Next Article in Journal
Radical Scavenging Capacity and In Vitro Cytoprotective Effects of Great Salt Lake-Derived Processed Mineral Water
Previous Article in Journal
Antioxidants: A Hot Controversy Defused by Cool Semantics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Rosmarinic Acid Attenuates Salmonella enteritidis-Induced Inflammation via Regulating TLR9/NF-κB Signaling Pathway and Intestinal Microbiota

1
College of Animal Science and Technology, Guangxi University, Nanning 530004, China
2
Guangxi Key Laboratory of Animal Breeding, Disease Control and Prevention, Nanning 530004, China
3
Guangxi Zhuang Autonomous Region Engineering Research Center of Veterinary Biologics, Nanning 530004, China
*
Authors to whom correspondence should be addressed.
Antioxidants 2024, 13(10), 1265; https://doi.org/10.3390/antiox13101265
Submission received: 8 July 2024 / Revised: 13 October 2024 / Accepted: 16 October 2024 / Published: 18 October 2024
(This article belongs to the Topic Recent Advances in Veterinary Pharmacology and Toxicology)

Abstract

Salmonella enteritidis (SE) infection disrupts the homeostasis of the intestinal microbiota, causing an intestinal inflammatory response and posing a great threat to human and animal health. The unreasonable use of antibiotics has led to an increase in the prevalence of drug-resistant SE, increasing the difficulty of controlling SE. Therefore, new drug strategies and research are urgently needed to control SE. Rosmarinic acid (RA) is a natural phenolic acid with various pharmacological activities, including antioxidant, anti-inflammatory and antibacterial properties. However, the protective effects and mechanism of RA on intestinal inflammation and the gut microbial disorders caused by SE have not been fully elucidated. In this study, RAW264.7 cells, MCECs and BALB/c mice were challenged with SE to assess the protective effects and mechanisms of RA. The results showed that RA enhanced the phagocytic ability of RAW264.7 cells, reduced the invasion and adhesion ability of SE in MCECs, and inhibited SE-induced inflammation in cells. Moreover, RA inhibited the activation of the NF-κB signaling pathway by upregulating TLR9 expression. Importantly, we found that RA provided protection against SE and increased the diversity and abundance of the intestinal microbiota in mice. Compared with infection control, RA significantly increased the abundance of Firmicutes and Acidibacteria and decreased the abundance of Proteobacteria, Epsilonbacteraeota and Bacteroidota. However, RA failed to alleviate SE-induced inflammation and lost its regulatory effects on the TLR9/NF-κB signaling pathway after destroying the gut microbiota with broad-spectrum antibiotics. These results indicated that RA attenuated SE-induced inflammation by regulating the TLR9/NF-κB signaling pathway and maintaining the homeostasis of the gut microbiota. Our study provides a new strategy for preventing SE-induced intestinal inflammation.

Graphical Abstract

1. Introduction

Salmonella invasion and intracellular replication within host cells result in gastroenteritis, bacteremia, enteric fever and focal infections [1]. Salmonella is prone to contaminating animal foods. It is frequently detected in seafood [2], beef [3], chicken and pork [4], causes significant economic losses in animal husbandry and seriously endangers public health [5,6]. Salmonella invades intestinal epithelial cells, inducing an excessive inflammatory response in the gut and disrupting intestinal mucosa barrier function [7]. The virulence factor T3SS-2 of Salmonella enhances its colonization in the intestinal lumen by achieving chemotactic-dependent utilization of intestinal inflammation [7]. Maintaining the intestinal barrier integrity and intestinal microbiota homeostasis offers colonization resistance against Salmonella, limiting bacterial expansion and transmission [8]. Moreover, enhancing the antioxidant capacity of epithelial cells and inhibiting excessive inflammatory responses in the intestine contribute to the control of Salmonella infection [9].
Macrophages are recruited to the site of infection to exert their phagocytic function after infection with Salmonella. Moreover, this response has been studied intensively in epithelial cells, the target of Salmonella during gastrointestinal infections [10]. The ability of immune cells, particularly macrophages, to eliminate bacteria is often associated with pattern recognition receptors (PRRs), especially TLRs. TLRs activate signaling pathways that provide specific immunological responses tailored to microbes expressing PAMPs [11]. TLRs include cell surface TLRs and endosomal TLRs [12]. TLR9 is an intracellular TLR that recognizes unmethylated CpG motifs in the double-stranded DNA of bacteria. TLR9 activation amplifies the T-cell response and promotes bacterial clearance; thus, TLR9 activation may be an effective strategy for resisting pathogen entry [13]. Previous studies have proven that TLR9 is important for the host defense against Salmonella typhimurium invasion in mice [14]. Persistent infection with Salmonella leads to an inflammatory response in the body, and the NF-κB signaling pathway plays an important role in Salmonella-induced inflammation. TLR9 negatively regulates the NF-κB-NLRP3-IL-1β pathway and plays a vital role in defense against Salmonella typhimurium and the protection of the intestinal integrity. Moreover, CpG treatment induced increased TLR9 expression and enhanced the host resistance to Salmonella [15]. These studies indicated that activating TLR9 and inhibiting the NF-κB pathway are beneficial for the host to clear Salmonella and alleviate intestinal inflammatory damage.
The gut microbiota promotes the integrity of the intestinal mucosa, provides essential nutrients such as vitamins and enzymes, protects hosts from pathogen infections and regulates innate and adaptive immunity [16]. The metabolites produced by the symbiotic gut microbiota affect the host’s health through recognition by the immune system [17]. The disturbance of the gut microbiota leads to cardiac metabolism disorders, type 2 diabetes, obesity, and various chronic inflammatory diseases [18,19,20]. Moreover, the gut microbiota is crucial for resisting the colonization of exogenous microorganisms [21]. Mice harboring low-complexity gut microbiota are unable to resist Salmonella infection [22]. Maintaining normal gut microbiota can reduce the colonization of Salmonella and maintain intestinal barrier function [23].
Salmonella enteritidis (SE), a common serotype of Salmonella, is one of the main pathogens causing acute gastroenteritis. Currently, the main prevention and treatment drugs for SE infection are antibiotics, and the unreasonable use of antibiotics has led to the emergence of SE resistance and damage to intestinal barrier function. Residues of veterinary drugs in animal food impair public health and safety, and because of their powerful biological activity and nontoxicity and the advantage of having multiple targets, the effective monomeric components of Chinese herbal medicine are an outstanding choice for controlling Salmonella [24]. Rosmarinic acid (RA) is a bioactive phenolic compound commonly found in plants of the Lamiaceae and Boraginaceae families, and possesses anti-inflammatory, anticancer and antibacterial activities [25,26,27]. RA has been widely used in the beverage, food and skincare industries [28,29], provides protection against colitis and inhibits the growth of Escherichia coli, Proteus mirabilis and Bacillus cereus [28,30,31]. Additionally, RA has direct antibacterial and bactericidal effects on Salmonella in vitro [32]. However, the role of RA on SE infection in vivo and the regulatory mechanism of RA against SE are unclear.
In this study, we investigated the protective effects of RA on Salmonella-challenged RAW264.7 cells, MCECs and BALB/c mice, and the regulatory effects of RA on the TLR9/NF-κB signaling pathway and the gut microbiota. Overall, this study revealed that RA has a good protective effect on SE-induced inflammation and intestinal damage in mice by regulating the TLR9/NF-κB signaling pathway and gut microbiota. These findings indicate that RA is a mild, effective and potentially effective agent with few side effects that can be used to prevent SE infection.

2. Materials and Methods

2.1. Reagents

RA was purchased from McLean Biochemical Technology Co., Ltd. (Shanghai, China); LB nutrient agar and nutrient broth were purchased from Beijing Land Bridge Co., Ltd. (Beijing, China); DMEM and FBS were purchased from Thermo Fisher Scientific (Waltham, MA, USA); RNAlater was purchased from Genstar (Guangzhou, China); FITC was purchased from Sigma-Aldrich (Shanghai, China); rabbit monoclonal antibodies against p-p65, p65, p-IκB-α, IκB-α and β-actin were purchased from Abmart (Shanghai, China); ELISA kits were purchased from Mlbio (Shanghai, China); SOD, MDA, GPT and GOT biochemical indicator detection kits were purchased from Nanjing Jiancheng Biology Co., Ltd. (Nanjing, China); and E6446 dihydrochloride was purchased from Selleck (Chongqing, China).

2.2. Animal

BALB/c mice (female, 6–8 weeks, 18–22 g) were purchased from Beijing Si Bei Fu Biotechnology Co., Ltd. (Beijing, China). All mice received food and water ad libitum. The laboratory temperature was maintained at 22–24 °C, with a relative humidity of 40–50%. This study was conducted according to the recommendations of the Academy of Animal Research Guidelines and approved by the Animal Ethics Committee of Guangxi University (protocol number: GXU-2022-336). All animal experiments involving mice protocols and procedures were performed according to the protocols for the care of laboratory animals, Ministry of Science and Technology People’s Republic of China. The mice were euthanized using anesthesia.

2.3. Bacteria and Cell Culture

The Salmonella enterica (SE) serovar Enteritidis strain was isolated from chickens and maintained by the Pharmacology and Pathology Laboratory of the School of Animal Science and Technology, Guangxi University. SE was grown in LB broth at 37 °C and shaken at 180 rpm for 6 h, centrifuged at 3000 rpm for 10 min, and resuspended with PBS for challenge.
RAW264.7 cells and MCECs were cultured in high-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and penicillin streptomycin, and incubated with 5% CO2 at 37 °C.

2.4. Minimum Inhibitory Concentration (MIC)

RA was dissolved and diluted with LB broth. Then, 100 μL of RA at different concentrations (0.0157–8 mg/mL) was added to the 96-well plate. Next, 100 μL of SE was added, and the final concentration of RA was 0.00785–4 mg/mL. The experiment was conducted three times in parallel.

2.5. CCK-8 Assay

A CCK-8 kit was used to evaluate the impact of RA on the viability of RAW 264.7 cells and MCECs. Briefly, cells (105/well) in antibiotic-free medium were grown on 96-well plates at 37 °C for 12 h. Except for the control wells, the cells were treated with different concentrations of RA (0–480 μg/mL) and incubated at 37°C in 5% CO2 for 6 h, 12 h, 24 h or 48 h. Then, 10 μL of CCK-8 reagent was added. After incubation at 37 °C for 2 h, the optical density (OD) was determined at 450 nm via a microplate reader. The experiment was conducted six times in parallel. Survival rate data in the blank control group was compared with other groups at the same time point for statistical analysis. The percentage survival was determined using the following formula:
Viability (%) = (ODtreated cells − ODcontrol)/(ODcontrol cells − ODcontrol) × 100%

2.6. CFU Detection

RAW264.7 cells and MCECs (105/well) were cultured in antibiotic-free medium on 24-well plates for 12 h, followed by pretreatment with different concentrations of RA (0–60 μg/mL) for 6 h. Then, SE was challenged with an MOI of 100, the supernatant was removed 2 h after the challenge, and the cells were washed with PBS three times to remove unattached bacteria. For the adhesion assay, the cells were incubated with 0.1% Triton X-100, and the suspensions were serially diluted with PBS and then plated on LB plates. The plates were cultured at 37°C for 16–18 h. Finally, the number of SE colonies that adhered to the cells was counted. For the invasion assay, the cells were washed with PBS three times after incubation with 0.1% Triton X-100 and then incubated in DMEM supplemented with penicillin and streptomycin (100 μg/mL) for 60 min. Furthermore, the cells were lysed with 1% Triton X-100, and the number of intracellular bacteria was determined via an adhesion assay. Finally, the number of SE colonies that invaded the cells was counted.

2.7. Phagocytosis Test

The cells were pretreated with RA (0–60 μg/mL) for 6 h and washed with PBS after pretreatment. Then, the cells were challenged with FITC-labeled SE at an MOI of 100 for 2 h, washed with PBS three times and fixed with 4% formaldehyde for 15 min. Finally, the cells were treated with DAPI for 10 min and observed using a fluorescence microscope.

2.8. Inflammatory Factor Detection

Cells were pretreated with RA (0–60 μg/mL) for 6 h and then challenged with SE (MOI: 100) for 2 h. The supernatant was collected to measure cytokine levels. The cells were lysed with TRIzol or RIPA buffer and then stored at −80 °C for RT–qPCR or Western blot detection.

2.9. Molecular Docking

The crystal structure of the target protein TLR9 was retrieved from the PDB database (PDB-No. 3WPF). The molecular structure of RA was obtained from the PubChem compound database. We prepared and converted the protein and ligand files into PDBQT format. Water molecules were removed from the protein structure, and hydrogen atoms were added accordingly. The grid box dimensions were determined based on the protein domain. PyMol 3.0 software was used to visualize the docking model.

2.10. RA Pretreatment and SE Challenge in Mice

To evaluate the effects of RA on the survival rate of SE-challenged mice, the mice were randomly divided into two groups: the SE infection control group and the RA + SE group. The mice in the RA + SE group were orally administered RA (20 mg/ kg·bw) daily for 7 days, and the mice in the SE infection control group were orally administered the same dose of PBS. Then, the mice were intraperitoneally challenged with SE (2.5 × 108 CFUs/mL, 0.2 mL) and observed for 15 days. Body weight and mortality were recorded daily.
To evaluate the effects of RA on SE-induced enteritis, the mice were randomly divided into four groups: the blank control group, the RA control group, the SE infection control group and the RA + SE group. Mice in the RA control group and RA + SE group were orally administered with RA (20 mg/ kg·bw) daily for 7 days, and mice in SE group and the blank control group were orally administered an equivalent volume of PBS. On the 7th day, 12 h after RA pretreatment, the mice were intraperitoneally injected with SE (2.5 × 108 CFUs/mL, 0.2 mL). The mice were euthanized 24 h after the challenge. Serum, intestinal tissues and feces were collected for further analysis.
To analyze the effects of the gut microbiota on RA-induced protection, the mice were randomly divided into four groups: the blank control group, the SE infection control group, the antibiotic control group and the RA + SE + antibiotic group. Mice in the antibiotic control group and the RA + SE+ antibiotic group were orally administered with broad-spectrum antibiotics. Six hours after antibiotic treatment, mice in the RA + SE + antibiotics group were orally administered with RA (20 mg/ kg·bw) daily for 7 days, and the other mice were orally administered an equivalent volume of PBS. On the 7th day, 12 h after RA pretreatment, the mice were intraperitoneally injected with SE (2.5 × 108 CFUs/mL, 0.2 mL). The mice were euthanized 24 h after the challenge. Serum, intestinal tissues and feces were collected for further analysis. Broad-spectrum antibiotics included neomycin (100 mg/L), streptomycin (50 mg/L), penicillin (100 mg/L), vancomycin (50 mg/L) and metronidazole (100 mg/L).

2.11. Measurement of Biochemical Indicators

The levels of glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), malondialdehyde (MDA) and SOD in mouse serum were detected with a biochemical reagent kit according to the manufacturer’s instructions.

2.12. Measurement of Cytokine Levels

The levels of TNF-α, IL-1β and IL-6 were detected via ELISA kits according to the manufacturer’s instructions.

2.13. Histological Evaluation

Duodenal and colon tissues were collected, fixed in 4% paraformaldehyde and embedded in paraffin. Tissues were cut into 3 μm series slices, dewaxed in xylene, rehydrated in an ethanol gradient and then stained with hematoxylin and eosin. Histological pathology was scored according to a previously established scoring system on the basis of the degree of epithelial damage, inflammatory infiltrate in the mucosa, submucosa and muscularis/serosa, crypt damage, severity of inflammation, intestinal villus injury and damage to intestinal glands [33].

2.14. RT-qPCR

Total RNA was extracted from cells and intestinal tissues using a TRIzol kit according to the manufacturer’s instructions. Reverse transcription was performed with an ABM reagent kit according to the manufacturer’s instructions. The primers used for real-time PCR are listed in the Appendix A.1 (Table A1). All samples were analyzed via the Roche 96 Light Cycle 96 system (Roche, Sweden) and programmed to undergo one cycle (95 °C for 2 min) and 40 cycles (95 °C for 15 s, 60 °C for 30 s, and 72 °C for 20 s). The mRNA expression levels of the targeted genes were normalized to that of β-actin. All experiments were performed in triplicate.

2.15. Western Blot

Cells and intestinal tissues were lysed in RIPA lysis buffer. Protein concentrations were determined using the Bradford or bicinchoninic acid (BCA) kit. Aliquots containing 20 μg of protein were resolved by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes. The membranes were blocked with 5% BSA for 2 h at room temperature before being incubated overnight with primary antibodies diluted 1:1500 in 5% BSA. The membranes were then washed five times in 1× TBST, incubated with a secondary antibody conjugated to horseradish peroxidase at a dilution of 1:3000 with BSA at 37 °C for 1 h, and processed with an enhanced chemiluminescence (ECL) kit.

2.16. Analysis of 16S rDNA Sequencing

Intestinal contents were collected and stored at −80 °C. Fecal genomic DNA extraction and the evaluation of DNA purity and concentration were performed by Lianchuan Biotechnology Co., Ltd. (Hangzhou, China). PCR amplification of 16S rDNA, library construction, ion S5 sequencing and bioinformatics analysis were performed on the V3-V4 domain of 16S rDNA in the gut microbiota.

2.17. Data Analysis

All data were analyzed uisng GraphPad Prism (version 8. 0) to test for normal distributions. For normally distributed data, one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test was used to analyze significance. For non-normally distributed data, the Kruskal-Wallis test was used to analyze the body weight of mice, and the Mantle-Cox test was used to analyze the survival rates of mice, and the results were expressed as the mean ± standard deviation (SD); a p-value less than 0.05 was considered statistically significant.

3. Results

3.1. RA Alleviated Salmonella Enteritidis (SE) -Induced Inflammatory Responses In Vitro

The MIC of RA against SE was 1 mg/mL (Appendix A.2 (Table A2)). Moreover, pretreatment with 60 μg/mL of RA for 6 h had no significant effect on the viability of RAW264.7 cells and MCECs. Thus, 60 μg/mL RA was used for subsequent experiments (Figure 1A,B). To investigate the effects of RA on the phagocytic ability of RAW264.7 cells and the ability of SE to adhere to and invade MCECs, cells were challenged with FITC-labeled SE. Compared with the untreated control, RA significantly enhanced the RAW264.7 cell phagocytosis of SE in a dose-dependent manner (Figure 1C,D). Moreover, RA significantly reduced the invasion and adhesion of SE in MCECs (Figure 1E,F). SE infection causes the excessive secretion of proinflammatory cytokines. The RA pretreatment significantly decreased the levels of TNF-α, IL-1β and IL-6 (Figure 1G,H), indicating that RA inhibited the SE-induced inflammatory response. Overall, these results indicated that RA promoted macrophage phagocytosis, inhibited the adhesion and invasion of SE and alleviated the SE-induced inflammatory response in vitro.

3.2. RA Regulated TLR9/NF-κB Signaling Pathway

TLRs and the NF-κB signaling pathway play significant roles in bacterial invasion. In this study, we evaluated the effects of RA on the expression of TLR9 and the NF-κB signaling pathway. To assess the binding energy and interaction mode between RA and TLR9, we used Python 3.13.0, Yasara 24.10.5 and DS4.0 software to determine the protein–ligand docking and binding energy for each interaction. The results showed that RA could bind to the TLR9 protein, forming hydrogen bonds with the amino acid residues HIS394, ARG470 and ASP469 (Figure 2A). In addition, the free binding energy of RA for the TLR9 protein was −8.61 kcal/mol (Appendix A.3 (Table A3)), indicating that RA could spontaneously and stably bind to TLR9. The SE challenge inhibited the mRNA expression of TLR9 and increased the mRNA expression of TNF-α and IL-6, and RA significantly reversed these changes (Figure 2B–G). Furthermore, we found that RA pretreatment significantly increased the protein expression level of TLR9 and inhibited the protein expression levels of p-p65 and p-IκB-α compared to the SE infection control group (Figure 2H–O). Collectively, these results revealed that RA regulated TLR9 and inhibited the phosphorylation of p65 and IκB-α to limit the activation of the NF-κB signaling pathway against SE infection.
Figure 1. RA alleviated the cellular inflammation caused by SE. (A,B) Effects of RA on the viability of RAW264.7 cells and MCECs. The cells were treated with different concentrations of RA for 6 h, 12 h, 24 h, or 48 h, and a CCK-8 assay was used to detect cell viability. The cell survival rate data at the same time were obtained for statistical analysis (n = 6). (C,D) The fluorescence images and intensity of the phagocytic ability of RAW264.7 cells. The cells were pretreated with different concentrations of RA and challenged with FITC-labeled SE (MOI = 100) for 2 h (n = 3). (E) The bacteria adhering to MCECs. The cells were pretreated with different concentrations of RA, challenged with SE (MOI = 100) for 2 h and lysed with PBS containing 0.1% Triton X-100. The bacteria adhering to the cells were detected (n = 6). (F) The intracellular bacteria in MCECs. The cells were treated with RA and challenged with SE (MOI = 100) for 2 h, and then treated with DMEM containing 1% penicillin and streptomycin for 1 h. The cells were subsequently lysed with PBS containing 1% Triton X-100 and the intracellular bacteria were detected (n = 6). (G) Levels of TNF-α, IL-1β and IL-6 in RAW264.7 cells (n = 6). (H) Levels of TNF-α, IL-1β and IL-6 in MCECs (n = 6). Cells were pretreated with different concentrations of RA for 6 h, and challenged with SE (MOI = 100) for 2 h. Cytokine levels in the cell supernatant were detected via ELISA. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group, ### p < 0.001, #### p < 0.0001 versus the blank control group.
Figure 1. RA alleviated the cellular inflammation caused by SE. (A,B) Effects of RA on the viability of RAW264.7 cells and MCECs. The cells were treated with different concentrations of RA for 6 h, 12 h, 24 h, or 48 h, and a CCK-8 assay was used to detect cell viability. The cell survival rate data at the same time were obtained for statistical analysis (n = 6). (C,D) The fluorescence images and intensity of the phagocytic ability of RAW264.7 cells. The cells were pretreated with different concentrations of RA and challenged with FITC-labeled SE (MOI = 100) for 2 h (n = 3). (E) The bacteria adhering to MCECs. The cells were pretreated with different concentrations of RA, challenged with SE (MOI = 100) for 2 h and lysed with PBS containing 0.1% Triton X-100. The bacteria adhering to the cells were detected (n = 6). (F) The intracellular bacteria in MCECs. The cells were treated with RA and challenged with SE (MOI = 100) for 2 h, and then treated with DMEM containing 1% penicillin and streptomycin for 1 h. The cells were subsequently lysed with PBS containing 1% Triton X-100 and the intracellular bacteria were detected (n = 6). (G) Levels of TNF-α, IL-1β and IL-6 in RAW264.7 cells (n = 6). (H) Levels of TNF-α, IL-1β and IL-6 in MCECs (n = 6). Cells were pretreated with different concentrations of RA for 6 h, and challenged with SE (MOI = 100) for 2 h. Cytokine levels in the cell supernatant were detected via ELISA. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group, ### p < 0.001, #### p < 0.0001 versus the blank control group.
Antioxidants 13 01265 g001

3.3. RA Inhibited NF-κB Signaling Pathway by Upregulating TLR9

To confirm the relationship between TLR9 and the NF-κB signaling pathway in RA-mediated anti-inflammatory effects, the cells were pretreated with the TLR9 inhibitor E664 dihydrochloride. In the presence of E664 dihydrochloride, SE infection significantly increased the levels of TNF-α, IL-1β and IL-6 and reduced the mRNA expression level of TLR9. After pretreatment with E664 dihydrochloride, RA pretreatment failed to reverse these effects (Figure 3A–H). The protein expression levels of p-p65 and p-IκB-α in the inhibitor-treated group were significantly greater than those in the blank group, indicating that the suppression of TLR9 led to the activation of the NF-κB signaling pathway and caused the loss of the regulatory effect of RA on the NF-κB signaling pathway (Figure 3I–P). Overall, these results suggested that RA alleviated the SE-induced inflammatory response by promoting TLR9 expression to inhibit the NF-κB signaling pathway.

3.4. RA Provided Protection against SE in Mice

To investigate the protective effect and mechanism of RA on SE infection in vivo, the mice were orally treated with RA for 7 days. We found that RA reduced the mortality rate caused by SE (Figure 4A,B). Moreover, compared with the SE infection control group, RA significantly alleviated body weight loss, decreased the DAI, increased the length of the colon (Figure 4C–G) and decreased the organ indices of the liver and other organs (Appendix B.1, Figure A1). Consistently, we found that SE infection led to the enlargement of the intestinal cavity, damage to and detachment of the duodenal villi, reduction in colonic glands and thinning of the muscular layer (Figure 4H). Moreover, the RA pretreatment significantly improved the pathological damage to the duodenum and colon (Figure 4I,J). These results indicate that RA provided protection against SE in mice.

3.5. RA Alleviated SE-Induced Intestinal Inflammation and Oxidative Damage

Excessive inflammation and oxidative stress cause damage to organs and tissues. In this study, we found that SE infection caused a significant increase in the levels of GOT, GPT and MDA in serum, and led to a significant decrease in the SOD level in serum compared with the blank control group, suggesting SE infection led to oxidative damage, but RA significantly decreased the production of GOT, GPT and MDA, and significantly increased the SOD production compared with that in the SE infection control group, indicating that RA pretreatment may alleviate oxidative damage caused by SE infection in mice (Figure 5A–D). Moreover, SE infection significantly increased the production of TNF-α, IL-1β and IL-6 and inhibited TLR9 expression compared with the blank control group; however, the RA pretreatment alleviated the overproduction of inflammatory cytokines and the suppression of TLR9 compared with the SE infection control group (Figure 5E–H). Moreover, in comparison with the blank control group, SE infection significantly increased the protein expression levels of p-p65 and p-IκB-α, while RA downregulated SE-caused p-p65 and p-IκB-α expression (Figure 5I), which was consistent with the findings of the cell experiments. Collectively, these results indicated that RA improved SE-induced inflammatory and oxidative damage in mice, which may be associated with upregulating TLR9 and inhibiting the NF-κB signaling pathway.

3.6. RA Improved SE-Caused Intestinal Microbiota Disorder

The gut microbiota plays a crucial role in maintaining intestinal homeostasis. We analyzed the composition and structure of the gut microbiota to investigate the effect of RA on the gut microbiota of mice. A total of 16,027 significant features were obtained for the 16S rRNA genes of the four bacterial groups (Figure A2A). The rarefaction curve of the OTUs of the mouse gut bacterial community tended to flatten, and the sequencing depth basically covered most of the microbial species in the sample (Figure A3B). A Venn diagram of the overlapping and shared OTU data revealed that 766 OTUs in the RA pretreatment group were shared with those in the control group, and 733 OTUs in the infection control group were shared with those in the control group (Figure A3C). A Circos diagram revealed that after the RA pretreatment, Lachnospiraceae_NK4A136 dominated the intestinal microbiota in the mice at the genus level (Figure 6A). According to the α-diversity analysis, the species abundance of the gut microbiota in the SE infection control group was significantly lower than that in the control group, suggesting that SE could decrease the species diversity of the intestinal microbiota in mice. Compared with that in the SE infection control group, the α-diversity of the gut microbiota in the RA pretreatment group was significantly greater, indicating that RA had an effect on the abundance of bacterial species in the gut microbiota in the context of SE-induced intestinal inflammation (Figure 6B–D). A β-diversity analysis was performed via a principal coordinate analysis and non-metric multidimensional scaling analysis to explore the differences in the microbiota composition between the groups (Figure 6E and Appendix B.2, Figure A2). Clearly, a marked separation between the SE infection control group and the blank control group was observed, indicating that the microbiota composition was altered after modeling with SE. There was no overlap between the SE infection control group and the RA pretreatment group, indicating that RA altered the gut microbiota structure in mice infected with SE. These results suggested that the gut microbiota of the mice was uniquely altered after the RA supplementation. A taxonomic analysis at the phylum level revealed that SE infection caused an increase in the abundance of Proteobacteria, Epsilonbacteraeota and Bacteroidota as well as a decrease in the abundance of Fiemicutes and Acidibacteria; the RA pretreatment reversed this trend (Figure 6F–K). A taxonomic analysis at the genus level revealed that SE infection significantly increased the abundance of Muribaculaceae, Bilophila and Tyzzerella but decreased the abundance of Lachnospiraceae_NK4A136, Acetatifactor and Intestinimonas, and RA reversed the changes in the gut microbiota caused by SE (Figure 6L–R). The use of the linear discriminant analysis effect size (LEfSe) to display the microbial characteristics is the most likely to explain the differences between categories and to reveal the taxonomic groups with the greatest differences in abundance between different groups (Figure A3E). These results indicated that the RA pretreatment increased the abundance and diversity of the gut microbiota, upregulated the abundance of Lachnospiraceae_NK4A136, Acetatifactor and Intestinimonas, and reduced the abundance of Muribaculaceae, Bilophila and Tyzzerella at the genus level to improve the intestinal microbiota disorders caused by SE.

3.7. RA Failed to Provide Protection in Pseudo Germ-Free Mice

To verify the relationship between the RA-induced protection and the gut microbiota. We use of broad-spectrum antibiotics cleared the gut microbiota of the mice (Appendix B.3, Figure A3). In this study, we found that the elimination of the intestinal microbiota aggravated SE infection, and the mice without normal gut microbiota showed significant weight loss, increased DAI scores, intestinal enlargement and an increased organ coefficient of the liver and other organs (Figure 7A–F); the RA pretreatment did not reverse these changes. Moreover, the mice treated with broad-spectrum antibiotics presented a high level of TNF-α in serum after challenge with SE; RA did not alleviate the increase in TNF-α (Figure 7G). The pathological results of the duodenum showed that RA did not improve the SE-induced intestinal enlargement or intestinal villus damage in the duodenum (Figure 7H,I). These results suggested that the protective effect of RA against SE infection depends on the gut microbiota.

3.8. The Regulation of TLR9/NF-κB Signaling Pathway by RA Was Dependent on Gut Microbiota

To determine the relationship between the TLR9/NF-κB signaling pathway and gut microbiota regulated by RA, this study detected the expression of the TLR9/NF-κB signaling pathway in pseudo sterile mice. The SE challenge significantly decreased the mRNA expression of TLR9, but significantly increased the mRNA expression of TNF-α and IL-6 (Figure 8A–C). Moreover, the SE challenge significantly decreased the protein expression of TLR9 and significantly increased the protein expression of p-p65 and p-IκB-α, but RA did not reverse these effects (Figure 8D–G). These results indicated that the loss of the regulatory effect of RA on TLR9 led to the increased activation of the NF-κB signaling pathway and exacerbated intestinal inflammation in the pseudo sterile mice, which suggested that the gut microbiota is important for the protective effect of RA on SE infection.

4. Discussion

Salmonella enteritidis (SE) is a zoonotic pathogen that poses a great threat to human and animal health, causing significant economic losses to the livestock industry [28]. In modern society, the excessive intake of refined grains and insufficient intake of dietary fiber damage the gut microbiota, leading to a decrease in resistance to intestinal pathogen infections [34,35]. Antibiotics are often used to control SE infection, but their excessive use leads to the production of drug-resistant SE. Additionally, the excessive use of antibiotics disturbs the gut microbiota and damages the intestinal barrier [36]. Moreover, the inflammation induced by Salmonella typhimurium accelerated the transfer of plasmids and bacteriophages, promoting the spread of antibiotic resistance [37]. Therefore, there is an urgent need to find new drug strategies that can reduce bacterial resistance and prevent SE infection.
The control of inflammation and balance of the gut microbiota balance is important for resisting SE infection. The effective active ingredients of natural plants exhibit anti-inflammatory and antibacterial effects as well as low toxicity, and maintain the balance of the gut microbiota. Importantly, they are not prone to drug resistance. Like Ganoderma lucidum polysaccharide [38] and Astragalus polysaccharide [39], they are candidate drugs for limiting inflammation and regulating the gut microbiota caused by SE. RA, a compound derived from plants in the Lamiaceae family, has anti-inflammatory and antioxidant effects. However, its protective effects and mechanisms against SE challenge in vitro and in vivo are not yet clear. In this study, we found that the MIC of RA against SE was 1 mg/mL, which was consistent with the findings of a previous study [32]. Intestinal epithelial cells are the main target cells for SE infection, and SE invades intestinal epithelial cells and causes systemic infection and inflammatory reactions [40]. During infection, macrophages strongly phagocytose SE to reduce its adhesion and invasion to intestinal epithelial cells. Furthermore, we found that RA enhanced the ability of RAW264.7 cells to phagocytose SE, reduced the ability of SE to adhere and invade MCECs and alleviated the SE-induced overproduction of TNF-α, IL-1β and IL-6. Our study revealed that RA offered protection against SE in vivo. We found that RA reduced the mortality rate of the SE-challenged mice, significantly alleviated the SE-induced decreases in body weight and DAI, increased the organ index and shortened the colon. Additionally, the RA pretreatment significantly improved the pathological changes in the duodenum and colon in the SE-infected mice. Previous studies have shown that SE infection significantly decreased the SOD and GSH activities in Caco-2 cells and mice, which was consistent with our findings [9,41]. These alterations may be attributed to the active defense against the oxidative damage to intestinal epithelial cells after Salmonella infection [42]. Additionally, our data revealed that SE infection increased the TNF-α, IL-1β and IL-6 and MDA levels. MDA, a sensitive index assessing the degree of oxidative injury, was linked to chronic inflammation in the gut [43]. High levels of TNF-α, IL-1β and IL-6 and MDA in the SE-stimulated mice indicated that SE infection caused an imbalance in the redox status, resulting in oxidative stress and inflammatory responses. However, the mice pretreated with RA displayed a remarkable increase in SOD activity in serum, and a notable reduction in the levels of TNF-α, IL-1β and IL-6 and MDA in the serum, indicating that RA could enhance the antioxidant and anti-inflammatory ability to provide protection against SE.
TLRs are pattern recognition receptors that recognize a broad variety of structurally conserved molecules derived from microbes [44]. TLRs play a crucial role in preventing host invasion in pathogenic infections, and TLR2, TLR4 and TLR9 are involved in the defense against Salmonella in vivo [45]. TLR9 is vital for resistance to Salmonella infection, and its absence leads to severe Salmonella hepatitis, a high bacterial load, sustained inflammation and tissue damage [14,15,46]. In our study, we discovered that RA and TLR9 had multiple binding sites, and that RA bound well to the TLR9 protein, forming hydrogen bonds with the amino acid residues HIS394, ARG470 and ASP469. Consistently, we found that the RA pretreatment significantly upregulated the mRNA and protein expression of TLR9. After blocking TLR9 expression, RA failed to protect against SE infection, suggesting that the protection induced by RA was dependent on TLR9, which was consistent with the findings of a previous study, showing that TLR9 negatively regulates the NF-κB signaling pathway to alleviate IEC inflammation caused by Salmonella typhimurium [15]. The NF-κB signaling pathway is activated by various stimuli to regulate the inflammatory response [47]. The phosphorylation and nuclear translocation of p65 and IκB-α can activate the NF-κB signaling pathway, which plays a crucial role in regulating TNF-α, IL-1β and IL-6 [48]. Our study revealed that RA significantly inhibited the NF-κB signaling pathway to decrease the expression of TNF-α, IL-1β and IL-6, exerting a protective effect on Salmonella-induced intestinal and cellular inflammation. However, TLR9 suppression led to the loss of the ability of RA to inhibit the secretion of proinflammatory cytokines and the phosphorylation of p65 and IκB-α in vitro. Overall, our study suggested that RA inhibited the activation of the NF-κB signaling pathway by increasing TLR9 expression to alleviate SE-induced intestinal inflammation.
The gut is colonized by a large and diverse microbiota, and the microbiota composition is vital to the intestinal barrier [49]. High levels of fiber, unsaturated fatty acids and polyphenols in food are beneficial for physical health [50]. As a polyphenolic acid compound with medicinal and edible homology, RA is an effective active ingredient in plants rich in dietary fiber [51], and it has a protective effect on the gut microbiota [52]. The invasion of exogenous microorganisms leads to a decrease in the microbial diversity of the intestinal flora. Our study revealed that SE infection resulted in a decrease in the abundance and diversity of the gut microbiota in mice, whereas RA effectively increased the abundance and diversity of the gut microbiota. In the present study, the RA pretreatment increased the abundance of Firmicutes and Acidibacteria and decreased the abundance of Proteobacteria, Epsilonbacteraeota and Bacteroidota at the phylum level. Lachnospiraceae_NK4A136 is a representative bacterium that produces butyric acid and contributes to maintaining intestinal barrier function [53]. After the RA pretreatment, Lachnospiraceae_NK4A136 dominated the mouse gut microbiota at the genus level, suggesting that RA alleviated Salmonella-induced intestinal damage and maintained intestinal health through Lachnospiraceae_NK4A136. The long-term use of broad-spectrum antibiotics can greatly interfere with or eliminate gut microbiota, and thus weaken the resistance of the gut microbiota to colonization by exogenous pathogens [54]. After the clearance of the gut microbiota, the susceptibility of the intestine to SE increased [55]. Therefore, the gut microbiota plays an extremely important role in resisting SE infection. When the intestinal microbiota was cleared with broad-spectrum antibiotics, RA failed to alleviate inflammation and duodenum damage. Furthermore, RA also failed to regulate the expression of p-p65, p-IκB-α, proinflammatory cytokines and TLR9 in the SE-challenged mice, revealing that the gut microbiota played an important role in the protective effect of RA. The gut microbiota is a prerequisite for resisting exogenous pathogen infection; however, further research is needed on how RA upregulates TLR9 to inhibit the activation of the NF-κB signaling pathway through the gut microbiota to resist SE infection, and whether it directly affects the metabolites of the gut microbiota.

5. Conclusions

In summary, our study demonstrated that RA alleviated SE-induced inflammation by upregulating TLR9 and inhibiting the NF-κB signaling pathway, which is closely related to maintaining gut microbiota homeostasis in mice. Supplementing with RA may be a preventive strategy to alleviate the damage caused by SE in humans and animals. Our study provided theoretical support for the application and development of RA in the prevention and treatment of SE infection.

Author Contributions

Original draft, review editing, methodology, visualization and data curation, D.Y.; methodology and software, L.Q.; formal analysis and investigation, X.L.; conceptualization and validation, Y.L.; data curation and validation, L.Z.; formal analysis and visualization, M.W.; methodology and supervision, Y.P.; formal analysis, methodology and review editing, Z.L.; methodology, resources and review editing, J.H. All data were generated in-house, and no paper mill was used. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation grant number 31960717 and the Innovation Project of Guangxi Graduate Education YCBZ number 2021007.

Institutional Review Board Statement

This study was conducted according to the recommendations of the Academy of Animal Research Guidelines and approved by the Animal Ethics Committee of Guangxi University (protocol number: GXU-2022-336).

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Abbreviations

TLR9: toll-like receptor-9; NF-κB, nuclear factor kappa-light-chain-enhancer of activated B cells; SE (used in the chart), Salmonella enterica; GOT, glutamic oxaloacetic transaminase; GPT, glutamic-pyruvic transaminase; IL-1β, interleukin-1β; IL-6, interleukin-6; LB, Luria-Bertani culture medium; MDA, malondialdehyde; p-p65, phosphorylated p65; p-IκB-α, phosphorylated IκB-α; RA, rosmarinic acid; SOD, superoxide dismutase; TNF-α, tumour necrosis factor α; PAMPs, pathogen-associated molecular patterns; E6446 (used in the chart), E6446 dihydrochloride; MIC, minimum inhibitory concentration; BSA, bovine serum albumin; 20 mg/kg·bw, 20 mg/ kg·body weight.

Appendix A

Appendix A.1

Table A1. Primers for RT-qPCR.
Table A1. Primers for RT-qPCR.
Target GeneForward (5′–3′)Reverse (5′–3′)Genbank Number
TNF-αCGCTGAGGTCAATCTGCGGCTGGGTAGAGAATGGAXM_042684006.1
IL-6ACAGAAGGAGTGGCTAAGGAAGGCATAACGCACTAGGTTTXM_032905335.1
TLR9CAGGAGCGGTGAAGGTGGAAGGGAGGTCAGATTGGCNM_031178.2
β-actinCCTCACTGTCCACCTTCCGGGTGTAAAACGCAGCTCXM_058569360.1

Appendix A.2

The minimum inhibitory concentration of RA against SE. The minimum inhibitory concentration of RA against SE is 1 mg/mL.
Table A2. The minimum inhibitory concentration of RA against SE.
Table A2. The minimum inhibitory concentration of RA against SE.
Drug Concentration (mg/mL)4.002.001.000.5000.2500.1250.06250.03130.01570.00785Positive ControlNegative Control
1++++++++
2++++++++
3++++++++
+ represents positive, indicating the presence of bacterial precipitation, − represents negative, and no bacterial precipitation appears.

Appendix A.3

The free binding energy of RA and the TLR9 protein is −8.6100 kcal/mL.
Table A3. The free binding energy of RA and TLR9 protein.
Table A3. The free binding energy of RA and TLR9 protein.
RunBind. Energy [kcal/mol]Dissoc. Constant [pM]Contacting Receptor Residues
001000008.610000000000488412.0000HIS A 394 THR A 395 ARG A 418 PHE A 419 PHE A 467 ASP A 469 ARG A 470 CYS A 471 LYS A 472 ASN A 473 LYS A 475 THR A 477 ASP A 479 SER A 481 ARG A 482 SER A 503 SER A 505 HIS A 506 ASP A 528
002000008.6100 00000000488412.0000HIS A 394 THR A 395 ARG A 418 PHE A 419 PHE A 467 ASP A 469 ARG A 470 CYS A 471 LYS A 472 ASN A 473 LYS A 475 THR A 477 ASP A 479 SER A 481 ARG A 482 SER A 503 SER A 505 HIS A 506 ASP A 528
003000008.4100 00000000684523.3125ARG A 418 PHE A 419 PHE A 467 ASP A 469 CYS A 471 LYS A 472 ASN A 473 LYS A 475 THR A 477 ASP A 479 SER A 481 SER A 503 SER A 505 ASP A 528 SER A 530
004000008.4100 00000000684523.3125ARG A 418 PHE A 419 PHE A 467 ASP A 469 CYS A 471 LYS A 472 ASN A 473 LYS A 475 THR A 477 ASP A 479 SER A 481 SER A 503 SER A 505 ASP A 528 SER A 530
005000008.3810 00000000718862.0000HIS A 394 THR A 395 HIS A 397 ARG A 418 PHE A 419 PHE A 467 ASP A 469 ARG A 470 CYS A 471 LYS A 472 ASN A 473 LYS A 475 THR A 477 ASP A 479 SER A 503
006000008.3810 00000000718862.0000HIS A 394 THR A 395 HIS A 397 ARG A 418 PHE A 419 PHE A 467 ASP A 469 ARG A 470 CYS A 471 LYS A 472 ASN A 473 LYS A 475 THR A 477 ASP A 479 SER A 503
007000008.3720 00000000729865.1875PRO A 30 ALA A 31 PHE A 32 LEU A 33 CYS A 35 GLU A 36 LEU A 37 LYS A 38 PRO A 39 GLN A 779 THR A 780 VAL A 782 PRO A 783 GLY A 784 LEU A 785 ALA A 786
008000008.3720 00000000729865.1875PRO A 30 ALA A 31 PHE A 32 LEU A 33 CYS A 35 GLU A 36 LEU A 37 LYS A 38 PRO A 39 GLN A 779 THR A 780 VAL A 782 PRO A 783 GLY A 784 LEU A 785 ALA A 786

Appendix B

Appendix B.1

The organ coefficient is an important indicator for evaluating the degree of bacterial infection. SE infection leads to a significant decrease in the weight and food and water intake of mice, as well as pathological phenomena such as organ edema and congestion. Therefore, the increase in the organ coefficient was caused by SE infection. After the pretreatment with RA, the increase in the organ coefficient in the liver, kidney and spleen caused by SE was significantly reduced.
Figure A1. The protective effect of RA on SE-infected mice. Organ indices of the liver, kidney and spleen (n = 6). Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group.
Figure A1. The protective effect of RA on SE-infected mice. Organ indices of the liver, kidney and spleen (n = 6). Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group.
Antioxidants 13 01265 g0a1

Appendix B.2

RA regulated the gut microbiota in the SE-infected mice.
Figure A2. RA regulated gut microbiota in SE-infected mice. (A): Feature numbers; (B): rare curve of the OTU level; (C): Venn diagram; (D): non-metric multi-dimensional scaling analysis; (E): linear discriminant analysis effect size.
Figure A2. RA regulated gut microbiota in SE-infected mice. (A): Feature numbers; (B): rare curve of the OTU level; (C): Venn diagram; (D): non-metric multi-dimensional scaling analysis; (E): linear discriminant analysis effect size.
Antioxidants 13 01265 g0a2

Appendix B.3

The broad-spectrum antibiotic pretreatment significantly reduced the number of intestinal bacteria in the mice.
Figure A3. Broad-spectrum antibiotic pretreatment significantly reduced the number of intestinal bacteria in mice. The broad-spectrum antibiotics used included neomycin (100 mg/L), streptomycin (50 mg/L), penicillin (100 mg/L), vancomycin (50 mg/L), and metronidazole (100 mg/L). The mice were orally administered with 0.5 mL of broad-spectrum antibiotics by gavage for 7 d (n = 6). After 7 d, 10 g of mouse feces was collected under sterile conditions. The feces were diluted with 1 g/mL sterile water and cultured anaerobically and aerobically on LB medium via the dilution coating plate method. The bacterial colonies on the plate were counted after 12 h at 37 °C. Student’s t-test was used for statistical analysis. **** for p < 0.0001 versus the blank control group.
Figure A3. Broad-spectrum antibiotic pretreatment significantly reduced the number of intestinal bacteria in mice. The broad-spectrum antibiotics used included neomycin (100 mg/L), streptomycin (50 mg/L), penicillin (100 mg/L), vancomycin (50 mg/L), and metronidazole (100 mg/L). The mice were orally administered with 0.5 mL of broad-spectrum antibiotics by gavage for 7 d (n = 6). After 7 d, 10 g of mouse feces was collected under sterile conditions. The feces were diluted with 1 g/mL sterile water and cultured anaerobically and aerobically on LB medium via the dilution coating plate method. The bacterial colonies on the plate were counted after 12 h at 37 °C. Student’s t-test was used for statistical analysis. **** for p < 0.0001 versus the blank control group.
Antioxidants 13 01265 g0a3

References

  1. LaRock, D.L.; Chaudhary, A.; Miller, S.I. Salmonellae interactions with host processes. Nat. Rev. Microbiol. 2015, 13, 191–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Karp, B.E.; Leeper, M.M.; Chen, J.C.; Tagg, K.A.; Francois Watkins, L.K.; Friedman, C.R. Multidrug-Resistant Salmonella Serotype Anatum in Travelers and Seafood from Asia, United States. Emerg. Infect. Dis. 2020, 26, 1030–1033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Oueslati, W.; Rjeibi, M.R.; Mhadhbi, M.; Jbeli, M.; Zrelli, S.; Ettriqui, A. Prevalence, virulence and antibiotic susceptibility of Salmonella spp. strains, isolated from beef in Greater Tunis (Tunisia). Meat Sci. 2016, 119, 154–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Lin, D.; Yan, M.; Lin, S.; Chen, S. Increasing prevalence of hydrogen sulfide negative Salmonella in retail meats. Food Microbiol. 2014, 43, 1–4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Elbediwi, M.; Pan, H.; Biswas, S.; Li, Y.; Yue, M. Emerging colistin resistance in Salmonella enterica serovar Newport isolates from human infections. Emerg. Microbes Infect. 2020, 9, 535–538. [Google Scholar] [CrossRef] [Scilit]
  6. Shi, S.; Wu, S.; Shen, Y.; Zhang, S.; Xiao, Y.; He, X.; Gong, J.; Farnell, Y.; Tang, Y.; Huang, Y.; et al. Iron oxide nanozyme suppresses intracellular Salmonella Enteritidis growth and alleviates infection in vivo. Theranostics 2018, 8, 6149–6162. [Google Scholar] [CrossRef] [Scilit]
  7. Zhang, K.; Griffiths, G.; Repnik, U.; Hornef, M. Seeing is understanding: Salmonella’s way to penetrate the intestinal epithelium. Int. J. Med. Microbiol. 2018, 308, 97–106. [Google Scholar] [CrossRef] [Scilit]
  8. Jacobson, A.; Lam, L.; Rajendram, M.; Tamburini, F.; Honeycutt, J.; Pham, T.; Van Treuren, W.; Pruss, K.; Stabler, S.R.; Lugo, K.; et al. A Gut Commensal-Produced Metabolite Mediates Colonization Resistance to Salmonella Infection. Cell Host Microbe 2018, 24, 296–307.e297. [Google Scholar] [CrossRef] [Scilit]
  9. Guo, F.; Liu, H.; Li, X.; Hu, Z.; Huang, J.; Bi, R.; Abbas, W.; Guo, Y.; Wang, Z. Sophy β-Glucan from the Black Yeast Aureobasidium pullulans Attenuates Salmonella-Induced Intestinal Epithelial Barrier Injury in Caco-2 Cell Monolayers via Exerting Anti-Oxidant and Anti-Inflammatory Properties. Antioxidants 2023, 13, 48. [Google Scholar] [CrossRef] [Scilit]
  10. Masud, S.; Prajsnar, T.K.; Torraca, V.; Lamers, G.E.M.; Benning, M.; Van Der Vaart, M.; Meijer, A.H. Macrophages target Salmonella by Lc3-associated phagocytosis in a systemic infection model. Autophagy 2019, 15, 796–812. [Google Scholar] [CrossRef] [Scilit]
  11. Kawai, T.; Akira, S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 2011, 34, 637–650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Khanmohammadi, S.; Rezaei, N. Role of Toll-like receptors in the pathogenesis of COVID-19. J. Med. Virol. 2021, 93, 2735–2739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Vaknin, I.; Blinder, L.; Wang, L.; Gazit, R.; Shapira, E.; Genina, O.; Pines, M.; Pikarsky, E.; Baniyash, M. A common pathway mediated through Toll-like receptors leads to T- and natural killer-cell immunosuppression. Blood 2008, 111, 1437–1447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Zhan, R.; Han, Q.; Zhang, C.; Tian, Z.; Zhang, J. Toll-Like receptor 2 (TLR2) and TLR9 play opposing roles in host innate immunity against Salmonella enterica serovar Typhimurium infection. Infect. Immun. 2015, 83, 1641–1649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Li, Y.; Liu, M.; Zuo, Z.; Liu, J.; Yu, X.; Guan, Y.; Zhan, R.; Han, Q.; Zhang, J.; Zhou, R.; et al. TLR9 Regulates the NF-κB-NLRP3-IL-1β Pathway Negatively in Salmonella-Induced NKG2D-Mediated Intestinal Inflammation. J. Immunol. 2017, 199, 761–773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Zhang, Y.; Chen, R.; Zhang, D.; Qi, S.; Liu, Y. Metabolite interactions between host and microbiota during health and disease: Which feeds the other? Biomed. Pharmacother. 2023, 160, 114295. [Google Scholar] [CrossRef] [Scilit]
  17. Brown, E.M.; Clardy, J.; Xavier, R.J. Gut microbiome lipid metabolism and its impact on host physiology. Cell Host Microbe 2023, 31, 173–186. [Google Scholar] [CrossRef] [Scilit]
  18. Malesza, I.J.; Malesza, M.; Walkowiak, J.; Mussin, N.; Walkowiak, D.; Aringazina, R.; Bartkowiak-Wieczorek, J.; Mądry, E. High-Fat, Western-Style Diet, Systemic Inflammation, and Gut Microbiota: A Narrative Review. Cells 2021, 10, 3164. [Google Scholar] [CrossRef] [Scilit]
  19. Chen, C.; Liao, J.; Xia, Y.; Liu, X.; Jones, R.; Haran, J.; McCormick, B.; Sampson, T.R.; Alam, A.; Ye, K. Gut microbiota regulate Alzheimer’s disease pathologies and cognitive disorders via PUFA-associated neuroinflammation. Gut 2022, 71, 2233–2252. [Google Scholar] [CrossRef] [Scilit]
  20. Yang, G.; Wei, J.; Liu, P.; Zhang, Q.; Tian, Y.; Hou, G.; Meng, L.; Xin, Y.; Jiang, X. Role of the gut microbiota in type 2 diabetes and related diseases. Metab. Clin. Exp. 2021, 117, 154712. [Google Scholar] [CrossRef] [Scilit]
  21. Ducarmon, Q.R.; Zwittink, R.D.; Hornung, B.V.H.; van Schaik, W.; Young, V.B.; Kuijper, E.J. Gut Microbiota and Colonization Resistance against Bacterial Enteric Infection. Microbiol. Mol. Biol. Rev. 2019, 83, e00007-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Lubin, J.B.; Green, J.; Maddux, S.; Denu, L.; Duranova, T.; Lanza, M.; Wynosky-Dolfi, M.; Flores, J.N.; Grimes, L.P.; Brodsky, I.E.; et al. Arresting microbiome development limits immune system maturation and resistance to infection in mice. Cell Host Microbe 2023, 31, 554–570.e557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Liu, J.; Liu, H.; Liu, H.; Teng, Y.; Qin, N.; Ren, X.; Xia, X. Live and pasteurized Akkermansia muciniphila decrease susceptibility to Salmonella Typhimurium infection in mice. J. Adv. Res. 2023, 52, 89–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Tsou, L.K.; Lara-Tejero, M.; RoseFigura, J.; Zhang, Z.J.; Wang, Y.C.; Yount, J.S.; Lefebre, M.; Dossa, P.D.; Kato, J.; Guan, F.; et al. Antibacterial Flavonoids from Medicinal Plants Covalently Inactivate Type III Protein Secretion Substrates. J. Am. Chem. Soc. 2016, 138, 2209–2218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Jin, B.R.; Chung, K.S.; Hwang, S.; Hwang, S.N.; Rhee, K.J.; Lee, M.; An, H.J. Rosmarinic acid represses colitis-associated colon cancer: A pivotal involvement of the TLR4-mediated NF-κB-STAT3 axis. Neoplasia 2021, 23, 561–573. [Google Scholar] [CrossRef] [Scilit]
  26. Chung, C.H.; Jung, W.; Keum, H.; Kim, T.W.; Jon, S. Nanoparticles Derived from the Natural Antioxidant Rosmarinic Acid Ameliorate Acute Inflammatory Bowel Disease. ACS Nano 2020, 14, 6887–6896. [Google Scholar] [CrossRef] [Scilit]
  27. Elian, C.; Andaloussi, S.A.; Moilleron, R.; Decousser, J.W.; Boyer, C.; Versace, D.L. Biobased polymer resources and essential oils: A green combination for antibacterial applications. J. Mater. Chem. B 2022, 10, 9081–9124. [Google Scholar] [CrossRef] [Scilit]
  28. Righi, N.; Boumerfeg, S.; Fernandes, P.A.R.; Deghima, A.; Baali, F.; Coelho, E.; Cardoso, S.M.; Coimbra, M.A.; Baghiani, A. Thymus algeriensis Bioss & Reut: Relationship of phenolic compounds composition with in vitro/in vivo antioxidant and antibacterial activity. Food Res. Int. 2020, 136, 109500. [Google Scholar] [CrossRef] [Scilit]
  29. Huerta-Madroñal, M.; Caro-León, J.; Espinosa-Cano, E.; Aguilar, M.R.; Vázquez-Lasa, B. Chitosan–Rosmarinic acid conjugates with antioxidant, anti-inflammatory and photoprotective properties. Carbohydr. Polym. 2021, 273, 118619. [Google Scholar] [CrossRef] [Scilit]
  30. Dahchour, A. Anxiolytic and antidepressive potentials of rosmarinic acid: A review with a focus on antioxidant and anti-inflammatory effects. Pharmacol. Res. 2022, 184, 106421. [Google Scholar] [CrossRef] [Scilit]
  31. Noor, S.; Mohammad, T.; Rub, M.A.; Raza, A.; Azum, N.; Yadav, D.K.; Hassan, M.I.; Asiri, A.M. Biomedical features and therapeutic potential of rosmarinic acid. Arch. Pharmacal Res. 2022, 45, 205–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Zhang, J.; Cui, X.; Zhang, M.; Bai, B.; Yang, Y.; Fan, S. The antibacterial mechanism of perilla rosmarinic acid. Biotechnol. Appl. Biochem. 2022, 69, 1757–1764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Singla, B.; Holmdahl, R.; Csanyi, G. Editorial: Oxidants and Redox Signaling in Inflammation. Front. Immunol. 2019, 10, 545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Schnupf, P.; Gaboriau-Routhiau, V.; Cerf-Bensussan, N. Modulation of the gut microbiota to improve innate resistance. Curr. Opin. Immunol. 2018, 54, 137–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Desai, M.S.; Seekatz, A.M.; Koropatkin, N.M.; Kamada, N.; Hickey, C.A.; Wolter, M.; Pudlo, N.A.; Kitamoto, S.; Terrapon, N.; Muller, A.; et al. A Dietary Fiber-Deprived Gut Microbiota Degrades the Colonic Mucus Barrier and Enhances Pathogen Susceptibility. Cell 2016, 167, 1339–1353.e1321. [Google Scholar] [CrossRef] [Scilit]
  36. Li, J.; Cha, R.; Zhao, X.; Guo, H.; Luo, H.; Wang, M.; Zhou, F.; Jiang, X. Gold Nanoparticles Cure Bacterial Infection with Benefit to Intestinal Microflora. ACS Nano 2019, 13, 5002–5014. [Google Scholar] [CrossRef] [Scilit]
  37. Wotzka, S.Y.; Nguyen, B.D.; Hardt, W.D. Salmonella Typhimurium Diarrhea Reveals Basic Principles of Enteropathogen Infection and Disease-Promoted DNA Exchange. Cell Host Microbe 2017, 21, 443–454. [Google Scholar] [CrossRef] [Scilit]
  38. Li, M.; Yu, L.; Zhai, Q.; Chu, C.; Wang, S.; Zhao, J.; Zhang, H.; Tian, F.; Chen, W. Combined Ganoderma lucidum polysaccharide and ciprofloxacin therapy alleviates Salmonella enterica infection, protects the intestinal barrier, and regulates gut microbiota. Food Funct. 2023, 14, 6896–6913. [Google Scholar] [CrossRef] [Scilit]
  39. Dong, N.; Li, X.; Xue, C.; Wang, C.; Xu, X.; Bi, C.; Shan, A.; Li, D. Astragalus polysaccharides attenuated inflammation and balanced the gut microflora in mice challenged with Salmonella typhimurium. Int. Immunopharmacol. 2019, 74, 105681. [Google Scholar] [CrossRef] [Scilit]
  40. Yuan, H.; Zhou, L.; Chen, Y.; You, J.; Hu, H.; Li, Y.; Huang, R.; Wu, S. Salmonella effector SopF regulates PANoptosis of intestinal epithelial cells to aggravate systemic infection. Gut Microbes 2023, 15, 2180315. [Google Scholar] [CrossRef] [Scilit]
  41. Shi, Z.; Nan, Y.; Zhou, X.; Zhang, W.; Zhang, Z.; Zhang, C.; Duan, H.; Ge, J.; Zhao, L. Molecular Mechanisms of Intestinal Protection by Levilactobacillus brevis 23017 against Salmonella typhimurium C7731-Induced Damage: Role of Nrf2. Microorganisms 2024, 12, 1135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Ookawara, T.; Imazeki, N.; Matsubara, O.; Kizaki, T.; Oh-Ishi, S.; Nakao, C.; Sato, Y.; Ohno, H. Tissue distribution of immunoreactive mouse extracellular superoxide dismutase. Am. J. Physiol. 1998, 275, C840–C847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Sottero, B.; Rossin, D.; Poli, G.; Biasi, F. Lipid Oxidation Products in the Pathogenesis of Inflammation-related Gut Diseases. Curr. Med. Chem. 2018, 25, 1311–1326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Wesch, D.; Peters, C.; Oberg, H.H.; Pietschmann, K.; Kabelitz, D. Modulation of γδ T cell responses by TLR ligands. Cell. Mol. Life Sci. 2011, 68, 2357–2370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Arpaia, N.; Godec, J.; Lau, L.; Sivick, K.E.; McLaughlin, L.M.; Jones, M.B.; Dracheva, T.; Peterson, S.N.; Monack, D.M.; Barton, G.M. TLR signaling is required for Salmonella typhimurium virulence. Cell 2011, 144, 675–688. [Google Scholar] [CrossRef] [Scilit]
  46. Celhar, T.; Yasuga, H.; Lee, H.Y.; Zharkova, O.; Tripathi, S.; Thornhill, S.I.; Lu, H.K.; Au, B.; Lim, L.H.K.; Thamboo, T.P.; et al. Toll-Like Receptor 9 Deficiency Breaks Tolerance to RNA-Associated Antigens and Up-Regulates Toll-Like Receptor 7 Protein in Sle1 Mice. Arthritis Rheumatol. 2018, 70, 1597–1609. [Google Scholar] [CrossRef] [Scilit]
  47. Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-κB pathway for the therapy of diseases: Mechanism and clinical study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [CrossRef] [Scilit]
  48. Feng, Z.; Li, X.; Lin, J.; Zheng, W.; Hu, Z.; Xuan, J.; Ni, W.; Pan, X. Oleuropein inhibits the IL-1β-induced expression of inflammatory mediators by suppressing the activation of NF-κB and MAPKs in human osteoarthritis chondrocytes. Food Funct. 2017, 8, 3737–3744. [Google Scholar] [CrossRef] [Scilit]
  49. Fung, T.C.; Olson, C.A.; Hsiao, E.Y. Interactions between the microbiota, immune and nervous systems in health and disease. Nat. Neurosci. 2017, 20, 145–155. [Google Scholar] [CrossRef] [Scilit]
  50. Perler, B.K.; Friedman, E.S.; Wu, G.D. The Role of the Gut Microbiota in the Relationship Between Diet and Human Health. Annu. Rev. Physiol. 2023, 85, 449–468. [Google Scholar] [CrossRef] [Scilit]
  51. Oliveira-Alves, S.C.; Vendramini-Costa, D.B.; Betim Cazarin, C.B.; Maróstica Júnior, M.R.; Borges Ferreira, J.P.; Silva, A.B.; Prado, M.A.; Bronze, M.R. Characterization of phenolic compounds in chia (Salvia hispanica L.) seeds, fiber flour and oil. Food Chem. 2017, 232, 295–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Zhou, Z.; He, W.; Tian, H.; Zhan, P.; Liu, J. Thyme (Thymus vulgaris L.) polyphenols ameliorate DSS-induced ulcerative colitis of mice by mitigating intestinal barrier damage, regulating gut microbiota, and suppressing TLR4/NF-κB-NLRP3 inflammasome pathways. Food Funct. 2023, 14, 1113–1132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Ma, L.; Ni, Y.; Wang, Z.; Tu, W.; Ni, L.; Zhuge, F.; Zheng, A.; Hu, L.; Zhao, Y.; Zheng, L.; et al. Spermidine improves gut barrier integrity and gut microbiota function in diet-induced obese mice. Gut Microbes 2020, 12, 1832857. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Li, D.T.; Feng, Y.; Tian, M.L.; Ji, J.F.; Hu, X.S.; Chen, F. Gut microbiota-derived inosine from dietary barley leaf supplementation attenuates colitis through PPARγ Signaling activation. Microbiome 2021, 9, 83. [Google Scholar] [CrossRef] [Scilit]
  55. Fang, D.; Xu, T.Q.; Sun, J.Y.; Shi, J.R.; Li, F.L.; Yin, Y.Q.; Wang, Z.Q.; Liu, Y. Nicotinamide Mononucleotide Ameliorates Sleep Deprivation-Induced Gut Microbiota Dysbiosis and Restores Colonization Resistance against Intestinal Infections. Adv. Sci. 2023, 10, e2207170. [Google Scholar] [CrossRef] [Scilit]
Figure 2. RA alleviated inflammation caused by SE via regulating the TLR9/NF-κB signaling pathway. Cells were pretreated with different concentrations of RA for 6 h and challenged with SE (MOI = 100) for 2 h; cells were collected for RT-qPCR or Western blot detection. (A) Molecular docking analysis of the binding mode and affinity of RA for TLR9. (BD) The mRNA expression levels of TLR9, TNF-α and IL-6 in RAW264.7 cells (n = 6). (EG) The mRNA expression levels of TLR9, TNF-α and IL-6 in MCECs (n = 6). (HO) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in RAW264.7 cells and MCECs (n = 3). Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group.
Figure 2. RA alleviated inflammation caused by SE via regulating the TLR9/NF-κB signaling pathway. Cells were pretreated with different concentrations of RA for 6 h and challenged with SE (MOI = 100) for 2 h; cells were collected for RT-qPCR or Western blot detection. (A) Molecular docking analysis of the binding mode and affinity of RA for TLR9. (BD) The mRNA expression levels of TLR9, TNF-α and IL-6 in RAW264.7 cells (n = 6). (EG) The mRNA expression levels of TLR9, TNF-α and IL-6 in MCECs (n = 6). (HO) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in RAW264.7 cells and MCECs (n = 3). Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group.
Antioxidants 13 01265 g002
Figure 3. RA inhibited the activation of NF-κB signaling pathway by upregulating TLR9. The cells were pretreated with 10 μM E6446 (TLR9 inhibitor dihydrochloride) for 2 h, and co-incubated with RA for 6 h and then challenged with SE (MOI = 100) for 2 h. The cell supernatants were collected to detect cytokines, and the cells were collected for RT–qPCR or Western blot detection. (A,B) Levels of proinflammatory cytokines in RAW264.7 cells and MCECs (n = 6). (CE) The mRNA expression levels of TLR9, TNF-α and IL-6 in RAW264.7 cells (n = 6). (FH) The mRNA expression levels of TLR9, TNF-α and IL-6 in MCECs (n = 6). (IL) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in RAW264.7 cells (n = 3). (MP) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in MCECs (n = 3). For (A,B), statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group. For (CP), statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 3. RA inhibited the activation of NF-κB signaling pathway by upregulating TLR9. The cells were pretreated with 10 μM E6446 (TLR9 inhibitor dihydrochloride) for 2 h, and co-incubated with RA for 6 h and then challenged with SE (MOI = 100) for 2 h. The cell supernatants were collected to detect cytokines, and the cells were collected for RT–qPCR or Western blot detection. (A,B) Levels of proinflammatory cytokines in RAW264.7 cells and MCECs (n = 6). (CE) The mRNA expression levels of TLR9, TNF-α and IL-6 in RAW264.7 cells (n = 6). (FH) The mRNA expression levels of TLR9, TNF-α and IL-6 in MCECs (n = 6). (IL) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in RAW264.7 cells (n = 3). (MP) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in MCECs (n = 3). For (A,B), statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group. For (CP), statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Antioxidants 13 01265 g003
Figure 4. Protective effects of RA on SE-challenged mice. (A) Experimental design for evaluating the effect of RA on the survival rate of mice challenged with SE. Mice were orally pretreated with RA (20 mg/kg·bw) for 7 days and then intraperitoneally injected with 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL. The mortality of mice was recorded. (B) Survival rate of the mice (n = 20). (C) Experimental design for testing the protective effect of RA against SE. The treatment and challenge of the mice were the same as those in (A), and samples were collected 24 h after challenge. (D) Changes in the body weights of the mice (n = 10). (E) Disease activity index (n = 10). (F,G) Measurement of colon length (n = 6). (H) The histopathological changes in duodenum and colon (n = 3). (I) Duodenum histopathological score (n = 3). (J) Colon histopathological score (n = 3). For (BD), statistical analysis was performed by Mantle-Cox test and Kruskal-Wallis test, respectively, and SE infection control group was compared with other groups. In (GJ), statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± (SD), * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group, # p < 0.05, #### p < 0.0001 versus the blank control group.
Figure 4. Protective effects of RA on SE-challenged mice. (A) Experimental design for evaluating the effect of RA on the survival rate of mice challenged with SE. Mice were orally pretreated with RA (20 mg/kg·bw) for 7 days and then intraperitoneally injected with 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL. The mortality of mice was recorded. (B) Survival rate of the mice (n = 20). (C) Experimental design for testing the protective effect of RA against SE. The treatment and challenge of the mice were the same as those in (A), and samples were collected 24 h after challenge. (D) Changes in the body weights of the mice (n = 10). (E) Disease activity index (n = 10). (F,G) Measurement of colon length (n = 6). (H) The histopathological changes in duodenum and colon (n = 3). (I) Duodenum histopathological score (n = 3). (J) Colon histopathological score (n = 3). For (BD), statistical analysis was performed by Mantle-Cox test and Kruskal-Wallis test, respectively, and SE infection control group was compared with other groups. In (GJ), statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± (SD), * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group, # p < 0.05, #### p < 0.0001 versus the blank control group.
Antioxidants 13 01265 g004
Figure 5. RA alleviated SE-induced intestinal inflammation by regulating TLR9 and inhibiting the activation of the NF-κB signaling pathway. The mice were orally pretreated with RA (20 mg/kg·bw) for 7 days, 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL was intraperitoneally injected, and samples were collected 24 h after challenge. (AD) Serum levels of GOT, GPT, MDA and SOD (n = 6). (E) Levels of TNF-α, IL-1β and IL-6 in the serum (n = 6) (FH). The mRNA expression levels of TLR9, TNF-α and IL-6 in colon tissues (n = 6). (IL) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in colon tissues (n = 3). Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group, # p < 0.05, ## p < 0.01, #### p < 0.0001 versus the blank control group.
Figure 5. RA alleviated SE-induced intestinal inflammation by regulating TLR9 and inhibiting the activation of the NF-κB signaling pathway. The mice were orally pretreated with RA (20 mg/kg·bw) for 7 days, 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL was intraperitoneally injected, and samples were collected 24 h after challenge. (AD) Serum levels of GOT, GPT, MDA and SOD (n = 6). (E) Levels of TNF-α, IL-1β and IL-6 in the serum (n = 6) (FH). The mRNA expression levels of TLR9, TNF-α and IL-6 in colon tissues (n = 6). (IL) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in colon tissues (n = 3). Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group, # p < 0.05, ## p < 0.01, #### p < 0.0001 versus the blank control group.
Antioxidants 13 01265 g005
Figure 6. RA regulated the gut microbiota in SE-challenged mice (n = 6). The mice were orally pretreated with RA (20 mg/kg·bw) for 7 days, then intraperitoneally injected with 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL. (A) Circos diagram. (B) Alpha diversity analysis: observed OTUs. (C) Alpha diversity analysis: Shannon index. (D) Alpha diversity analysis: Chao 1. (E) β-diversity analysis: PCoA. (F) Relative abundance of the gut microbiota at the genus level. (GK) Relative abundance of p__Proteobacteria, p__Epsilonbacteraeota, p__Bacteroidota, p__Firmicutes and p__Actinobacteria. (L) Relative abundance of the gut microbiota at the genus level. (MR) Relative abundance of g__Muribaculaceae_unclassified, g__Bilophila, g__Tyzzerella, g__Lachnospiraceae_NK4A136_group, g__Acetatifactor and g__Intestinimonas. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group, # p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 versus the blank control group.
Figure 6. RA regulated the gut microbiota in SE-challenged mice (n = 6). The mice were orally pretreated with RA (20 mg/kg·bw) for 7 days, then intraperitoneally injected with 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL. (A) Circos diagram. (B) Alpha diversity analysis: observed OTUs. (C) Alpha diversity analysis: Shannon index. (D) Alpha diversity analysis: Chao 1. (E) β-diversity analysis: PCoA. (F) Relative abundance of the gut microbiota at the genus level. (GK) Relative abundance of p__Proteobacteria, p__Epsilonbacteraeota, p__Bacteroidota, p__Firmicutes and p__Actinobacteria. (L) Relative abundance of the gut microbiota at the genus level. (MR) Relative abundance of g__Muribaculaceae_unclassified, g__Bilophila, g__Tyzzerella, g__Lachnospiraceae_NK4A136_group, g__Acetatifactor and g__Intestinimonas. Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 versus the SE infection control group, # p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 versus the blank control group.
Antioxidants 13 01265 g006
Figure 7. RA lost its protective effect against SE after clearance of the microbiota. (A) Experimental design in mice. The mice were orally pretreated with RA (20 mg/kg·bw) or antibiotics for 7 days, 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL was intraperitoneally injected, and samples were collected 24 h after challenge (n = 10). (B) Changes in body weight (n = 10). (C) Disease activity index (n = 10). (D,E) Measurement of colon length (n = 10). (F) Organ indices of the liver, kidney and spleen (n = 10). (G) Levels of TNF-α, IL-1β and IL-6 in the serum (n = 6). (H) Histopathological changes in the duodenum (n = 3). (I) Duodenal histopathological score (n = 3). For (B), statistical analysis was performed using Kruskal-Wallis test, and the SE infection control group was compared with other groups. For (CI), statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, **** p < 0.0001 versus the SE infection control group, # p < 0.05, ## p < 0.01, #### p < 0.0001 versus the blank control group.
Figure 7. RA lost its protective effect against SE after clearance of the microbiota. (A) Experimental design in mice. The mice were orally pretreated with RA (20 mg/kg·bw) or antibiotics for 7 days, 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL was intraperitoneally injected, and samples were collected 24 h after challenge (n = 10). (B) Changes in body weight (n = 10). (C) Disease activity index (n = 10). (D,E) Measurement of colon length (n = 10). (F) Organ indices of the liver, kidney and spleen (n = 10). (G) Levels of TNF-α, IL-1β and IL-6 in the serum (n = 6). (H) Histopathological changes in the duodenum (n = 3). (I) Duodenal histopathological score (n = 3). For (B), statistical analysis was performed using Kruskal-Wallis test, and the SE infection control group was compared with other groups. For (CI), statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, * p < 0.05, ** p < 0.01, **** p < 0.0001 versus the SE infection control group, # p < 0.05, ## p < 0.01, #### p < 0.0001 versus the blank control group.
Antioxidants 13 01265 g007
Figure 8. RA failed to inhibit NF-κB signaling pathway by regulating TLR9 after clearance of the microbiota. The mice were orally pretreated with RA (20 mg/ kg·bw) and antibiotics for 7 days and then intraperitoneally injected with 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL. Samples were collected 24 h after challenge. (AC) The mRNA expression levels of TLR9, TNF-α and IL-6 in colon tissues (n = 6). (DG) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in colon tissues (n = 3). Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, ** p < 0.01, **** p < 0.0001 versus the SE infection control group, # p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 versus the blank control group.
Figure 8. RA failed to inhibit NF-κB signaling pathway by regulating TLR9 after clearance of the microbiota. The mice were orally pretreated with RA (20 mg/ kg·bw) and antibiotics for 7 days and then intraperitoneally injected with 0.2 mL of SE at a concentration of 2.5 × 108 CFUs/mL. Samples were collected 24 h after challenge. (AC) The mRNA expression levels of TLR9, TNF-α and IL-6 in colon tissues (n = 6). (DG) The protein expression levels of TLR9, p65, p-p65, IκB-α and p-IκB-α in colon tissues (n = 3). Statistical analysis was performed by one-way ANOVA followed by Tukey’s multiple comparison test, and expressed as the mean ± SD, ** p < 0.01, **** p < 0.0001 versus the SE infection control group, # p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 versus the blank control group.
Antioxidants 13 01265 g008
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yi, D.; Wang, M.; Liu, X.; Qin, L.; Liu, Y.; Zhao, L.; Peng, Y.; Liang, Z.; He, J. Rosmarinic Acid Attenuates Salmonella enteritidis-Induced Inflammation via Regulating TLR9/NF-κB Signaling Pathway and Intestinal Microbiota. Antioxidants 2024, 13, 1265. https://doi.org/10.3390/antiox13101265

AMA Style

Yi D, Wang M, Liu X, Qin L, Liu Y, Zhao L, Peng Y, Liang Z, He J. Rosmarinic Acid Attenuates Salmonella enteritidis-Induced Inflammation via Regulating TLR9/NF-κB Signaling Pathway and Intestinal Microbiota. Antioxidants. 2024; 13(10):1265. https://doi.org/10.3390/antiox13101265

Chicago/Turabian Style

Yi, Dandan, Menghui Wang, Xia Liu, Lanqian Qin, Yu Liu, Linyi Zhao, Ying Peng, Zhengmin Liang, and Jiakang He. 2024. "Rosmarinic Acid Attenuates Salmonella enteritidis-Induced Inflammation via Regulating TLR9/NF-κB Signaling Pathway and Intestinal Microbiota" Antioxidants 13, no. 10: 1265. https://doi.org/10.3390/antiox13101265

APA Style

Yi, D., Wang, M., Liu, X., Qin, L., Liu, Y., Zhao, L., Peng, Y., Liang, Z., & He, J. (2024). Rosmarinic Acid Attenuates Salmonella enteritidis-Induced Inflammation via Regulating TLR9/NF-κB Signaling Pathway and Intestinal Microbiota. Antioxidants, 13(10), 1265. https://doi.org/10.3390/antiox13101265

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop