechanisms of Juvenile Largemouth Bass (Micropterus salmoides). Antioxidants 2025, 14, 313. https://doi.org/10.3390/antiox14030313
Zhang L, Huang D, Gu J, Liang H, Ren M. The Significant Enhancing Effect of Vitamin B6-Fortified Feed on the Intestinal Digestive Efficiency, Immunity, and Antioxidant Defense Mechanisms of Juvenile Largemouth Bass (Micropterus salmoides). Antioxidants. 2025; 14(3):313. https://doi.org/10.3390/antiox14030313
Chicago/Turabian StyleZhang, Leimin, Dongyu Huang, Jiaze Gu, Hualiang Liang, and Mingchun Ren. 2025. "The Significant Enhancing Effect of Vitamin B6-Fortified Feed on the Intestinal Digestive Efficiency, Immunity, and Antioxidant Defense Mechanisms of Juvenile Largemouth Bass (Micropterus salmoides)" Antioxidants 14, no. 3: 313. https://doi.org/10.3390/antiox14030313
APA StyleZhang, L., Huang, D., Gu, J., Liang, H., & Ren, M. (2025). The Significant Enhancing Effect of Vitamin B6-Fortified Feed on the Intestinal Digestive Efficiency, Immunity, and Antioxidant Defense Mechanisms of Juvenile Largemouth Bass (Micropterus salmoides). Antioxidants, 14(3), 313. https://doi.org/10.3390/antiox14030313