Ferulic Acid Relieves the Oxidative Stress Induced by Oxidized Fish Oil in Oriental River Prawn (Macrobrachium nipponense) with an Emphasis on Lipid Metabolism and Gut Microbiota
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Oxidized Fish Oil Preparation
2.3. Experimental Diet
2.4. Prawns and Management
2.5. Sampling
2.6. Growth Performance Parameters
2.7. Biochemical Parameter Analysis of Hemolymph and Hepatopancreas
2.8. Real-Time PCR Measurements
2.9. Histology Study
2.10. 16S rDNA Sequencing and Gut Microbial Analysis
2.11. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Biochemical Parameter Analysis
3.3. Lipid Metabolism and Antioxidant-Related Gene Expression
3.4. Oil Red O Staining
3.5. Diversity of Gut Microbiota
3.6. Composition of the Gut Microbial Community at Different Taxonomic Levels
3.7. Analysis of Microbial Composition of Different Groups
3.8. Functional Prediction of Gut Microbial Community
3.9. Gut Microbiota and Phenotypic Indicators Correlation Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fatima, M.; Afzal, M.; Shah, S.J. Effect of dietary oxidized oil and vitamin E on growth performance, lipid peroxidation and fatty acid profile of Labeo rohita fingerlings. Aquacult. Nutr. 2019, 25, 281–289. [Google Scholar] [CrossRef]
- Hatlen, B.; Berge, G.M.; Odom, J.M.; Mundheim, H.; Ruyter, B. Growth performance, feed utilisation and fatty acid deposition in Atlantic salmon, Salmo salar L., fed graded levels of high-lipid/high-EPA Yarrowia lipolytica biomass. Aquaculture 2012, 364, 39–47. [Google Scholar] [CrossRef]
- Tocher, D.R.; Betancor, M.B.; Sprague, M.; Olsen, R.E.; Napier, J.A. Omega-3 Long-Chain Polyunsaturated Fatty Acids, EPA and DHA: Bridging the Gap between Supply and Demand. Nutrients 2019, 11, 89. [Google Scholar] [CrossRef] [PubMed]
- Ismail, A.; Bannenberg, G.; Rice, H.B.; Schutt, E.; MacKay, D. Oxidation in EPA- and DHA-rich oils: An overview. Lipid Technol. 2016, 28, 55–59. [Google Scholar] [CrossRef]
- Chen, Y.J.; Liu, Y.J.; Yang, H.J.; Yuan, Y.; Liu, F.J.; Tian, L.X.; Liang, G.Y.; Yuan, R.M. Effect of dietary oxidized fish oil on growth performance, body composition, antioxidant defence mechanism and liver histology of juvenile largemouth bass Micropterus salmoides. Aquacult. Nutr. 2012, 18, 321–331. [Google Scholar] [CrossRef]
- Tacer-Tanas, S.; Arslan, M. Can Dietary Hazelnut Oil Inclusion Alleviate the Negative Effects of Oxidized Fish Oil in Rainbow Trout (Oncorhynchus mykiss) Juveniles? Turk. J. Fish. Aquat. Sc. 2023, 23, 10. [Google Scholar]
- Hasanpour, S.; Salati, A.P.; Falahatkar, B.; Azarm, H.M. Effects of dietary green tea (Camellia sinensis L.) supplementation on growth performance, lipid metabolism, and antioxidant status in a sturgeon hybrid of Sterlet (Huso huso ♂ x Acipenser ruthenus ♀) fed oxidized fish oil. Fish Physiol. Biochem. 2017, 43, 1315–1323. [Google Scholar] [CrossRef]
- Kumar, N.; Pruthi, V. Potential applications of ferulic acid from natural sources. Biotechnol. Rep. 2014, 4, 86–93. [Google Scholar] [CrossRef]
- Dulong, V.; Kouassi, M.C.; Labat, B.; Le Cerf, D.; Picton, L. Antioxidant properties and bioactivity of Carboxymethylpullulan grafted with ferulic acid and of their hydrogels obtained by enzymatic reaction. Food Chem. 2018, 262, 21–29. [Google Scholar] [CrossRef]
- Gao, J.; Gu, X.; Zhang, M.; Zu, X.; Shen, F.; Hou, X.; Hao, E.; Bai, G. Ferulic acid targets ACSL1 to ameliorate lipid metabolic disorders in db/db mice. J. Funct. Foods. 2022, 91, 105009. [Google Scholar] [CrossRef]
- Yu, L.J.; Wen, H.; Jiang, M.; Wu, F.; Tian, J.; Lu, X.; Xiao, J.R.; Liu, W. Effects of ferulic acid on growth performance, immunity and antioxidant status in genetically improved farmed tilapia (Oreochromis niloticus) fed oxidized fish oil. Aquacult. Nutr. 2020, 26, 1431–1442. [Google Scholar] [CrossRef]
- Chen, S.; Lin, Y.; Shi, H.; Miao, L.; Liu, B.; Ge, X. Dietary ferulic acid supplementation improved cottonseed meal-based diet utilization by enhancing intestinal physical barrier function and liver antioxidant capacity in grass carp (Ctenopharyngodon Idellus). Front. Physiol. 2022, 13, 922037. [Google Scholar] [CrossRef] [PubMed]
- Clarke, G.; Stilling, R.M.; Kennedy, P.J.; Stanton, C.; Cryan, J.F.; Dinan, T.G. Minireview: Gut Microbiota: The Neglected Endocrine Organ. Mol. Endocrinol. 2014, 28, 1221–1238. [Google Scholar] [CrossRef] [PubMed]
- Lippert, K.; Kedenko, L.; Antonielli, L.; Kedenko, I.; Gemeier, C.; Leitner, M.; Kautzky-Willer, A.; Paulweber, B.; Hackl, E. Gut microbiota dysbiosis associated with glucose metabolism disorders and the metabolic syndrome in older adults. Benef. Microbes. 2017, 8, 545–556. [Google Scholar] [CrossRef]
- Hur, K.Y.; Lee, M.S. Gut Microbiota and Metabolic Disorders. Diabetes Metab. 2015, 39, 198–203. [Google Scholar] [CrossRef]
- Long, S.S.; You, Y.; Dong, X.H.; Tan, B.P.; Zhang, S.; Chi, S.Y.; Yang, Q.H.; Liu, H.Y.; Xie, S.W.; Yang, Y.Z.; et al. Effect of dietary oxidized fish oil on growth performance, physiological homeostasis and intestinal microbiome in hybrid grouper (♀Epi-nephelus fuscoguttatus x ♂Epinephelus lanceolatus). Aquacult. Rep. 2022, 24, 101130. [Google Scholar] [CrossRef]
- Li, M.; Tang, L.; Heqiu, Y.Q.; Lv, D.L.; Ding, J.; Chang, Y.Q.; Zuo, R.T. Effects of Oxidized Fish Oil on the Growth, Immune and Antioxidant Capacity, Inflammation-Related Gene Expression, and Intestinal Microbiota Composition of Juvenile Sea Urchin (Strongylocentrotus intermedius). Aquacult. Nutr. 2022, 2022, 2340308. [Google Scholar] [CrossRef]
- Kong, Y.Q.; Ding, Z.L.; Zhang, Y.X.; Zhou, P.X.; Wu, C.B.; Zhu, M.H.; Ye, J.Y. Types of carbohydrate in feed affect the growth performance, antioxidant capacity, immunity, and activity of digestive and carbohydrate metabolism enzymes in juvenile Macrobrachium nipponense. Aquaculture 2019, 512, 734282. [Google Scholar] [CrossRef]
- Li, F.J.; Zhang, S.Y.; Fu, C.P.; Li, T.T.; Cui, X.Y. Molecular and functional analysis of the insulin-like peptides gene in the oriental river prawn Macrobrachium nipponense. Gen. Comp. Endocr. 2019, 280, 209–214. [Google Scholar] [CrossRef]
- Ding, Z.L.; Xiong, Y.F.; Zheng, J.X.; Zhou, D.S.; Kong, Y.Q.; Qi, C.L.; Liu, Y.; Ye, J.Y.; Limbu, S.M. Modulation of growth, antioxidant status, hepatopancreas morphology, and carbohydrate metabolism mediated by alpha-lipoic acid in juvenile freshwater prawns Macrobrachium nipponense under two dietary carbohydrate levels. Aquaculture 2022, 546, 737314. [Google Scholar] [CrossRef]
- Mourente, G.; Diaz-Salvago, E.; Bell, J.G.; Tocher, D.R. Increased activities of hepatic antioxidant defence enzymes in juvenile gilthead sea bream (Sparus aurata L.) fed dietary oxidised oil: Attenuation by dietary vitamin E. Aquaculture 2002, 214, 343–361. [Google Scholar] [CrossRef]
- Song, C.Y.; Liu, B.; Xu, P.; Xie, J.; Ge, X.P.; Zhou, Q.L.; Sun, C.X.; Zhang, H.M.; Shan, F.; Yang, Z.F. Oxidized fish oil injury stress in Megalobrama amblycephala: Evaluated by growth, intestinal physiology, and transcriptome-based PI3K-Akt/NF-kappa B/TCR inflammatory signaling. Fish Shellfish. Immun. 2018, 81, 446–455. [Google Scholar] [CrossRef] [PubMed]
- Available online: https://www.chinesestandard.net/PDF.aspx/GBT5538-2005 (accessed on 24 November 2024).
- Available online: https://cdn.standards.iteh.ai/samples/33635/dd822e8eb1bb4933a9d663d08f32f4d2/ISO-3960-2001.pdf (accessed on 24 November 2024).
- Zhao, Z.X.; Xie, J.; Liu, B.; Ge, X.P.; Song, C.Y.; Ren, M.C.; Zhou, Q.L.; Miao, L.H.; Zhang, H.M.; Shan, F.; et al. The effects of emodin on cell viability, respiratory burst and gene expression of Nrf2-Keapi signaling molecules in the peripheral blood leukocytes of blunt snout bream (Megalobrama amblycephala). Fish Shellfish. Immun. 2017, 62, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Luo, N.; Ding, Z.L.; Kong, Y.Q.; Zhang, R.F.; Zhang, Y.X.; Wu, C.L.; Ye, J.Y. An evaluation of increasing linolenic acid level in the diet of Macrobrachium nipponense: Lipid deposition, fatty acid composition and expression of lipid metabolism-related genes. Aquac. Nutr. 2018, 24, 758–767. [Google Scholar] [CrossRef]
- Zhou, Q.L.; Jiang, S.F.; Xiong, Y.W.; Liu, B.; Sun, C.X.; Jiang, Z.T.; Fu, H.T. Fishmeal level affects growth performance of Macrobrachium nipponense via regulating protein and lipid metabolism. Aquac. Int. 2022, 28, 1771–1785. [Google Scholar] [CrossRef]
- Li, Y.M.; Liu, Z.Q.; Yang, Y.; Jiang, Q.C.; Wu, D.L.; Huang, Y.H.; Zhao, Y.L. Effects of nanoplastics on energy metabolism in the oriental river prawn (Macrobrachium nipponense). Environ. Pollut. 2021, 268, 115890. [Google Scholar] [CrossRef]
- Wang, L.; Feng, J.B.; Wang, G.L.; Guan, T.Y.; Zhu, C.K.; Li, J.L.; Wang, H. Effects of cadmium on antioxidant and non-specific immunity of Macrobrachium nipponense. Ecotoxicol. Environ. Saf. 2021, 224, 112651. [Google Scholar] [CrossRef]
- Hu, Y.N.; Fu, H.T.; Qiao, H.; Sun, S.M.; Zhang, W.Y.; Jin, S.B.; Wu, Y. Validation and Evaluation of Reference Genes for Quantitative Real-Time PCR in Macrobrachium Nipponense. Int. J. Mol. Sci. 2018, 19, 2258. [Google Scholar] [CrossRef]
- Liu, Y.K.; Zhou, X.X.; Liu, B.; Gao, Q.; Sun, C.X.; Zhou, Q.L.; Zheng, X.C.; Liu, B. Effects of high fat in the diet on growth, antioxidant, immunity and fat deposition of Macrobrachium rosenbergii post-larvae. Fish Shellfish. Immun. 2022, 129, 13–21. [Google Scholar] [CrossRef]
- Sun, C.; Liu, B.; Zhou, Q.; Xiong, Z.; Zhang, H. Response of Macrobrachium rosenbergii to Vegetable Oils Replacing Dietary Fish Oil: Insights from Antioxidant Defense. Front. Physiol. 2020, 11, 218. [Google Scholar] [CrossRef]
- Magoc, T.; Salzberg, S.L. FLASH: Fast Length Adjustment of Short Reads to Improve Genome Assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.J.P. Taxonomy annotation and guide tree errors in 16S rRNA databases. PeerJ 2018, 6, e5030. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C.J.B. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef]
- Alibeygi, T.; Moghanlou, K.S.; Mozanzadeh, M.T.; Imani, A.; Tahmasebi, R. Growth performance, fatty acid profile, antioxidant capacity, liver and gut histopathology in Asian seabass (Lates calcarifer) fed various levels of oxidized fish oil and vitamin E. Aquaculture 2025, 595, 741609. [Google Scholar] [CrossRef]
- Liu, X.; Jiang, S.F.; Liu, B.; Zhou, Q.L.; Sun, C.X.; Zheng, X.C.; Han, Y.Q. Dietary effect of ferulic acid on growth performance, physiological response, non-specific immunity and disease resistance of oriental river prawn (Macrobrachium nipponense). Aquacult. Rep. 2022, 24, 101162. [Google Scholar] [CrossRef]
- Zietek, J.; Guz, L.; Panasiuk, K.; Winiarczyk, S.; Adaszek, L. New intravital method for hemolymph collection from Cornu aspersum snails and the establishment of standards for selected biochemical parameters of their hemolymph. Med. Weter. 2017, 73, 366–369. [Google Scholar] [CrossRef]
- Ramli, N.S.; Jia, H.J.; Sekine, A.; Lyu, W.; Furukawa, K.; Saito, K.; Kato, H. Eggshell membrane powder lowers plasma triglyceride and liver total cholesterol by modulating gut microbiota and accelerating lipid metabolism in high-fat diet-fed mice. Food Sci. Nutr. 2020, 8, 2512–2523. [Google Scholar] [CrossRef]
- Zvintzou, E.; Xepapadaki, E.; Skroubis, G.; Mparnia, V.; Giannatou, K.; Benabdellah, K.; Kypreos, K.E. High-Density Lipoprotein in Metabolic Disorders and Beyond: An Exciting New World Full of Challenges and Opportunities. Pharmaceuticals 2023, 16, 855. [Google Scholar] [CrossRef]
- Merlen, G.; Bidault-Jourdainne, V.; Kahale, N.; Glenisson, M.; Ursic-Bedoya, J.; Doignon, I.; Tordjmann, T. Hepatoprotective impact of the bile acid receptor TGR5. Liver Int. 2020, 40, 1005–1015. [Google Scholar] [CrossRef]
- Keitel, V.; Kubitz, R.; Häussinger, D. Endocrine and paracrine role of bile acids. World J. Gastroentero. 2008, 14, 5620–5629. [Google Scholar] [CrossRef]
- Engström-Öst, J.; Kanerva, M.; Vuori, K.; Riebesell, U.; Spisla, C.; Glippa, O. Oxidative stress and antioxidant defence responses in two marine copepods in a high CO2 experiment. Sci. Total Environ. 2020, 745, 140600. [Google Scholar] [CrossRef]
- Lushchak, V.I. Contaminant-induced oxidative stress in fish: A mechanistic approach. Fish Physiol. Biochem. 2016, 42, 711–747. [Google Scholar] [CrossRef] [PubMed]
- Ortiz, C.; Müller, L.; Borges, L.; Pinto, L.A.D.; Cadaval, T.R.S., Jr.; Tesser, M.B.; Ventura-Lima, J. The use of chitosan as an antioxidant in the feed of cultivated P. vannamei shrimp against oxidative stress induced by exposure to microplastics. Mar. Environ. Res. 2024, 202, 106747. [Google Scholar]
- Mir, S.M.; Ravuri, H.G.; Pradhan, R.K.; Narra, S.; Kumar, J.M.; Kuncha, M.; Kanjilal, S.; Sistla, R. Ferulic acid protects lipopolysaccharide-induced acute kidney injury by suppressing inflammatory events and upregulating antioxidant defenses in Balb/c mice. Biomed. Pharmacother. 2018, 100, 304–315. [Google Scholar] [CrossRef] [PubMed]
- Escorcia, W.; Ruter, D.L.; Nhan, J.; Curran, S.P. Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining. Jove-J. Vis. Exp. 2018, 133, 57352. [Google Scholar] [CrossRef]
- Fujimoto, T.; Parton, R.G. Not Just Fat: The Structure and Function of the Lipid Droplet. Cold Spring Harb. Perspect. Biol. 2011, 3, a004838. [Google Scholar] [CrossRef]
- Walther, T.C.; Kim, S.; Arlt, H.; Voth, G.A.; Farese, R.V., Jr. Structure and function of lipid droplet assembly complexes. Curr. Opin. Struct. Biol. 2023, 80, 102606. [Google Scholar] [CrossRef]
- Cho, J.; Park, E. Ferulic acid maintains the self-renewal capacity of embryo stem cells and adipose-derived mesenchymal stem cells in high fat diet-induced obese mice. J. Nutr. Biochem. 2020, 77, 108327. [Google Scholar] [CrossRef]
- Koh, E.J.; Kim, K.J.; Seo, Y.J.; Choi, J.; Lee, B.Y. Modulation of HO-1 by Ferulic Acid Attenuates Adipocyte Differentiation in 3T3-L1 Cells. Molecules 2017, 22, 745. [Google Scholar] [CrossRef]
- Fouad, A.M.; El-Senousey, H.K.; Yang, X.J.; Yao, J.H. Dietary L-arginine supplementation reduces abdominal fat content by modulating lipid metabolism in broiler chickens. Animal 2013, 7, 1239–1245. [Google Scholar] [CrossRef]
- Mandrup, S.; Hummel, R.; Ravn, S.; Jensen, G.; Andreasen, P.H.; Gregersen, N.; Knudsen, J.; Kristiansen, K. Acyl-coa-binding protein diazepam-binding inhibitor gene and pseudogenes—A typical housekeeping gene family. J. Mol. Biol. 1992, 228, 1011–1022. [Google Scholar] [CrossRef] [PubMed]
- Shinoda, Y.; Wang, Y.F.; Yamamoto, T.; Miyachi, H.; Fukunaga, K. Analysis of binding affinity and docking of novel fatty acid-binding protein (FABP) ligands. J. Pharmacol. Sci. 2020, 143, 264–271. [Google Scholar] [CrossRef] [PubMed]
- Setoyama, D.; Fujimura, Y.; Miura, D. Metabolomics reveals that carnitine palmitoyltransferase-1 is a novel target for oxidative inactivation in human cells. Genes Cells 2013, 18, 1107–1119. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.J.; Ye, W.D.; Clements, K.D.; Zan, Z.Y.; Zhao, W.S.; Zou, H.; Wang, G.T.; Wu, S.G. Bacillus licheniformis FA6 Affects Zebrafish Lipid Metabolism through Promoting Acetyl-CoA Synthesis and Inhibiting beta-Oxidation. Int. J. Mol. Sci. 2023, 24, 673. [Google Scholar] [CrossRef] [PubMed]
- Ranzani, A.T.; Cordeiro, A.T. Mutations in the tetramer interface of human glucose-6-phosphate dehydrogenase reveals kinetic differences between oligomeric states. Febs Lett. 2017, 2591, 1278–1284. [Google Scholar] [CrossRef]
- Moraes, B.; Martins, R.; Lopes, C.; Martins, R.; Arcanjo, A.; Nascimento, J.; Logullo, C. G6PDH as a key immunometabolic and redox trigger in arthropods. Front. Physiol. 2023, 14, 1287090. [Google Scholar] [CrossRef]
- Sun, X.D.; Li, X.B.; Jia, H.D.; Wang, H.Y.; Shui, G.H.; Qin, Y.L.; Shu, X.; Wang, Y.Z.; Dong, J.H.; Liu, G.W.; et al. Nuclear Factor E2-Related Factor 2 Mediates Oxidative Stress-Induced Lipid Accumulation in Adipocytes by Increasing Adipogenesis and Decreasing Lipolysis. Antioxid. Redox Sign. 2022, 32, 173–192. [Google Scholar] [CrossRef]
- Valdes, A.M.; Walter, J.; Segal, E.; Spector, T.D. Re: Role of the gut microbiota in nutrition and health. BMJ 2018, 361, 17–22. [Google Scholar]
- Yin, X.Y.; Liu, W.Y.; Chen, H.; Qi, C.; Chen, H.S.; Niu, H.X.; Yang, J.F.; Kwok, K.W.H.; Dong, W. Effects of ferulic acid on muscle development and intestinal microbiota of zebrafish. J. Anim. Physiol. Anim. Nutr. 2022, 106, 429–440. [Google Scholar] [CrossRef]
- Cotillard, A.; Kennedy, S.P.; Kong, L.C.; Prifti, E.; Pons, N.; Le Chatelier, E.; Almeida, M.; Quinquis, B.; Levenez, F.; Galleron, N.; et al. Dietary intervention impact on gut microbial gene richness. Nature 2013, 500, 585. [Google Scholar] [CrossRef]
- Schoeler, M.; Caesar, R. Dietary lipids, gut microbiota and lipid metabolism. Rev. Endocr. Metab. Dis. 2019, 20, 461–472. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.H.; Chiu, C.C.; Hung, S.W.; Huang, W.C.; Lee, Y.P.; Liu, J.Y.; Huang, Y.T.; Chen, T.H.; Chuang, H.L. Gnotobiotic mice inoculated with Firmicutes, but not Bacteroidetes, deteriorate nonalcoholic fatty liver disease severity by modulating hepatic lipid metabolism. Nutr. Res. 2019, 69, 20–29. [Google Scholar] [CrossRef] [PubMed]
- Turnbaugh, P.J.; Ley, R.E.; Mahowald, M.A.; Magrini, V.; Mardis, E.R.; Gordon, J.I. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006, 444, 1027–1031. [Google Scholar] [CrossRef] [PubMed]
- Shih, M.K.; Tain, Y.L.; Chen, Y.W.; Hsu, W.H.; Yeh, Y.T.; Chang, S.K.C.; Hou, C.Y. Resveratrol Butyrate Esters Inhibit Obesity Caused by Perinatal Exposure to Bisphenol A in Female Offspring Rats. Molecules 2021, 26, 4010. [Google Scholar] [CrossRef]
- Wu, C.C.; Huang, Y.W.; Hou, C.Y.; Chen, Y.T.; Dong, C.D.; Chen, C.W.; Hsieh, S.L. Lemon fermented products prevent obesity in high-fat diet-fed rats by modulating lipid metabolism and gut microbiota. J. Food Sci. Tech. Mys. 2023, 60, 1036–1044. [Google Scholar] [CrossRef]
- Biddle, A.; Stewart, L.; Blanchard, J.; Leschine, S.J.D. Untangling the Genetic Basis of Fibrolytic Specialization by Lachnospiraceae and Ruminococcaceae in Diverse Gut Communities. Diversity 2013, 5, 627–640. [Google Scholar] [CrossRef]
- Oh, J.K.; Vasquez, R.; Kim, S.H.; Lee, J.H.; Kim, E.J.; Hong, S.K.; Kang, D.K. Neoagarooligosaccharides modulate gut microbiota and alleviate body weight gain and metabolic syndrome in high-fat diet-induced obese rats. J. Funct. Foods 2022, 88, 104869. [Google Scholar] [CrossRef]
- Yan, J.K.; Chen, T.T.; Li, L.Q.; Liu, F.Y.; Liu, X.Z.; Li, L. The anti-hyperlipidemic effect and underlying mechanisms of barley (Hordeum vulgare L.) grass polysaccharides in mice induced by a high-fat diet. Food Funct. 2023, 14, 7066–7081. [Google Scholar]
- Sánchez, B.; Delgado, S.; Blanco-Míguez, A.; Lourenço, A.; Gueimonde, M.; Margolles, A. Probiotics, gut microbiota, and their influence on host health and disease. Mol. Nutr. Food Res. 2017, 61, 1. [Google Scholar] [CrossRef]
- Sirichoat, A.; Lulitanond, V.; Faksri, K. Analysis of bacterial and fungal communities in fermented fish (pla-ra) from Northeast Thailand. Arch. Microbiol. 2022, 204, 6. [Google Scholar] [CrossRef]
- Ankrah, N.Y.D.; Barker, B.E.; Song, J.; Wu, C.; McMullen, J.G.; Douglas, A.E. Predicted Metabolic Function of the Gut Microbiota of Drosophila melanogaster. Msystems 2021, 6, 3. [Google Scholar] [CrossRef] [PubMed]
- Yu, T.; Chen, Y.K.; Chen, X.M.; Abdallah, G.; Zhang, D.M. The effect of oxidized fish oil on lipid metabolism in Rhynchocypris lagowski Dybowski. Aquacult. Rep. 2020, 17, 100388. [Google Scholar] [CrossRef]
- Xiong, F.; Wu, S.G.; Qin, L.; Shi, M.J.; Li, W.X.; Zou, H.; Wang, G.T. Transcriptome analysis of grass carp provides insights into disease-related genes and novel regulation pattern of bile acid feedback in response to lithocholic acid. Aquaculture 2018, 500, 613–621. [Google Scholar] [CrossRef]










| Ingredients (%) | CT | OF | OF+FA160 | OF+FA320 |
|---|---|---|---|---|
| Fish meal a | 30.00 | 30.00 | 30.00 | 30.00 |
| Soybean meal a | 22.00 | 22.00 | 22.00 | 22.00 |
| Rapeseed meal a | 10.00 | 10.00 | 10.00 | 10.00 |
| Shrimp meal a | 6.00 | 6.00 | 6.00 | 6.00 |
| Squid paste a | 3.00 | 3.00 | 3.00 | 3.00 |
| Wheat flour a | 20.93 | 20.93 | 20.91 | 20.90 |
| Fish oil b | 3.00 | 0 | 0 | 0 |
| Oxidized fish oil b | 0 | 3.00 | 3.00 | 3.00 |
| Soybean phospholipids b | 1.00 | 1.00 | 1.00 | 1.00 |
| Ca(H2PO4)2 c | 2.00 | 2.00 | 2.00 | 2.00 |
| Premix c | 1.00 | 1.00 | 1.00 | 1.00 |
| Vitamin C c | 0.50 | 0.50 | 0.50 | 0.50 |
| Choline chloride (60%) c | 0.50 | 0.50 | 0.50 | 0.50 |
| Ecdysone (10%) c | 0.02 | 0.02 | 0.02 | 0.02 |
| DMPT d | 0.05 | 0.05 | 0.05 | 0.05 |
| Ferulic acid (99.1%) d | 0.00 | 0.00 | 0.016 | 0.032 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 |
| Proximate Composition (%, air-dried) | ||||
| Dry matter | 89.36 | 89.47 | 89.43 | 89.53 |
| Crude protein | 40.65 | 40.62 | 40.58 | 40.56 |
| Ether extract | 8.24 | 8.21 | 8.25 | 8.24 |
| Lysine | 2.64 | 2.62 | 2.63 | 2.61 |
| Methionine | 0.92 | 0.91 | 0.89 | 0.93 |
| Gross energy (MJ/kg) | 17.09 | 17.01 | 17.12 | 17.10 |
| Gene | Primer sequences (5′–3′) | Product Length (bp) | Tm (°C) | Accession Number | Reference |
|---|---|---|---|---|---|
| ACC | (F) CAAGGTCCACTACATGGTCT (R) ACTCTTCCCAAACTCTCTCC | 154 | 56.55 | KP690138.1 | (Luo et al., 2018) [26] |
| 56.17 | |||||
| FAS | (F) CGGTCAGACAAACTACGGCT (R) CACTGAATAGCCACCCCAGG | 93 | 60.04 | MK307767.1 | (Zhou et al., 2020) [27] |
| 60.11 | |||||
| CPT1 | (F) AATTTTTGACTGGCTTCTCC (R) TCCATTCTGGAAATCATCTG | 176 | 54.06 | KP690136.1 | (Luo et al., 2018) [26] |
| 52.62 | |||||
| G6PDH | (F) CGTGGACCTTTCTTCATTAG (R) ACCATCAACCATTTGAGAAG | 164 | 53.75 | KP690144.1 | (Luo et al., 2018) [26] |
| 53.46 | |||||
| ACBP | (F) GAGGCTGCTGAGAAGGTC (R) ATCATACCAGGTCGCTCC | 122 | 57.07 | KF896234.1 | (Li et al., 2021) [28] |
| 55.74 | |||||
| FABP10 | (F) CCAAGCCAACTCTGGAAGTC (R) GATCTCAACGCTGGCTTCTC | 218 | 58.47 | JN995589.1 | (Li et al., 2021) [28] |
| 58.71 | |||||
| SCD | (F) ATAATGTTTGCCCTGCTACA (R) ATGTCATTCTGGAAGGCAAT | 224 | 55.00 | KU922943.1 | (Luo et al., 2021) [26] |
| 54.97 | |||||
| SOD | (F) AGTTTCAGCCGTCTGTTCG (R) CACAGTGCTTACATCACCCTTA | 231 | 58.10 | HQ852225.1 | (Wang et al., 2021) [29] |
| 58.06 | |||||
| CAT | (F) GAACTGGGATTTGGTTGGCA (R) GGTCCGAGAAAAGGATGGTG | 185 | 58.66 | KC485002.1 | (Wang et al., 2021) [29] |
| 58.26 | |||||
| GPx | (F) CCTGGCTTTCCCCTGTAACC (R) ACCGAGTCATCCGAAGGCA | 204 | 60.32 | HQ651155.1 | (Wang et al., 2021) [29] |
| 60.98 | |||||
| HSP60 | (F) GTTGCCTTGCTTCGTTGTATGCC (R) GGTAGCAATGGTGTAACACGGCG | 120 | 63.28 | KF028596.1 | (Wang et al., 2021) [29] |
| 64.36 | |||||
| EIF | (F) CATGGATGTACCTGTGGTGAAAC (R) CTGTCAGCAGAAGGTCCTCATTA | 179 | 59.56 | MH540106.1 | (Hu et al., 2018) [30] |
| 59.80 |
| Parameters | CT | OF | OF+FA160 | OF+FA320 |
|---|---|---|---|---|
| IW (g) | 0.140± 0.008 | 0.140 ± 0.008 | 0.130± 0.008 | 0.130 ± 0.007 |
| FW (g) | 1.090 ± 0.033 a | 0.910 ± 0.025 b | 0.990 ± 0.024 b | 0.930 ± 0.022 b |
| SR (%) | 79.800 ± 3.693 | 83.600 ± 1.860 | 81.400 ± 2.619 | 78.330 ± 0.989 |
| WGR (%) | 707.390 ± 37.102 b | 561.510 ± 23.086 a | 648.790 ± 35.600 ab | 605.140 ± 29.221 a |
| SGR (%/d) | 3.720 ± 0.084 b | 3.370 ± 0.063 a | 3.590 ± 0.083 ab | 3.480 ± 0.072 a |
| FCR | 1.610 ± 0.110 | 1.840 ± 0.107 | 1.690 ± 0.095 | 1.780 ± 0.076 |
| RFI (%/d) | 6.440 ± 0.374 | 6.660 ± 0.205 | 6.630 ± 0.200 | 7.080± 0.219 |
| Items | CT | OF | OF+FA160 | OF+FA320 |
|---|---|---|---|---|
| Hemolymph | ||||
| TG (mmol/L) | 0.980 ± 0.056 ab | 1.040 ± 0.060 b | 0.830 ± 0.038 a | 0.850 ± 0.005 ab |
| TC (mmol/L) | 0.660 ± 0.014 ab | 0.700 ± 0.031 b | 0.550 ± 0.046 a | 0.630 ± 0.043 ab |
| HDL-C (mmol/L) | 0.200 ± 0.019 bc | 0.150 ± 0.013 a | 0.200 ± 0.018 c | 0.150 ± 0.009 ab |
| LDL-C (mmol/L) | 0.220 ± 0.007 ab | 0.250 ± 0.018 a | 0.190 ± 0.013 b | 0.200 ± 0.018 ab |
| TBA (µmol/L) | 5.810 ± 0.140 b | 5.130 ± 0.273 a | 5.960 ± 0.182 b | 5.670 ± 0.214 ab |
| Hepatopancreas | ||||
| TG (mmol/gprot) | 1.520 ± 0.062 ab | 1.830 ± 0.081 a | 1.360 ± 0.087 b | 1.410 ± 0.251 ab |
| TC (mmol/gprot) | 0.100 ± 0.015 a | 0.180 ± 0.041 b | 0.110 ± 0.016 a | 0.110 ± 0.023 a |
| HDL-C (mmol/gprot) | 0.200 ± 0.032 ab | 0.170 ± 0.008 a | 0.240 ± 0.014 b | 0.210 ± 0.014 ab |
| LDL-C (mmol/gprot) | 0.330 ± 0.026 a | 0.460 ± 0.028 b | 0.370 ± 0.030 a | 0.360 ± 0.035 a |
| TBA (umol/L/gprot) | 5.080 ± 0.253 b | 4.210 ± 0.294 a | 5.160 ± 0.265 b | 5.040 ± 0.188 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Sun, C.; Zhou, Q.; Zheng, X.; Jiang, S.; Wang, A.; Han, Y.; Xu, G.; Liu, B. Ferulic Acid Relieves the Oxidative Stress Induced by Oxidized Fish Oil in Oriental River Prawn (Macrobrachium nipponense) with an Emphasis on Lipid Metabolism and Gut Microbiota. Antioxidants 2024, 13, 1463. https://doi.org/10.3390/antiox13121463
Liu X, Sun C, Zhou Q, Zheng X, Jiang S, Wang A, Han Y, Xu G, Liu B. Ferulic Acid Relieves the Oxidative Stress Induced by Oxidized Fish Oil in Oriental River Prawn (Macrobrachium nipponense) with an Emphasis on Lipid Metabolism and Gut Microbiota. Antioxidants. 2024; 13(12):1463. https://doi.org/10.3390/antiox13121463
Chicago/Turabian StyleLiu, Xin, Cunxin Sun, Qunlan Zhou, Xiaochuan Zheng, Sufei Jiang, Aimin Wang, Yongquan Han, Gangchun Xu, and Bo Liu. 2024. "Ferulic Acid Relieves the Oxidative Stress Induced by Oxidized Fish Oil in Oriental River Prawn (Macrobrachium nipponense) with an Emphasis on Lipid Metabolism and Gut Microbiota" Antioxidants 13, no. 12: 1463. https://doi.org/10.3390/antiox13121463
APA StyleLiu, X., Sun, C., Zhou, Q., Zheng, X., Jiang, S., Wang, A., Han, Y., Xu, G., & Liu, B. (2024). Ferulic Acid Relieves the Oxidative Stress Induced by Oxidized Fish Oil in Oriental River Prawn (Macrobrachium nipponense) with an Emphasis on Lipid Metabolism and Gut Microbiota. Antioxidants, 13(12), 1463. https://doi.org/10.3390/antiox13121463

