Swietenine Alleviates Nonalcoholic Fatty Liver Disease in Diabetic Mice via Lipogenesis Inhibition and Antioxidant Mechanisms
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Studies
2.2. Biochemical Studies
2.3. Histological Studies
2.4. Real-Time Quantitative PCR (RT-qPCR) Assay
2.5. Immunohistochemical Studies
2.6. Statistical Analysis
3. Results
3.1. Effect of Swietenine on Biochemcial Parameters
3.2. Effect of Swietenine on Fat Accumulation
3.3. Effect of Swietenine on Lipogenesis Enzymes and Regulators
3.4. Effect of Swietenine on Crucial Regulators of Oxidative Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Han, H.S.; Kang, G.; Kim, J.S.; Choi, B.H.; Koo, S.H. Regulation of glucose metabolism from a liver-centric perspective. Exp. Mol. Med. 2016, 48, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deprince, A.; Haas, J.T.; Staels, B. Dysregulated lipid metabolism links NAFLD to cardiovascular disease. Mol. Metab. 2020, 42, 101092. [Google Scholar] [CrossRef] [PubMed]
- Delli Bovi, A.P.; Marciano, F.; Mandato, C.; Siano, M.A.; Savoia, M.; Vajro, P. Oxidative Stress in Non-alcoholic Fatty Liver Disease. An Updated Mini Review. Front. Med. 2021, 8, 165. [Google Scholar] [CrossRef] [PubMed]
- Pei, K.; Gui, T.; Kan, D.; Feng, H.; Jin, Y.; Yang, Y.; Zhang, Q.; Du, Z.; Gai, Z.; Wu, J.; et al. An Overview of Lipid Metabolism and Nonalcoholic Fatty Liver Disease. Biomed Res. Int. 2020, 2020, 4020249. [Google Scholar] [CrossRef]
- Damba, T.; Bourgonje, A.R.; Abdulle, A.E.; Pasch, A.; Sydor, S.; van den Berg, E.H.; Gansevoort, R.T.; Bakker, S.J.L.; Blokzijl, H.; Dullaart, R.P.F.; et al. Oxidative stress is associated with suspected non-alcoholic fatty liver disease and all-cause mortality in the general population. Liver Int. 2020, 40, 2148–2159. [Google Scholar] [CrossRef]
- Chen, Z.; Tian, R.; She, Z.; Cai, J.; Li, H. Role of oxidative stress in the pathogenesis of nonalcoholic fatty liver disease. Free Radic. Biol. Med. 2020, 152, 116–141. [Google Scholar] [CrossRef]
- Li, S.; Tan, H.Y.; Wang, N.; Zhang, Z.J.; Lao, L.; Wong, C.W.; Feng, Y. The role of oxidative stress and antioxidants in liver diseases. Int. J. Mol. Sci. 2015, 16, 26087–26124. [Google Scholar] [CrossRef] [Green Version]
- Masarone, M.; Rosato, V.; Dallio, M.; Gravina, A.G.; Aglitti, A.; Loguercio, C.; Federico, A.; Persico, M. Role of oxidative stress in pathophysiology of nonalcoholic fatty liver disease. Oxid. Med. Cell. Longev. 2018, 2018, 9547613. [Google Scholar] [CrossRef]
- Pierantonelli, I.; Svegliati-Baroni, G. Nonalcoholic Fatty Liver Disease: Basic Pathogenetic Mechanisms in the Progression from NAFLD to NASH. Transplantation 2019, 103, E1–E13. [Google Scholar] [CrossRef]
- Arroyave-Ospina, J.C.; Wu, Z.; Geng, Y.; Moshage, H. Role of oxidative stress in the pathogenesis of non-alcoholic fatty liver disease: Implications for prevention and therapy. Antioxidants 2021, 10, 174. [Google Scholar] [CrossRef]
- Bessone, F.; Razori, M.V.; Roma, M.G. Molecular pathways of nonalcoholic fatty liver disease development and progression. Cell. Mol. Life Sci. 2019, 76, 99–128. [Google Scholar] [CrossRef] [PubMed]
- Ore, A.; Akinloye, O.A. Oxidative stress and antioxidant biomarkers in clinical and experimental models of non-alcoholic fatty liver disease. Medicina 2019, 55, 26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Zou, B.; Yeo, Y.H.; Feng, Y.; Xie, X.; Lee, D.H.; Fujii, H.; Wu, Y.; Kam, L.Y.; Ji, F.; et al. Prevalence, incidence, and outcome of non-alcoholic fatty liver disease in Asia, 1999–2019: A systematic review and meta-analysis. Lancet Gastroenterol. Hepatol. 2019, 4, 389–398. [Google Scholar] [CrossRef] [PubMed]
- Estes, C.; Razavi, H.; Loomba, R.; Younossi, Z.; Sanyal, A.J. Modeling the epidemic of nonalcoholic fatty liver disease demonstrates an exponential increase in burden of disease. Hepatology 2018, 67, 123–133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seto, W.K.; Yuen, M.F. Nonalcoholic fatty liver disease in Asia: Emerging perspectives. J. Gastroenterol. 2017, 52, 164–174. [Google Scholar] [CrossRef] [PubMed]
- Sayiner, M.; Koenig, A.; Henry, L.; Younossi, Z.M. Epidemiology of Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis in the United States and the Rest of the World. Clin. Liver Dis. 2016, 20, 205–214. [Google Scholar] [CrossRef] [PubMed]
- Asrani, S.K.; Devarbhavi, H.; Eaton, J.; Kamath, P.S. Burden of liver diseases in the world. J. Hepatol. 2019, 70, 151–171. [Google Scholar] [CrossRef]
- Fan, J.G.; Kim, S.U.; Wong, V.W.S. New trends on obesity and NAFLD in Asia. J. Hepatol. 2017, 67, 862–873. [Google Scholar] [CrossRef] [Green Version]
- Rinella, M.; Charlton, M. The globalization of nonalcoholic fatty liver disease: Prevalence and impact on world health. Hepatology 2016, 64, 19–22. [Google Scholar] [CrossRef] [Green Version]
- Younossi, Z.M.; Koenig, A.B.; Abdelatif, D.; Fazel, Y.; Henry, L.; Wymer, M. Global epidemiology of nonalcoholic fatty liver disease—Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016, 64, 73–84. [Google Scholar] [CrossRef] [Green Version]
- Mitra, S.; De, A.; Chowdhury, A. Epidemiology of non-alcoholic and alcoholic fatty liver diseases. Transl. Gastroenterol. Hepatol. 2020, 5, 16. [Google Scholar] [CrossRef] [PubMed]
- Eslam, M.; Sanyal, A.J.; George, J.; Sanyal, A.; Neuschwander-Tetri, B.; Tiribelli, C.; Kleiner, D.E.; Brunt, E.; Bugianesi, E.; Yki-Järvinen, H.; et al. MAFLD: A Consensus-Driven Proposed Nomenclature for Metabolic Associated Fatty Liver Disease. Gastroenterology 2020, 158, 1999–2014.e1. [Google Scholar] [CrossRef] [PubMed]
- Glass, L.M.; Hunt, C.M.; Fuchs, M.; Su, G.L. Comorbidities and Nonalcoholic Fatty Liver Disease: The Chicken, the Egg, or Both? Fed. Pract. 2019, 36, 64–71. [Google Scholar] [PubMed]
- Dwivedi, D.K.; Jena, G.B. NLRP3 inhibitor glibenclamide attenuates high-fat diet and streptozotocin-induced non-alcoholic fatty liver disease in rat: Studies on oxidative stress, inflammation, DNA damage and insulin signalling pathway. Naunyn. Schmiedebergs. Arch. Pharmacol. 2020, 393, 705–716. [Google Scholar] [CrossRef]
- Mu, W.; Xuefang, C.; Liu, Y.; Qianzhou, L.; Gaolin, L.; Jigang, Z.; Xiaoyu, L. Potential nexus of non-alcoholic fatty liver disease and type 2 diabetes mellitus: Insulin resistance between hepatic and peripheral tissues. Front. Pharmacol. 2019, 9, 1566. [Google Scholar] [CrossRef] [Green Version]
- Osório, J. Hepatic lipogenesis independent of insulin in type 2 diabetes mellitus—A paradox clarified. Nat. Rev. Endocrinol. 2015, 11, 130. [Google Scholar] [CrossRef]
- Lally, J.S.V.; Ghoshal, S.; DePeralta, D.K.; Moaven, O.; Wei, L.; Masia, R.; Erstad, D.J.; Fujiwara, N.; Leong, V.; Houde, V.P.; et al. Inhibition of Acetyl-CoA Carboxylase by Phosphorylation or the Inhibitor ND-654 Suppresses Lipogenesis and Hepatocellular Carcinoma. Cell Metab. 2019, 29, 174–182.e5. [Google Scholar] [CrossRef] [Green Version]
- De Silva, G.S.; Desai, K.; Darwech, M.; Naim, U.; Jin, X.; Adak, S.; Harroun, N.; Sanchez, L.A.; Semenkovich, C.F.; Zayed, M.A. Circulating serum fatty acid synthase is elevated in patients with diabetes and carotid artery stenosis and is LDL-associated. Atherosclerosis 2019, 287, 38–45. [Google Scholar] [CrossRef] [Green Version]
- Alves-Bezerra, M.; Cohen, D.E. Triglyceride metabolism in the liver. Compr. Physiol. 2018, 8, 1–22. [Google Scholar] [CrossRef]
- Solano-Urrusquieta, A.; Morales-González, J.A.; Castro-Narro, G.E.; Cerda-Reyes, E.; Flores-Rangel, P.D.; Fierros-Oceguera, R. NRF-2 and nonalcoholic fatty liver disease. Ann. Hepatol. 2020, 19, 458–465. [Google Scholar] [CrossRef]
- Bataille, A.M.; Manautou, J.E. Nrf2 a potential target for new therapeutics in liver disease. Clin. Pharmacol. Ther. 2012, 92, 340–348. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Xu, M.; Jeong, S.; Qian, Y.; Wu, H.; Xia, Q.; Kong, X. The Role of Nrf2 in Liver Disease: Novel Molecular Mechanisms and Therapeutic Approaches. Front. Pharmacol. 2018, 9, 1428. [Google Scholar] [CrossRef] [Green Version]
- Bathish, B.; Robertson, H.; Dillon, J.F.; Dinkova-Kostova, A.T.; Hayes, J.D. Nonalcoholic steatohepatitis and mechanisms by which it is ameliorated by activation of the CNC-bZIP transcription factor Nrf2. Free Radic. Biol. Med. 2022, 188, 221–261. [Google Scholar] [CrossRef]
- Tacelli, M.; Celsa, C.; Magro, B.; Giannetti, A.; Pennisi, G.; Spatola, F.; Petta, S. Antidiabetic drugs in NAFLD: The accomplishment of two goals at once? Pharmaceuticals 2018, 11, 121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hardy, T.; Anstee, Q.M.; Day, C.P. Nonalcoholic fatty liver disease: New treatments. Curr. Opin. Gastroenterol. 2015, 31, 175–183. [Google Scholar] [CrossRef] [PubMed]
- Van Herck, M.A.; Vonghia, L.; Francque, S.M. Animal models of nonalcoholic fatty liver disease—A starter’s guide. Nutrients 2017, 9, 1072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Süntar, I. Importance of ethnopharmacological studies in drug discovery: Role of medicinal plants. Phytochem. Rev. 2020, 19, 1199–1209. [Google Scholar] [CrossRef]
- Choudhury, H.; Pandey, M.; Hua, C.K.; Mun, C.S.; Jing, J.K.; Kong, L.; Ern, L.Y.; Ashraf, N.A.; Kit, S.W.; Yee, T.S.; et al. An update on natural compounds in the remedy of diabetes mellitus: A systematic review. J. Tradit. Complement. Med. 2018, 8, 361–376. [Google Scholar] [CrossRef]
- Zakaria, Z.; Othman, Z.A.; Nna, V.U.; Mohamed, M. The promising roles of medicinal plants and bioactive compounds on hepatic lipid metabolism in the treatment of non-alcoholic fatty liver disease in animal models: Molecular targets. Arch. Physiol. Biochem. 2021, 1–17. [Google Scholar] [CrossRef]
- Mak, K.-K.; Shiming, Z.; Balijepalli, M.K.; Dinkova-Kostova, A.T.; Epemolu, O.; Mohd, Z.; Pichika, M.R. Studies on the mechanism of anti-inflammatory action of swietenine, a tetranortriterpenoid isolated from Swietenia macrophylla seeds. Phytomedicine Plus 2021, 1, 100018. [Google Scholar] [CrossRef]
- Dutta, M.; Biswas, U.K.; Chakraborty, R.; Banerjee, P.; Maji, D.; Mondal, M.C.; Raychaudhuri, U. Antidiabetic and antioxidant effect of Swietenia macrophylla seeds in experimental type 2 diabetic rats. Int. J. Diabetes Dev. Ctries. 2013, 33, 60–65. [Google Scholar] [CrossRef]
- Maiti, A.; Dewanjee, S.; Kundu, M.; Mandal, S.C. Evaluation of antidiabetic activity of the seeds of Swietenia macrophylla in diabetic rats. Pharm. Biol. 2009, 47, 132–136. [Google Scholar] [CrossRef]
- Sukardiman; Ervina, M. The recent use of Swietenia mahagoni (L.) Jacq. as antidiabetes type 2 phytomedicine: A systematic review. Heliyon 2020, 6, e03536. [Google Scholar] [CrossRef] [PubMed]
- Hashim, M.A.; Yam, M.F.; Hor, S.Y.; Lim, C.P.; Asmawi, M.Z.; Sadikun, A. Anti-hyperglycaemic activity of swietenia macrophylla king (meliaceae) seed extracts in normoglycaemic rats undergoing glucose tolerance tests. Chin. Med. 2013, 8, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shiming, Z.; Mak, K.K.; Balijepalli, M.K.; Chakravarthi, S.; Pichika, M.R. Swietenine potentiates the antihyperglycemic and antioxidant activity of Metformin in Streptozotocin induced diabetic rats. Biomed. Pharmacother. 2021, 139, 111576. [Google Scholar] [CrossRef] [PubMed]
- Nair, A.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27. [Google Scholar] [CrossRef] [Green Version]
- Janhavi, P.; Divyashree, S.; Sanjailal, K.P.; Muthukumar, S.P. DoseCal: A virtual calculator for dosage conversion between human and different animal species. Arch. Physiol. Biochem. 2022, 128, 426–430. [Google Scholar] [CrossRef]
- Stotz, E.; Schenk, E.A.; Churukian, C.; Willis, C. Oil red O: Comparison of staining quality and chemical components as determined by thin layer chromatography. Stain Technol. 1986, 61, 187–190. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Kim, S.W.; Roh, J.; Park, C.S. Immunohistochemistry for Pathologists: Protocols, Pitfalls, and Tips. J. Pathol. Transl. Med. 2016, 50, 411. [Google Scholar] [CrossRef] [Green Version]
- Zhou, C.H.; Liu, L.L.; Wu, Y.Q.; Song, Z.; Xing, S.H. Enhanced expression of salusin-β contributes to progression of atherosclerosis in LDL receptor deficient mice. Can. J. Physiol. Pharmacol. 2012, 90, 463–471. [Google Scholar] [CrossRef] [PubMed]
- Crowe, A.; Yue, W. Semi-quantitative Determination of Protein Expression Using Immunohistochemistry Staining and Analysis: An Integrated Protocol. Bio-Protocol 2019, 9, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Sharma, N.; Dev, R.; Ruiz-Rosado, J.D.D.; Partida-Sanchez, S.; Guerau-de-Arellano, M.; Dhakal, P.; Kuivaniemi, H.; Hans, C.P. Pharmacological inhibition of Notch signaling regresses pre-established abdominal aortic aneurysm. Sci. Rep. 2019, 9, 13458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Green Version]
- Dentin, R.; Girard, J.; Postic, C. Carbohydrate responsive element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c): Two key regulators of glucose metabolism and lipid synthesis in liver. Biochimie 2005, 87, 81–86. [Google Scholar] [CrossRef]
- Guo, L.; Guo, Y.Y.; Li, B.Y.; Peng, W.Q.; Chang, X.X.; Gao, X.; Tang, Q.Q. Enhanced acetylation of ATP-citrate lyase promotes the progression of nonalcoholic fatty liver disease. J. Biol. Chem. 2019, 294, 11805–11816. [Google Scholar] [CrossRef] [PubMed]
- Gross, A.S.; Zimmermann, A.; Pendl, T.; Schroeder, S.; Schoenlechner, H.; Knittelfelder, O.; Lamplmayr, L.; Santiso, A.; Aufschnaiter, A.; Waltenstorfer, D.; et al. Acetyl-CoA carboxylase 1– Dependent lipogenesis promotes autophagy downstream of AMPK. J. Biol. Chem. 2019, 294, 12020–12039. [Google Scholar] [CrossRef] [Green Version]
- Jensen-Urstad, A.P.L.; Semenkovich, C.F. Fatty acid synthase and liver triglyceride metabolism: Housekeeper or messenger? Biochim. Biophys. Acta—Mol. Cell Biol. Lipids 2012, 1821, 747–753. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.; So, J.S.; Park, J.G.; Lee, A.H. Transcriptional control of hepatic lipid metabolism by SREBP and ChREBP. Semin. Liver Dis. 2013, 33, 301. [Google Scholar] [CrossRef] [Green Version]
- Slocum, S.L.; Skoko, J.J.; Wakabayashi, N.; Aja, S.; Yamamoto, M.; Kensler, T.W.; Chartoumpekis, D.V. Keap1/Nrf2 pathway activation leads to a repressed hepatic gluconeogenic and lipogenic program in mice on a high-fat diet. Arch. Biochem. Biophys. 2016, 591, 57–65. [Google Scholar] [CrossRef] [Green Version]
- Wei, W.; Ma, N.; Fan, X.; Yu, Q.; Ci, X. The role of Nrf2 in acute kidney injury: Novel molecular mechanisms and therapeutic approaches. Free Radic. Biol. Med. 2020, 158, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Shin, S.; Wakabayashi, J.; Yates, M.S.; Wakabayashi, N.; Dolan, P.M.; Aja, S.; Liby, K.T.; Sporn, M.B.; Yamamoto, M.; Kensler, T.W. Role of Nrf2 in prevention of high-fat diet-induced obesity by synthetic triterpenoid CDDO-Imidazolide. Eur. J. Pharmacol. 2009, 620, 138–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanaka, Y.; Aleksunes, L.M.; Yeager, R.L.; Gyamfi, M.A.; Esterly, N.; Guo, G.L.; Klaassen, C.D. NF-E2-related factor 2 inhibits lipid accumulation and oxidative stress in mice fed a high-fat diet. J. Pharmacol. Exp. Ther. 2008, 325, 655–664. [Google Scholar] [CrossRef]
- Chartoumpekis, D.V.; Ziros, P.G.; Psyrogiannis, A.I.; Papavassiliou, A.G.; Kyriazopoulou, V.E.; Sykiotis, G.P.; Habeos, I.G. Nrf2 represses FGF21 during long-term high-fat diet—Induced obesity in mice. Diabetes 2011, 60, 2465–2473. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tomah, S.; Alkhouri, N.; Hamdy, O. Nonalcoholic fatty liver disease and type 2 diabetes: Where do Diabetologists stand? Clin. Diabetes Endocrinol. 2020, 6, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Gabbia, D.; Cannella, L.; De Martin, S.; Shiri-Sverdlov, R.; Squadrito, G. The Role of Oxidative Stress in NAFLD–NASH–HCC Transition—Focus on NADPH Oxidases. Biomedicines 2021, 9, 687. [Google Scholar] [CrossRef] [PubMed]
- Belew, G.D.; Jones, J.G. De novo lipogenesis in non-alcoholic fatty liver disease: Quantification with stable isotope tracers. Eur. J. Clin. Invest. 2022, 52, e13733. [Google Scholar] [CrossRef]
- Batchuluun, B.; Pinkosky, S.L.; Steinberg, G.R. Lipogenesis inhibitors: Therapeutic opportunities and challenges. Nat. Rev. Drug Discov. 2022, 21, 283–305. [Google Scholar] [CrossRef]
- Zarghamravanbakhsh, P.; Frenkel, M.; Poretsky, L. Metabolic causes and consequences of nonalcoholic fatty liver disease (NAFLD). Metab. Open 2021, 12, 100149. [Google Scholar] [CrossRef]
- Ludtmann, M.H.R.; Angelova, P.R.; Zhang, Y.; Abramov, A.Y.; Dinkova-Kostova, A.T. Nrf2 affects the efficiency of mitochondrial fatty acid oxidation. Biochem. J. 2014, 457, 415–424. [Google Scholar] [CrossRef] [Green Version]
- Sharma, R.S.; Harrison, D.J.; Kisielewski, D.; Cassidy, D.M.; McNeilly, A.D.; Gallagher, J.R.; Walsh, S.V.; Honda, T.; McCrimmon, R.J.; Dinkova-Kostova, A.T.; et al. Experimental Nonalcoholic Steatohepatitis and Liver Fibrosis Are Ameliorated by Pharmacologic Activation of Nrf2 (NF-E2 p45-Related Factor 2). Cell. Mol. Gastroenterol. Hepatol. 2018, 5, 367–398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Knatko, E.V.; Tatham, M.H.; Zhang, Y.; Castro, C.; Higgins, M.; Dayalan Naidu, S.; Leonardi, C.; de la Vega, L.; Honda, T.; Griffin, J.L.; et al. Downregulation of Keap1 Confers Features of a Fasted Metabolic State. iScience 2020, 23, 101638. [Google Scholar] [CrossRef]
- Moghadamtousi, S.Z.; Goh, B.H.; Chan, C.K.; Shabab, T.; Kadir, H.A. Biological activities and phytochemicals of Swietenia macrophylla king. Molecules 2013, 18, 10465–10483. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balijepalli, M.K.; Suppaiah, V.; Chin, A.-M.; Buru, A.S.; Sagineedu, S.R.; Pichika, M.R. Acute oral toxicity studies of swietenia macrophylla seeds in sprague dawley rats. Pharmacognosy Res. 2015, 7, 38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bashir, A.; Duseja, A.; De, A.; Mehta, M.; Tiwari, P. Non-alcoholic fatty liver disease development: A multifactorial pathogenic phenomena. Liver Res. 2022, 6, 72–83. [Google Scholar] [CrossRef]
- Im, Y.R.; Hunter, H.; de Gracia Hahn, D.; Duret, A.; Cheah, Q.; Dong, J.; Fairey, M.; Hjalmarsson, C.; Li, A.; Lim, H.K.; et al. A Systematic Review of Animal Models of NAFLD Finds High-Fat, High-Fructose Diets Most Closely Resemble Human NAFLD. Hepatology 2021, 74, 1884–1901. [Google Scholar] [CrossRef]
Gene Code | Gene Name | Sequence (5’-3’) | Accession Number |
---|---|---|---|
β-actin | Beta-actin | F: CGGTTCCGATGCCCTGAGGCTCTTR: CGTCACACTTCATGATGGAATTGA | NM_007393.5 |
ACLY | ATP citrate lysase | F: CTCACACGGAAGCTCATCAAR: TCCAGCATTCCACCAGTATTC | NM_001199296.1 |
ACC1 | Acetyl CoA carboxylase isoform 1 | F: CCCGTGAGAACACAGAGATAAAR: CTGAGGTGGTTGAGTGTGTT | NM_133360.3 |
FASN | Fatty acid synthase | F: GGATGTCAACAAGCCCAAATACR: GAGGAGAAGGCCACAAAGTAG | NM_007988.3 |
SREPB1c | Sterol regulatory element-binding protein-1c | F: GGAGCCATGGATTGCACATTR: GGCCCGGGAAGTCACTGT | NM_001358314.1 |
ChREBPβ | Carbohydrate-responsive element-binding protein | F: CCATCTTTGGACCTCCCTTTAATR: GAAACAGACCGACATCTCTCATC | NM_001359237.1 |
NRF2 | Nuclear factor erythroid 2-related factor 2 | F: CAAGACTTGGGCCACTTAAAAGAC R: AGTAAGGCTTTCCATCCTCATCAC | NM_010902.5 |
HO-1 | Heme oxygenase-1 | F: GTGATGGAGCGTCCACAGC R: TTGGTGGCCTCCTTCAAGG | NM_010442.2 |
NQO-1 | NADPH quinone oxidoreductase 1 | F: AGCTGGAAGCTGCAGACCTG R: CCTTTCAGAATGGCTGGCA | NM_008706.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mak, K.-K.; Zhang, S.; Chellian, J.; Mohd, Z.; Epemolu, O.; Dinkova-Kostova, A.T.; Balijepalli, M.K.; Pichika, M.R. Swietenine Alleviates Nonalcoholic Fatty Liver Disease in Diabetic Mice via Lipogenesis Inhibition and Antioxidant Mechanisms. Antioxidants 2023, 12, 595. https://doi.org/10.3390/antiox12030595
Mak K-K, Zhang S, Chellian J, Mohd Z, Epemolu O, Dinkova-Kostova AT, Balijepalli MK, Pichika MR. Swietenine Alleviates Nonalcoholic Fatty Liver Disease in Diabetic Mice via Lipogenesis Inhibition and Antioxidant Mechanisms. Antioxidants. 2023; 12(3):595. https://doi.org/10.3390/antiox12030595
Chicago/Turabian StyleMak, Kit-Kay, Shiming Zhang, Jestin Chellian, Zulkefeli Mohd, Ola Epemolu, Albena T. Dinkova-Kostova, Madhu Katyayani Balijepalli, and Mallikarjuna Rao Pichika. 2023. "Swietenine Alleviates Nonalcoholic Fatty Liver Disease in Diabetic Mice via Lipogenesis Inhibition and Antioxidant Mechanisms" Antioxidants 12, no. 3: 595. https://doi.org/10.3390/antiox12030595
APA StyleMak, K.-K., Zhang, S., Chellian, J., Mohd, Z., Epemolu, O., Dinkova-Kostova, A. T., Balijepalli, M. K., & Pichika, M. R. (2023). Swietenine Alleviates Nonalcoholic Fatty Liver Disease in Diabetic Mice via Lipogenesis Inhibition and Antioxidant Mechanisms. Antioxidants, 12(3), 595. https://doi.org/10.3390/antiox12030595