Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Preparation
2.2. Total Monomeric Anthocyanin Content (TMA)
2.3. Total Polyphenolic Content (TPC)
2.4. Antioxidant Activity (FRAP)
2.5. Total Flavonoid Content (TFC)
2.6. Total Carotenoid Content (TC)
2.7. Catalase Enzyme Activity (CAT)
2.8. Peroxidase Enzyme Activity (POD)
2.9. Superoxide Dismutase Enzyme Activity (SOD)
2.10. Soluble Solid Content (SSC) and pH
2.11. Determination of Colour Hue
2.12. RNA Isolation and Quantitative Real-Time PCR
2.13. Statistical Analysis
3. Results and Discussion
3.1. Total Monomer Anthocyanins
3.2. Total Polyphenolic Content
3.3. Antioxidant Activity
3.4. Total Flavonoid Content
3.5. Total Carotenoid Content
3.6. Enzymatic Activity
3.7. Correlation between Phytochemicals and AOX
3.8. Regulation of Anthocyanin Biosynthesis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lang, Y.Q.; Yanagawa, S.; Sasanuma, T.; Sasakuma, T. Orange fruit color in Capsicum due to deletion of capsanthin-capsorubin synthesis gene. Breed. Sci. 2004, 54, 33–39. [Google Scholar] [CrossRef] [Green Version]
- Paran, I.; Fallik, E. Breeding for fruit quality in pepper (Capsicum spp.). In Breeding for Fruit Quality; Wiley: Hoboken, NJ, USA, 2011; pp. 307–322. [Google Scholar]
- Wadhera, D.; Capaldi-Phillips, E.D. A Review of Visual Cues Associated with Food on Food Acceptance and Consumption. Eat. Behav. 2014, 15, 132–143. [Google Scholar] [CrossRef] [PubMed]
- Aza-Gonzalez, C.; Herrera-Isidrón, L.; Núñez-Palenius, H.G.; De La Vega, O.; Ochoa-Alejo, N. Anthocyanin accumulation and expression analysis of biosynthesis-related genes during Chili pepper fruit development. Biol. Plant. 2013, 57, 49–55. [Google Scholar] [CrossRef]
- Lightbourn, G.J.; Griesbach, R.J.; Novotny, J.A.; Clevidence, B.A.; Rao, D.D.; Stommel, J.R. Effects of anthocyanin and carotenoid combinations on foliage and immature fruit color of Capsicum annuum L. J. Hered. 2008, 99, 105–111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stommel, J.R.; Griesbach, R.J. Inheritance of fruit, foliar, and plant habit attributes in Capsicum. J. Am. Soc. Hortic. Sci. 2008, 133, 396–407. [Google Scholar] [CrossRef] [Green Version]
- Li, Z.; Wang, S.; Gui, X.-L.; Chang, X.-B.; Gong, Z.-H. A further analysis of the relationship between yellow ripe-fruit color and the capsanthin-capsorubin synthase gene in pepper (Capsicum sp.) indicated a new mutant variant in C. annuum and a tandem repeat structure in promoter region. PLoS ONE 2013, 8, e61996. [Google Scholar] [CrossRef]
- Ha, S.H.; Kim, J.B.; Park, J.S.; Lee, S.W.; Cho, K.J. A comparison of the carotenoid accumulation in Capsicum varieties that show different ripening colours: Deletion of the capsanthin-capsorubin synthase gene is not a prerequisite for the formation of a yellow pepper. J. Exp. Bot. 2007, 58, 3135–3144. [Google Scholar] [CrossRef] [Green Version]
- Matsufuji, H.; Nakamura, H.; Chino, M.; Takedas, M. Antioxidant activity of capsanthin and the fatty acid esters in paprika (Capsicum annuum). J. Agric. Food Chem. 1998, 46, 3468–3472. [Google Scholar] [CrossRef]
- Kilcrease, J.; Collins, A.M.; Richins, R.D.; Timlin, J.A.; O’connell, M.A. Multiple microscopic approaches demonstrate linkage between chromoplast architecture and carotenoid composition in diverse Capsicum annuum fruit. Plant J. 2013, 76, 1074–1083. [Google Scholar] [CrossRef]
- Kilcrease, J.; Rodriguez-Uribe, L.; Richins, R.D.; Arcos, J.M.; Victorino, J.; O’Connell, M.A. Correlations of carotenoid content and transcript abundances for fibrillin and carotenogenic enzymes in Capsicum annuum fruit pericarp. Plant Sci. 2015, 232, 57–66. [Google Scholar] [CrossRef]
- Panche, A.N.; Diwan, A.D.; Chandra, S.R. Flavonoids: An overview. J. Nutr. Sci. 2016, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anaya-Esparza, L.M.; Mora, Z.V.; Vázquez-Paulino, O.; Ascencio, F.; Villarruel-López, A. Bell Peppers (Capsicum annuum L.) Losses and Wastes: Source for Food and Pharmaceutical Applications. Molecules 2021, 26, 5341. [Google Scholar] [CrossRef] [PubMed]
- Pietta, P.G. Flavonoids as antioxidants. J. Nat. Prod. 2000, 63, 1035–1042. [Google Scholar] [CrossRef] [PubMed]
- Agati, G.; Azzarello, E.; Pollastri, S.; Tattini, M. Flavonoids as antioxidants in plants: Location and functional significance. Plant Sci. 2012, 196, 67–76. [Google Scholar] [CrossRef]
- Holton, T.A.; Cornish, E.C. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 1995, 7, 1071. [Google Scholar] [CrossRef]
- Ohno, S.; Ueno, M.; Doi, M. Differences in the CaMYBA genome between anthocyanin-pigmented cultivars and non-pigmented cultivars in pepper (Capsicum annuum). Hortic. J. 2020, 89, 30–36. [Google Scholar] [CrossRef] [Green Version]
- Borovsky, Y.; Oren-Shamir, M.; Ovadia, R.; De Jong, W.; Paran, I. The A locus that controls anthocyanin accumulation in pepper encodes a MYB transcription factor homologous to Anthocyanin2 of Petunia. Theor. Appl. Genet. 2004, 109, 23–29. [Google Scholar] [CrossRef]
- Sun, T.; Xu, Z.; Wu, C.T.; Janes, M.; Prinyawiwatkul, W.; No, H.K. Antioxidant activities of different colored sweet bell peppers (Capsicum annuum L.). J. Food Sci. 2007, 72, 98–102. [Google Scholar] [CrossRef]
- Lee, J.; Durst, R.W.; Wrolstad, R.E. Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: Collaborative study. J. AOAC Int. 2005, 88, 1269–1278. [Google Scholar] [CrossRef] [Green Version]
- Singleton, V.L.; Rossi, J.A. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. [Google Scholar]
- Benzie, I.F.; Strain, J.J. The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: The FRAP assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sytar, O.; Bośko, P.; Živčák, M.; Brestic, M.; Smetanska, I. Bioactive phytochemicals and antioxidant properties of the grains and sprouts of colored wheat genotypes. Molecules 2018, 23, 2282. [Google Scholar] [CrossRef] [Green Version]
- Hornero-Méndez, D.; Mínguez-Mosquera, M.I. Rapid spectrophotometric determination of red and yellow isochromic carotenoid fractions in paprika and red pepper oleoresins. J. Agric. Food Chem. 2001, 49, 3584–3588. [Google Scholar] [CrossRef] [PubMed]
- Xing, Y.; Li, X.; Xu, Q.; Yun, J.; Lu, Y.; Tang, Y. Effects of chitosan coating enriched with cinnamon oil on qualitative properties of sweet pepper (Capsicum annuum L.). Food Chem. 2011, 124, 1443–1450. [Google Scholar] [CrossRef]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Láng, F. Növényélettan, a Növényi Anyagcsere II; ELTE Eötvös Kiadó: Budapest, Hungary, 2007. [Google Scholar]
- Deepa, N.; Kaur, C.; George, B.; Singh, B.; Kapoor, H.C. Antioxidant constituents in some sweet pepper (Capsicum annuum L.) genotypes during maturity. LWT-Food Sci. Technol. 2007, 40, 121–129. [Google Scholar] [CrossRef]
- Aza-González, C.; Ochoa-Alejo, N. Characterization of anthocyanins from fruits of two Mexican chili peppers (Capsicum annuum L.). J. Mex. Chem. Soc. 2012, 56, 149–151. [Google Scholar] [CrossRef]
- Sadilova, E.; Stintzing, F.C.; Carle, R. Anthocyanins, colour and antioxidant properties of eggplant (Solanum melongena L.) and violet pepper (Capsicum annuum L.) peel extracts. Zeitschrift Naturforschung C 2006, 61, 527–535. [Google Scholar] [CrossRef] [PubMed]
- Bogusz, S., Jr.; Libardi, S.H.; Dias, F.F.; Coutinho, J.P.; Bochi, V.C.; Rodrigues, D.; Melo, A.M.; Godoy, H.T. Brazilian Capsicum peppers: Capsaicinoid content and antioxidant activity. J. Sci. Food Agric. 2018, 98, 217–224. [Google Scholar] [CrossRef] [PubMed]
- Castro-Concha, L.A.; Tuyub-Che, J.; Moo-Mukul, A.; Vazquez-Flota, F.A.; Miranda-Ham, M.L. Antioxidant capacity and total phenolic content in fruit tissues from accessions of Capsicum Chinense Jacq.(Habanero pepper) at different stages of ripening. Sci. World J. 2014. [Google Scholar] [CrossRef] [PubMed]
- Marín, A.; Ferreres, F.; Tomás-Barberán, F.A.; Gil, M.I. Characterization and quantitation of antioxidant constituents of sweet pepper (Capsicum annuum L.). J. Agric. Food Chem. 2004, 52, 3861–3869. [Google Scholar] [CrossRef] [PubMed]
- Navarro, J.M.; Flores, P.; Garrido, C.; Martinez, V. Changes in the contents of antioxidant compounds in pepper fruits at different ripening stages, as affected by salinity. Food Chem. 2006, 96, 66–73. [Google Scholar] [CrossRef]
- Ghasemnezhad, M.; Sherafati, M.; Payvast, G.A. Variation in phenolic compounds, ascorbic acid and antioxidant activity of five coloured bell pepper (Capsicum annuum) fruits at two different harvest times. J. Funct. Foods 2011, 3, 44–49. [Google Scholar] [CrossRef]
- Chandel, C.; Sharma, V.K.; Rana, P.S.; Dabral, M.; Aggrawal, S.; Saklani, P. Assessment of antimicrobial and antioxidant potential of cytoplasmic male sterile lines of pepper. SN Appl. Sci. 2020, 2, 1181. [Google Scholar] [CrossRef]
- Howard, L.R.; Talcott, S.T.; Brenes, C.H.; Villalon, B. Changes in phytochemical and antioxidant activity of selected pepper cultivars (Capsicum species) as influenced by maturity. J. Agric. Food Chem. 2000, 48, 1713–1720. [Google Scholar] [CrossRef]
- Sim, K.H.; Sil, H.Y. Antioxidant activities of red pepper (Capsicum annuum) pericarp and seed extracts. Int. J. Food Sci. Technol. 2008, 43, 1813–1823. [Google Scholar] [CrossRef]
- Sora, G.T.; Haminiuk, C.W.; da Silva, M.V.; Zielinski, A.A.; Gonçalves, G.A.; Bracht, A.; Peralta, R.M. A comparative study of the capsaicinoid and phenolic contents and in vitro antioxidant activities of the peppers of the genus Capsicum: An application of chemometrics. J. Food Sci. Technol. 2015, 52, 8086–8094. [Google Scholar] [CrossRef] [Green Version]
- Rosa, A.; Deiana, M.; Casu, V.; Paccagnini, S.; Appendino, G.; Ballero, M.; Dessí, M.A. Antioxidant activity of capsinoids. J. Agric. Food Chem. 2002, 50, 7396–7401. [Google Scholar] [CrossRef]
- Blanco-Ríos, A.K.; Medina-Juárez, L.Á.; González-Aguilar, G.A.; Gámez-Meza, N. Antioxidant activity of the phenolic and oily fractions of different sweet bell peppers. J. Mex. Chem. Soc. 2013, 57, 137–143. [Google Scholar] [CrossRef]
- Garra, A.; Alkalai-Tuvia, S.; Telerman, A.; Paran, I.; Fallik, E.; Elmann, A. Anti-proliferative activities, phytochemical levels and fruit quality of pepper (Capsicum spp.) following prolonged storage. Int. J. Food Sci. Technol. 2020, 55, 3574–3584. [Google Scholar] [CrossRef]
- Palma, J.M.; Terán, F.; Contreras-Ruiz, A.; Rodríguez-Ruiz, M.; Corpas, F.J. Antioxidant profile of pepper (Capsicum annuum L.) fruits containing diverse levels of capsaicinoids. Antioxidants 2020, 9, 878. [Google Scholar] [CrossRef] [PubMed]
- Guilherme, R.; Aires, A.; Rodrigues, N.; Peres, A.M.; Pereira, J.A. Phenolics and Antioxidant Activity of Green and Red Sweet Peppers from Organic and Conventional Agriculture: A Comparative Study. Agriculture 2020, 10, 652. [Google Scholar] [CrossRef]
- Stommel, J.R.; Lightbourn, G.J.; Winkel, B.S.; Griesbach, R.J. Transcription factor families regulate the anthocyanin biosynthetic pathway in Capsicum annuum. J. Am. Soc. Hortic. Sci. 2009, 134, 244–251. [Google Scholar] [CrossRef] [Green Version]
- Aguilar-Barragán, A.; Ochoa-Alejo, N. Virus-induced silencing of MYB and WD40 transcription factor genes affects the accumulation of anthocyanins in Chili pepper fruit. Biol. Plant 2014, 58, 567–574. [Google Scholar] [CrossRef]
- Zhang, Z.; Li, D.W.; Jin, J.H.; Yin, Y.X.; Zhang, H.X.; Chai, W.G.; Gong, Z.H. VIGS approach reveals the modulation of anthocyanin biosynthetic genes by CaMYB in Chili pepper leaves. Front. Plant Sci. 2015, 6, 500. [Google Scholar] [CrossRef] [Green Version]
Name/Code | Description | Appearance |
---|---|---|
‘Pim. Ney.’ | C. chinense, extreme purple throughout each phenophase | |
11263 | matures from lilac to red, pax, Leb | |
11270 | matures from purple to yellow, pax+, Leb | |
11274 | matures from purple to red, pax+, Leb-s | |
11278 | matures from white to red, pax | |
11280 | matures from white to red, pax+, Leb+ | |
‘Soroksári’ | matures from white to red, asx |
Forward 5′–3′ | Reverse 5′–3′ | Source | |
---|---|---|---|
ACT | GGACTCCGGTGATGGTGT | GTCCCTGACAATTTCTCGCTCAG | own design |
Ca10g11650 | TGGCTGCAGTTGGGATCTTT | TCCCAACCATCACTTTGTCCT | |
Ca10g11690 | TACTCGCCTTCTGAGGAAGGTA | TGGTACTTGAGAAGTTCCGAGG | |
Ca10g11710 | GACAGCGAGCGATGTGAAAA | GGCACTTGAGAAGTTCTGTGG | |
CHS | AGGAGGTTCGAAGGGAACAA | CCATCACCAAAGAGTGCTTG | based on Aza-Gonzalez et al. |
CHI | CCTCCTGGTTCTAACACCACC | CTTTGCGGCAGGTGAAACTC | |
F3H | GGCATGTGTGGATATGGACC | CCTCCGGTGCTGGATTCTG | |
F3′5′H | GATGGGGTGGCCGGTGATTG | GCCACCACAACGCGCTCG | |
DFR | CTAACACAGGGAAGAGGCTGGTTT | AATCGCTCCAGCTGGTCTCATCAT | own design |
ANS | ACCAGAACTAGCACTTGGCG | ACGCACTTTGCAGTTACCCA | |
UFGT | GGATGGTGTCAAACAAGGC | GTTCAGTACAACACCATCTGC | based on Aza-Gonzalez et al. |
GST | TGATTCTCTCGAGCAGAAAAAACC | TGGATAACCTTTGTTCATATATG |
GS1 | TMA | TPC | FRAP | TFC | TC | CAT | SOD | POD |
---|---|---|---|---|---|---|---|---|
µg cy-3-glu/g | mg Ga/g | µmol As/g | mg Qe/g | mg/kg | U/g | U/g | U/g | |
‘Pim. Ney.’ | 134,897.45 ± 723.37 a | 116.78 ± 8.32 a | 515.55 ± 6.26 a | 45.38 ± 0.25 a | 341.79 ± 113.45 a,b | 8.97 ± 0.76 a,b | 46.75 ± 2.53 a | 67.90 ± 5.50 a,c |
11263 | 10,222.68 ± 159.52 b | 43.73 ± 0.12 b,c | 281.67 ± 1.52 b | 56.98 ± 0.2 b | 273.21 ± 6.50 a,b | 8.72 ± 1.12 a,b | 42.53 ± 5.27 a | 26.60 ± 13.55 b |
11270 | 56,575.27 ± 1445.30 c | 43.15 ± 0.13 b,c | 359.28 ± 2.30 c | 15.78 ± 0.04 c | 105.60 ± 6.02 a | 4.56 ± 0.68 a,b | 64.84 ± 1.93 a | 36.18 ± 2.44 a,b |
11274 | 17,929.89 ± 6025.39 b | 43.11 ± 0.26 b,c | 366.58 ± 3.80 c | 86.34 ± 0.54 d | 448.47 ± 44.00 b | 10.38 ± 2.14 a | 58.48 ± 3.07 a | 24.07 ± 2.10 b |
11278 | Nd 1 | 60.34 ± 3.64 b | 232.84 ± 0.81 d | 49.97 ± 0.30 e | 489.41 ± 93.06 b,c | 4.21 ± 0.83 a,b | 48.85 ± 5.60 a | 44.59 ± 4.79 a,b,c |
11280 | Nd 1 | 35.08 ± 0.32 c | 455.04 ± 1.34 e | 65.55 ± 0.16 f | 432.05 ± 47.63 a,b | 8.77 ± 1.45 a,b | 158.46 ± 33.82 b | 80,34 ± 6.75 c,d |
‘Soroksári’ | Nd 1 | 84.57 ± 0.56 d | 511.03 ±1.76 a | 17.01 ± 0.70 c | 193.37 ± 55.77 a,b | 3.18 ± 1.10 b | 41.18 ± 3.01 a | 115.92 ± 9.10 d |
GS2 | ||||||||
‘Pim. Ney.’ | 461,480.11 ± 6274.54 a | 107.13 ± 9.77 a | 945.29 ± 1.33 a | 50.54 ± 0.71 a | 1108.41 ± 62.66 a | 8.52 ± 1.55 a | 163.79 ± 22.15 a | 46.88 ± 0.08 a |
11263 | 5615.80 ± 412.52 b | 33.07 ± 1.02 b | 181.02 ± 0.63 b | 34.51 ± 0.03 b | 473.84 ± 26.14 b | 3.53 ± 0.23 b | 55.76 ± 6.22 b | 44.99 ± 1.42 a |
11270 | 20543.74 ± 958.88c | 25.57 ± 0.42 b | 129.29 ± 0.83 c | 22.62 ± 0.03 c | 825.08 ± 58.10 a | 5.14 ± 0.85 a, b | 74.58 ± 1.51 b | 62.75 ± 1.20 a |
11274 | 7754.45 ± 630.72 b,c | 44.75 ± 0.88 b,c | 306.80 ± 1.46 d | 83.23 ± 0.27 d | 1493.24 ± 93.68 c | 2.93 ± 0.13 b | 28.15 ± 1.98 b | 59.83 ± 0.78 a |
11278 | Nd 1 | 66.33 ± 5.30 c | 358.24 ± 2.86 e | 30.07 ± 0.07 e | 451.59 ± 44.93 b | 1.68 ± 0.12 b | 29.37 ± 1.18 b | 59.18 ± 5.97 a |
11280 | Nd 1 | 61.86 ± 7.26 c,d | 411.35 ± 1.13 f | 112.50 ± 0.17 f | 1495.11 ± 49.65 c | 2.32 ± 0.04 b | 38.27 ± 0.40 b | 145.09 ± 7.72 b |
’Soroksári’ | 356.25 ± 22.85 b | 42.74 ± 1.96 b,c | 199.79 ± 0.88 g | 10.48 ± 0.04 g | 511.38 ± 41.75 b | 4.27 ± 0.27 b | 30.58 ± 7.84 b | 68.89 ± 16.00 a |
Breaker | ||||||||
‘Pim. Ney.’ | 517,082.19 ± 13557.80 a | 196.38 ± 2.19 a | 1737.93 ± 8.96 a | 43.93 ± 0.99 a | 583.01 ± 42.03 a | 15.60 ± 0.57 a | 85.38 ± 9.31 a | 129.80 ± 19.58 a |
11263 | Nd 1 | 21.72 ± 0.34 b | 153.49 ± 0.27 b | 9.39 ± 0.08 b | 1085.18 ± 93.27 a,b | 4.98 ± 0.72 b | 37.09 ± 1.12 b | 57.12 ± 0.79 b |
11270 | 3962.81 ± 218.28 b | 21.79 ± 0.89 b | 108.40 ± 0.16 c | 6.45 ± 0.06 c | 1201.93 ± 32.17 b | 5.45 ± 0.37 b | 9.29 ± 4.36 c | 64.02 ± 6.93 b |
11274 | 2143.08 ± 318.16 b | 24.42 ± 2.31 b,d | 266.32 ± 0.33 d | 6.29 ± 0.02 c | 1129.88 ± 130.97 a,b | 6.57 ± 4.74 a,b | 14.50 ± 0.95 c | 29.82 ± 0.97 b |
11278 | 521.84 ± 60.26 b | 87.66 ± 1.68 c | 751.18 ± 1.33 e | 11.97 ± 0.05 d | 679.61 ± 167.51 a,b | 3.84 ± 0.63 b | 7.13 ± 0.34 c | 30.91 ± 0.89 b |
11280 | Nd 1 | 30.80 ± 1.16 d,e | 199.44 ± 0.38 f | 7.15 ± 0.03 c | 825.88 ± 73.16 a,b | 6.08 ± 1.22 a,b | 5.47 ± 0.72 c | 33.12 ± 2.97 b |
’Soroksári’ | Nd 1 | 36.10 ± 2.04 e | 275.31 ± 0.46 d | 10.41 ± 0.07 b,d | 1198.05 ± 121.63 b,c | 7.17 ± 0.94 a,b | 6.83 ± 0.11 c | 55.32 ± 14.29 b |
Ripe | ||||||||
‘Pim. Ney.’ | 154,812.58 ± 77.25 a | 98.08 ± 5.63 a | 1155.14 ± 2.98 a | 27.57 ± 0.27 a | 717.20 ± 186.46 a | 56.90 ± 2.94 a | 115.58 ± 8.33 a | 74.79 ± 10.59 a,b |
11263 | Nd 1 | 21.12 ± 0.59 b | 245.63 ± 0.30 b | 5.32 ± 0.02 b | 1847.56 ± 366.00 a | 8.85 ± 1.24 b | 179.60 ± 29.65 a | 165.10 ± 24.19 a,b |
11270 | 352.08 ± 29.04 b | 23.87 ± 0.49 b | 217.02 ± 0.67 c | 2.10 ± 0.05 c | 1204.84 ± 189.71 a | 5.07 ± 0.86 b | 202.32 ± 155.68 a | 198.94 ± 81.22 a |
11274 | Nd 1 | 21.83 ± 0.98 b | 178.77 ± 0.55 d | 10.22 ± 0.08 d | 1651.30 ± 450.35 a | 4.28 ± 0.23 b | 16.48 ± 1.40 a | 21.03 ± 6.23 b |
11278 | Nd 1 | 17.06 ± 0.75 b | 133.71 ± 0.18 e | 20.52 ± 0.08 e | 2929.87 ± 510.87 a | 9.91 ± 1.18 b | 79.44 ± 19.74 a | 75.59 ± 9.44 a,b |
11280 | Nd 1 | 42.94 ± 1.51 c | 466.69 ± 0.63 f | 10.55 ± 0.06 d | 3874.30 ± 1065.33 a,b | 3.41 ± 0.64 b | 29.94 ± 15.11 a | 25.15 ± 11.95 b,c |
’Soroksári’ | Nd 1 | 22.30 ± 0.84 b | 207.80 ± 0.24 g | 7.04 ± 0.05 f | 6168.53 ± 921.44 b | 7.94 ± 1.24 b | 5.19 ± 2.07 a | 6.18 ± 0.93 b,d |
CAT | SOD | POD | FRAP | TPC | TMA | TFC | TC | Colour | |
---|---|---|---|---|---|---|---|---|---|
CAT | 1 | ||||||||
SOD | 0.209 | 1 | |||||||
POD | 0.110 | 0.763 ** | 1 | ||||||
FRAP | 0.523 ** | 0.200 | 0.097 | 1 | |||||
TPC | 0.322 ** | 0.079 | −0.001 | 0.906 ** | 1 | ||||
TMA | 0.272 | 0.301 * | 0.226 | 0.849 ** | 0.848 * | 1 | |||
TFC | 0.008 | 0.064 | −0.052 | 0.208 | 0.281 ** | 0.218 | 1 | ||
TC | −0.024 | −0.025 | −0.143 | −0.150 | −0.259 * | 0.077 | −0.194 | 1 | |
Colour | 0.457 ** | 0.165 | 0.036 | 0.531 ** | 0.526 ** | 0.609 ** | 0.222 * | −0.242 * | 1 |
TMA | TPC | TFC | FRAP | |
---|---|---|---|---|
Genotype (G) | 5918.75 | 438.54 | 12,311.20 | 61,209.87 |
Maturity (M) | 537.56 | 86.37 | 37,756.75 | 4501.43 |
G x M | 633.38 | 46.37 | 5255.05 | 9704.27 |
Gene ID | Phenophase | ‘Pim. Ney.’ | 11263 | 11270 | 11274 | 11278 | 11280 |
---|---|---|---|---|---|---|---|
Ca10g11650 | GS1 | 1126.61 | 10.94 | 9.00 | 16.87 | 0.46 | 0.21 |
GS2 | 2893.52 | 14.47 | 11.41 | 9.94 | 0.21 | 0.06 | |
Breaker | 35.89 | 3.66 | 3.02 | 4.97 | 0.23 | 0.31 | |
Ripe | 11.16 | 5.53 | 1.57 | 3.09 | 0.20 | 0.10 | |
Ca10g11690 | GS1 | 17.71 | 2.37 | 5.07 | 2.06 | 0.02 | 0.47 |
GS2 | 16.35 | 18.11 | 23.61 | 0.20 | 0.03 | 0.28 | |
Breaker | 5.25 | 1.47 | 1.53 | 0.18 | 0.06 | 0.44 | |
Ripe | 3.36 | 0.53 | 0.86 | 0.05 | 0.03 | 0.24 | |
Ca10g11710 | GS1 | 80.05 | 8.25 | 12.12 | 0.43 | 0.36 | 0.47 |
GS2 | 302.22 | 3.54 | 29.17 | 0.50 | 1.23 | 0.24 | |
Breaker | 177.36 | 0.46 | 1.74 | 0.32 | 0.85 | 0.48 | |
Ripe | 171.32 | 0.36 | 0.29 | 0.36 | 0.67 | 0.42 | |
Crude sample extracts’ colour | GS1→Ripe | | | | | | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kovács, Z.; Bedő, J.; Pápai, B.; Tóth-Lencsés, A.K.; Csilléry, G.; Szőke, A.; Bányai-Stefanovits, É.; Kiss, E.; Veres, A. Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines. Antioxidants 2022, 11, 637. https://doi.org/10.3390/antiox11040637
Kovács Z, Bedő J, Pápai B, Tóth-Lencsés AK, Csilléry G, Szőke A, Bányai-Stefanovits É, Kiss E, Veres A. Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines. Antioxidants. 2022; 11(4):637. https://doi.org/10.3390/antiox11040637
Chicago/Turabian StyleKovács, Zsófia, Janka Bedő, Bánk Pápai, Andrea Kitti Tóth-Lencsés, Gábor Csilléry, Antal Szőke, Éva Bányai-Stefanovits, Erzsébet Kiss, and Anikó Veres. 2022. "Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines" Antioxidants 11, no. 4: 637. https://doi.org/10.3390/antiox11040637
APA StyleKovács, Z., Bedő, J., Pápai, B., Tóth-Lencsés, A. K., Csilléry, G., Szőke, A., Bányai-Stefanovits, É., Kiss, E., & Veres, A. (2022). Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines. Antioxidants, 11(4), 637. https://doi.org/10.3390/antiox11040637