Next Article in Journal
AndroCom: A Real-World Android Applications’ Vulnerability Dataset to Assist with Automatically Detecting Vulnerabilities
Previous Article in Journal
Out-of-Roundness Wheel Damage Identification in Railway Vehicles Using AutoEncoder Models
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece

by
Nikolaos Tzimotoudis
1,
Antonia Mataragka
2,*,
Nikolaos D. Andritsos
3 and
John Ikonomopoulos
2
1
Laboratory of Microbiology, Hellenic Army Biological Research Centre, 6 Taxiarchou Velliou Str., P. Penteli, 15236 Attica, Greece
2
Laboratory of Anatomy and Physiology of Farm Animals, Department of Animal Science, School of Animal Biosciences, Agricultural University of Athens, 75 Iera Odos, 11855 Athens, Greece
3
Department of Food Science and Technology, School of Agricultural Sciences, University of Patras, 2 G. Seferi Str., 30100 Agrinio, Greece
*
Author to whom correspondence should be addressed.
Appl. Sci. 2025, 15(5), 2664; https://doi.org/10.3390/app15052664
Submission received: 10 January 2025 / Revised: 26 February 2025 / Accepted: 27 February 2025 / Published: 1 March 2025
(This article belongs to the Section Food Science and Technology)

Abstract

The drinking water cycle consists of the stages of untreated water, potable water, and sewage. Escherichia coli is considered an indicator of the fecal contamination of water since it is a common bacterium of the intestinal flora of humans and warm-blooded animals and is a carrier of many antibiotic resistance genes. The aim of this investigation was to assess the level of drug resistance of coliforms and E. coli isolates in samples of drinking water submitted from various sites of Central South Greece during the period 2018–2022. The highest resistance rates among both E. coli and coliform isolates were observed against ampicillin. The analysis of drug resistance conducted with reference to antibiotic groups indicated that most AMR and/or MDR isolates of E. coli or coliforms exhibited resistance against group A (ampicillin and amoxicillin/clavulanic acid). The most frequent phylogroup of the E. coli isolates was B1 followed by groups A and B2. The genus assignment for the coliform isolates other than E. coli was Enterobacter, Citrobacter, Klebsiella, and Serratia. In conclusion, various bacteria can be transferred from one stage of the drinking water cycle to the next, either through the normal operation of the cycle or due to system failures, with the consequence that even drinking water contains various bacteria, pathogenic or non-pathogenic.

1. Introduction

Access to safe and clean drinking water is a cornerstone of public and animal health. Globally, the provision of clean drinking water has improved substantially over the past decades, with significant progress driven by initiatives such as the United Nations Sustainable Development Goals (SDGs). SDG 6 aims at universal and equitable access to safe and affordable drinking water by 2030 [1]. However, despite these advancements, striving to ensure clean and safe drinking water, particularly in low-income and developing regions, remains a challenge. To this end, approximately 2 billion people globally still rely on contaminated drinking water sources, exposing them to a variety of diseases, including cholera and typhoid fever [2,3].
The quality of drinking water varies significantly depending on water management practices [4,5]. In high-income countries, regulatory frameworks and advanced water treatment facilities and technologies ensure that drinking water meets stringent safety standards. For instance, countries in North America and Europe routinely achieve compliance rates above 95% for microbial and chemical parameters [6], whereas many low- and middle-income countries often fail to control drinking water contamination from anthropogenic activities for reasons that are ultimately associated with underfunding [7,8]. Pathogens, including bacteria, viruses, and protozoa, remain widespread contaminants, particularly in areas with limited sanitation infrastructure [9,10]. Furthermore, untreated or poorly treated water sources contribute significantly to the spread of antibiotic resistance (AMR) genes that can be readily transferred to human and animal pathogens [11]. The emergence of AMR is exacerbated by antibiotics entering water systems through various pathways, including wastewater discharge from households, hospitals, and pharmaceutical industries, as well as agricultural runoff containing veterinary drugs [12,13]. It is noteworthy that the presence of antibiotics, even at trace concentrations in drinking water, has been shown to contribute to the emergence of resistance, with significant implications for public and animal health [11,14].
Based on the above, routine monitoring for microbial contamination and drug resistance is of key significance in maintaining high drinking water quality. Therefore, this study focused on the phylogroup and genus assignment of drinking water isolates of Escherichia coli and coliforms, respectively, and the assessment of their AMR.

2. Materials and Methods

2.1. Sample Collection

Within the context of compulsory routine monitoring for the microbiological safety of drinking water [15], we tested 2450 water samples submitted from various urban and rural sites of Central South Greece (mainland and islands) during a five-year period from 2018 to 2022 (Figure 1). As foreseen by the applicable regulation, sample collection was conducted monthly by the local competent authorities following standard procedures [15].
The samples submitted from each site were grouped per irrigation network (1 sample/network) and were microbiologically analyzed for the isolation of Escherichia coli and coliforms.

2.2. Isolation and Confirmation of Microbial Isolates

The isolation and confirmation of E. coli and coliform bacteria from the samples of drinking water were performed according to the standard methodology described in a relevant protocol published by the International Organization for Standardization (ISO 9308-1:2014) [16]. The analyses were conducted in a laboratory accredited under standard ISO/IEC 17025:2017 [17].
Briefly, regarding E. coli isolation from the water samples, one isolate was randomly selected from those dark-blue to violet colonies grown on chromogenic coliform agar (CCA) plates (Laboratorios Conda, S.A., Madrid, Spain) of each positive sample, whereas with regard to coliform bacteria, the same approach was followed by picking a pink to red well-isolated colony from the CCA plates of positive samples and performing the following biochemical tests: Gram-stain, Indole, Methyl Red, Voges–Proskauer, Citrate, Urea, Motility, Lactose, Oxidase and H2S (HiMedia Laboratories GmbH, Modautal, Germany). The E. coli isolates were further characterized by phylogroup assignment using the polymerase chain reaction (PCR), while coliforms other than E. coli were assigned also to the genera Enterobacter, Citrobacter, Klebsiella, and Serratia using PCR, followed by the antibiotic susceptibility testing (AST) of all the isolates.

2.3. Phylogroup and Genus Assignment of E. coli and Coliform Isolates Respectively

The phylogroup assignment of E. coli isolates and genus assignment of coliform isolates was conducted as previously described [18,19,20]. The primer sequences and PCR conditions for the phylogroup and genus assignment of E. coli and coliform isolates, respectively, are presented in Table 1A,B. Reference strains of E. coli ATCC 25922, Klebsiella pneumoniae ATCC 700603, Enterobacter cloacae ATCC 700323, Serratia marcescens ATCC 8100, and Citrobacter freundii ATCC 43864 were used for quality control (BioMérieux Inc., Durham, NC, USA).
DNA isolation was achieved using a commercially available kit according to the manufacturer’s instructions (Nucleospin® Tissue, Macheray-Nagel GmbH & Co. KG, Düren, Germany). The quality of the isolated DNA was assessed for purity and integrity with agarose gel electrophoresis followed by image analysis using a Bio-Rad ChemiDoc XRS+ Molecular Imager (Bio-Rad Laboratories Inc., Hercules, CA, USA), whereas spectrophotometry was used to measure optical density at 260/280 nm via a NanoDrop 8000 Spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA).

2.4. Antibiotic Susceptibility Testing

AST was conducted on the E. coli (n = 220) and coliform (n = 138) isolates with the Kirby–Bauer method [21] using the following antibiotics and the breakpoints determined by the European Committee on Antimicrobial Susceptibility Testing (EUCAST) [22]: ciprofloxacin (CIP: 5 μg), tetracycline (TE: 30 μg), gentamicin (CN: 10 μg), trimethoprim/sulfamethoxazole (SXT: 1.25/23.75 μg), ampicillin (AM: 10 μg), amoxicillin/clavulanic acid (AMC: 15 μg), ceftazidime (CAZ: 10 μg), cefoxitin (FOX: 30 μg), cefotaxime (CTX: 5 μg), meropenem (MEM: 10 μg), cefadroxil (CFR: 30 μg), cefuroxime sodium (CXM: 30 μg), cefixime (CFM: 5 μg), imipenem (IMP: 10 μg), and cefepime (FEP: 30 μg). Antibiotic disks were supplied by Oxoid (Oxoid Limited, Basingstoke, UK). Reference strains of E. coli ATCC 25922, Klebsiella pneumoniae ATCC 700603, Enterobacter cloacae ATCC 700323, Serratia marcescens ATCC 8100, and Citrobacter freundii ATCC 43864 were used for quality control for AST tests (bioMérieux Inc., Durham, UK).
E. coli and coliform isolates were characterized as an antibiotic (AMR), or multidrug-resistant (MDR), as proposed by others [23]. In brief, AMR is defined as non-susceptibility to at least one antibiotic group to which the test pathogen is typically susceptible, whilst MDR, as non-susceptibility to at least one agent from three antibiotic groups.

3. Results

3.1. Characterization of Microbial Isolates

In total, 358 microbial isolates of E. coli and coliform bacteria other than E. coli were recovered from the collected drinking water samples (220 E. coli and 138 other coliforms). The phylogroup assignment for the 220 E. coli isolates was A 18.6% (n = 41), B1 26.4% (n = 58), B2 17.3% (n = 38), D 4.1% (n = 9), E 0.9% (n = 2), F 3.6% (n = 8), Clades I/II 5.5% (n = 12), Clades III/IV/V 3.2% (n = 7), and 20.5% (n = 45) unclassified. The genus assignment for the 138 coliform isolates other than E. coli was Enterobacter (n = 26, 18.8%), Citrobacter (n = 56, 40.6%), Klebsiella (n = 51, 37%), and Serratia (n = 5, 3.6%).

3.2. Antibiotic Susceptibility Testing (AST) of Microbial Isolates

AST indicated that most E. coli isolates were resistant to ampicillin (16.4%, 36 of 220) and tetracycline (9.5%, 21 of 220). The percentage of E. coli isolates that exhibited resistance to the rest of the antibiotics included in the study ranged from 0.5% (cefotaxime) to 4.1% (cefadroxil, cefoxitin, and trimethoprim/sulfamethoxazole) (Table 2A). All the E. coli isolates tested (100%) were susceptible to gentamicin and meropenem, whereas the relevant percentages recorded for the rest of the antibiotics tested ranged from 83.6% (ampicillin) to 99.1% (cefotaxime) (Table 2A).
The results recorded in connection with the AST of the 138 coliform isolates indicated again that resistance was more commonly exhibited against ampicillin (72.5%). The relevant percentages for the rest of the antibiotics tested, for which resistance was recorded, ranged between 1.4% (cefuroxime) and 45.7% (cefoxitin) (Table 2B). All the coliform isolates (100%) were susceptible to cefepime, ciprofloxacin, gentamicin, imipenem, meropenem, and trimethoprim/sulfamethoxazole, whereas the relevant percentages recorded for the rest of the antibiotics tested ranged between 27.5% (ampicillin) and 98.6% (cefuroxime), (Table 2B).

3.3. Antibiotic Resistance of Microbial Isolates

Forty-six (n = 46) of the two hundred and twenty E. coli isolates (20.9%) and one hundred and fourteen of one hundred and thirty-eight (82.6%) coliform isolates exhibited resistance to at least one antibiotic, with the higher percentages recorded in all cases in connection with ampicillin (78.3%, thirty-six of forty-six for E. coli and 87.7%, one hundred of one hundred and fourteen for coliform isolates), (Group A antibiotics; Figure 2A,B).
The analysis of resistant E. coli isolates per phylogroup indicated that the highest percentage of isolates exhibiting resistance to any antibiotic belonged to phylogroups A (36.6%, 15 of 41) and B1 (29.3%, 17 of 58) (total AMR + MDR; Figure 3A). No resistant isolates were detected from phylogroups E and F, and only one isolate was detected from phylogroup D (11.1%, 1 of 9), Clade I/II (8.3%, 1 of 12), and Clade III/IV/V (14.3%, 1 of 7), (Figure 3A).
The analysis of resistant coliforms per genus indicated that the highest percentage of isolates exhibiting resistance to any antibiotic belonged to Enterobacter and Serratia (100.0%), followed by Citrobacter (82.1%, 46 of 56) and Klebsiella (72.5%, 37 of 51) (total AMR + MDR; Figure 3B).
The AMR/MDR classification of antibiotic resistance for the E. coli phylogroups indicated that 73.9% (34 of 46) and 26.1% (12 of 46) of the isolates were characterized as AMR and MDR, respectively (Figure 3A). The relevant results for coliforms indicated that 96.5% (110 of 114) and 3.5% (4 of 114) of the isolates were characterized as AMR and MDR, respectively (Figure 3B). Regarding the levels of drug resistance, the percentage of E. coli isolates that were resistant in one antibiotic group (AMR1) were 50.0% (23 of 46), in two antibiotic groups (AMR2) 23.9% (11 of 46), in three antibiotic groups (MDR3) 19.6% (9 of 46), and in four antibiotic groups (MDR4) 6.5% (3 of 46) (Figure 3A). The relevant percentages recorded in connection with coliforms were 42.1% (48 of 114) for AMR1, 54.4% (62 of 114) for AMR2, and 3.5% (4 of 114) for MDR3, whereas no MDR4 was detected (Figure 3B).
The analysis of drug resistance conducted with reference to antibiotic groups indicated that most AMR and/or MDR isolates of E. coli (78.3%, 36 of 46) or coliforms (93.9%, 107 of 114) exhibited resistance against group A (ampicillin and amoxicillin/clavulanic acid). None of the E. coli isolates exhibited resistance to groups D (gentamicin) and E (meropenem), whereas with regard to coliforms, the antibiotic groups for which resistance was not recorded were groups C (ciprofloxacin), D (gentamicin), E (imipenem and meropenem), and F (trimethoprim/sulfamethoxazole), (Figure 2A,B).
The MDR3 E. coli isolates studied here were in all the cases resistant to antibiotic group A (ampicillin and amoxicillin/clavulanic acid) with the other two being in decreasing order of frequency antibiotic groups G (tetracycline), F (trimethoprim/sulfamethoxazole), and B (ceftazidime, cefadroxil, cefotaxime, and cefoxitin) or C (ciprofloxacin) (Table 3). The MDR4 E. coli isolates were in all the cases (100%) resistant against the same three groups of antibiotics, i.e., A (ampicillin and amoxicillin/clavulanic acid), F (trimethoprim/sulfamethoxazole), and G (tetracycline), with the fourth being either antibiotic group B (ceftazidime, cefadroxil, cefotaxime, and cefoxitin) or C (ciprofloxacin) (Table 3).
The respective results recorded in connection with coliforms indicate higher homogeneity, since all (100%) the MDR3 isolates exhibited resistance to the antibiotic groups A (ampicillin and amoxicillin/clavulanic acid), B (ceftazidime, cefixime, cefadroxil, cefotaxime, cefuroxime, and cefoxitin), and G (tetracycline), (Table 3).

4. Discussion

Approximately 26 centuries ago, the ancient Greek physician Hippocrates (460 B.C.E.–367 B.C.E.) recorded in his book “On Airs, Waters and Places” his conclusions about the significance of clean water in the preservation of health, and at the same time made what has been considered to be the earliest scientific reference to the One Health concept [24]. Nowadays, the reports that link water quality to public and animal health demonstrate without doubt the significance of the continuous monitoring of the quality of drinking water, particularly in connection with the spread of microbial pathogens [25,26] and elements of drug resistance [27,28].
Based on this, the investigation presented herein relied on two commonly used hygiene indicator organisms of drinking water quality, namely E. coli and coliforms, and focused on the characterization of 358 microbial isolates recovered from drinking water samples collected from several urban and rural locations in Greece. All the microbiological analyses for the water samples were conducted in an accredited laboratory in full compliance with the ISO 17025 requirements. Moreover, this investigation implements similar studies conducted in the past in Greece [29,30,31,32,33], Peru [34], various African countries [35], Mozambique [36], and Bangladesh [37], which constitute a reliable point of reference for the conclusions reported here.
In connection with the phylogroup assignment of the E. coli isolates that were studied, our findings conclude that phylogroups B1 (26.4%) and A (18.6%) are the most prevalent, which agrees with other studies on drinking water in Greece [30,32], Bangladesh [37], Iran [38], and Kenya [39], and probably accounts for the certain phylogroups harboring the highest percentages of AMR and MDR (29.3% and 36.6% for phylogroups B1 and A, respectively). Based on the information available in the relevant literature, certain phylogroups of E. coli demonstrate high adaptability and environmental resilience, which in effect renders them the most detected in fresh water, particularly in sources of fecal contamination both from humans and animals [40,41,42,43].
Regarding the genus assignment of the detected coliforms, the relevant reports indicate that the most detectable genera are mostly Citrobacter, Enterobacter, and Klebsiella, with Serratia being the least commonly detected genus, which is also consistent with our findings [44,45,46,47]. All the coliforms are commonly found in the environment and may colonize water distribution systems, particularly under conditions conducive to biofilm formation [48,49]. The detection of these bacteria in drinking water raises concern about potential public health risks, particularly in connection with Klebsiella, which is often identified as the causal agent of healthcare-associated infections, especially among immunocompromised individuals, and has been strongly implicated in the horizontal transfer of antibiotic resistance genes [46,50,51]. The variations in the prevalence of the most common coliform genera in drinking water probably underscore their varying adaptation ability to different ecological niches within water distribution systems. The composition, quantity, and antibiotic resistance profiles of coliform bacteria in drinking water reservoirs are significantly influenced by seasonal, regional, and environmental dynamics, including climate change and water treatment practices [52]. The occurrence of eutrophication, where excessive nutrients stimulate algal growth and oxygen depletion, can further alter microbial community structures, promoting the dominance of resistant bacteria over non-resistant strains [52].
The results recorded with regard to the antibiotic susceptibility of E. coli indicate that the tested isolates were in all the cases sensitive to gentamicin and meropenem, whereas resistance was recorded primarily in connection with ampicillin and tetracycline. These findings are again consistent with those of other reports [32,34,43,45]. In this regard, it can be stated that the certain profile of antibiotic susceptibility/resistance constitutes a rather common feature of E. coli isolated from drinking water. Regarding the antibiotic resistance of the studied coliform isolates, the results recorded here were also similar to those of other studies with susceptibility against cefepime, ciprofloxacin, gentamicin, imipenem, meropenem, and trimethoprim/sulfamethoxazole being very common, and resistance recorded in connection primarily with ampicillin and cefoxitin [45,53,54].
Ampicillin resistance proved a common feature for most drug-resistant isolates of E. coli (87.7%, 100 of 114) and coliforms (78.3%, 36 of 46) in the present study. The resistance of E. coli and coliform bacteria to penicillins, including ampicillin and other beta-lactam antibiotics, is often mediated by the production of beta-lactamase enzymes such as TEM and SHV [55,56]. These resistant bacteria are frequently detected in drinking water sources contaminated with untreated or partially treated sewage, agricultural runoff, and hospital effluents, which raises concern about the efficiency of currently applicable drinking water management systems [57,58,59,60]. Penicillin-resistant E. coli and coliforms have been shown to survive conventional water treatment processes, including chlorination, particularly through biofilm formation, which, thus, becomes a potent reservoir of drug resistance genes [61,62,63], not only because water serves as a very effective medium for their spread, but also because of their high ability to acquire resistance through horizontal gene transfer. In effect, drug-resistant E. coli may spread among bacterial communities in water systems and human microbiota [64,65].
Comparing antibiotic resistance between the two groups of the tested isolates indicates that AMR percentage was higher for coliforms compared to E. coli (96.5% coliforms vs. 73.9% E. coli), with the reverse being recorded in connection with MDR (26.1% E. coli vs. 3.5% coliforms). Notably, none of the coliform isolates exhibited resistance to more than three groups of antibiotics, whereas the relevant percentage of E. coli was 6.5% (MDR4), (Table 3). Regarding the phylogroup and genus allocation of the MDR isolates, the findings that were recorded indicate that most MDR E. coli isolates belonged to phylogroup A, whereas the MDR coliforms were identified in decreasing order as Klebsiella, Enterobacter, and Serratia (Table 3).
The detection of MDR4 E. coli isolates in water does not constitute an uncommon finding, with other research groups reporting the detection of E. coli isolates exhibiting resistance against up to nine groups of antibiotics (MDR9) [41,65,66,67]. To the best of our knowledge, the highest level of drug resistance recorded for E. coli isolates from water has been reported in Greece, with the relevant isolates exhibiting resistance to an impressive 10 groups of antibiotics [32]. It is perhaps worth noting that Greece reports one of the highest consumptions of antibiotics in Europe, both in the community and hospital sector [68]. In more detail, in the year 2019, Greece reported a total of 34.1 defined daily doses (DDD) of antibiotics per 1000 inhabitants per day, with the average in EU/EEA being 19.4 DDD. The relevant percentage recorded in the community the same year in Greece was 32.4 DDD, which indicates broad non-nosocomial antibiotic usage [69]. Certain findings become perhaps more alarming given that the highest antibiotic consumption in Greece refers to broad-spectrum antibiotics, particularly penicillins, third- and fourth-generation cephalosporins, and fluoroquinolones [68]. Unfortunately, a similar negative distinction is also recognized for Greece among the European countries for reporting the highest prevalence of antibiotic-resistant ESKAPEE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter species, and Escherichia coli) infections in acute care hospitals, and an estimated annual incidence of >25,000 patients with nosocomial infections caused by difficult-to-treat pathogens [70].
Based on the evidence available in the literature, the most common profile of MDR ≥ 3 E. coli isolates in water in Greece consists primarily of resistance against penicillins, especially amoxicillin, third-generation cephalosporins [30,32], and fluoroquinolones, primarily ciprofloxacin [32]. The certain combination is identical to the drug resistance profile of 33.3% (three of nine) of the MDR3 isolates of E. coli that were recovered in this study. The relevant reports are also consistent with the drug resistance profile of the MDR4 isolates identified herein, which consists primarily of Group A (ampicillin and amoxicillin/clavulanic acid), F (trimethoprim/sulfamethoxazole), G (tetracycline), and to a smaller percentage of Group B (ceftazidime, cefixime, cefadroxil, cefotaxime, cefuroxime, cefepime, and cefoxitin) and Group C (ciprofloxacin), [29,31,33]. Notably, E. coli is the most commonly detected causal agent of community-, and hospital-acquired urinary tract infections in humans [71,72,73]. Interestingly, these infections are usually treated with a combination of antibiotics (trimethoprim/sulfamethoxazole, ciprofloxacin, and amoxicillin/clavulanic acid), which seems to reflect clearly on the MDR3/4 profile of the certain pathogen detected here [30].
The information available in the international literature in connection with MDR coliforms in drinking water is considerably less compared to that available for E. coli. However, several reports concluded the detection of coliform genera that are similar to those detected here [34,45,74]. The consistency of our findings to those of other research groups applies too in connection with the MDR3 profile of the coliforms detected in drinking water [45], which usually consists of groups A (ampicillin and amoxicillin/clavulanic acid), B (ceftazidime, cefixime, cefadroxil, cefotaxime, cefuroxime, and cefoxitin), and G (tetracycline), (Table 3).

5. Conclusions

In conclusion, it can be stated that the presence of several MDR E. coli and coliform bacteria in drinking water, which was confirmed by the findings of this study, is in agreement with those of many other studies conducted on humans and animals in Greece and abroad, which in turns underscores the need for improved water treatment methods and the enforcement of stricter antibiotic use regulations in both healthcare and agriculture.
The prevalence of phylogroups B1 and A among E. coli isolates, along with the detection of coliform genera Klebsiella, Enterobacter, Citrobacter, and Serratia, aligns with previous studies and suggests a significant environmental resilience and adaptability of these bacteria. The high resistance rates to ampicillin and other beta-lactam antibiotics further emphasize the challenges posed by antibiotic-resistant bacteria in water systems. These findings are consistent with global reports on AMR in water sources, particularly in regions with high antibiotic usage and inadequate water treatment infrastructure.
The transmission of drug resistance genes between isolates found in drinking water, animals, and humans renders the need for a One Health approach to control the spread of such microbial strains necessary, with the control measures targeting improved antibiotic stewardship, advanced water treatment technologies, and continuous surveillance.

Author Contributions

Conceptualization, J.I. and N.T.; methodology, N.T. and N.D.A.; software, N.T. and N.D.A.; validation, N.T. and N.D.A.; formal analysis, A.M.; investigation, A.M.; resources, N.T. and N.D.A.; data curation, A.M.; writing—original draft preparation, A.M.; writing—review and editing, A.M., J.I., N.T. and N.D.A.; visualization, A.M.; supervision, J.I. and A.M.; project administration, J.I. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. UN Sustainable Development Goal 6 on Clean Water and Sanitation (SDG 6): EU Support Through Focused Action; European Parliament. Available online: https://www.europarl.europa.eu/thinktank/en/document/EPRS_BRI(2023)751404 (accessed on 9 January 2025).
  2. WHO/UNICEF Joint Monitoring Programme for Water Supply, Sanitation and Hygiene. Progress on Household Drinking Water, Sanitation and Hygiene 2000–2022: Special Focus on Gender; United Nations Children’s Fund (UNICEF) and World Health Organization (WHO): New York, NY, USA, 2023. [Google Scholar]
  3. Kristanti, R.A.; Hadibarata, T.; Syafrudin, M.; Yılmaz, M.; Abdullah, S. Microbiological Contaminants in Drinking Water: Current Status and Challenges. Water Air Soil Pollut. 2022, 233, 299. [Google Scholar] [CrossRef]
  4. Potgieter, N.; Hoffman, A.N.T. The Relevance of Hygiene to Health in Developing Countries; IntechOpen: London, UK, 2019. [Google Scholar] [CrossRef]
  5. Han, X.; Liu, X.; Gao, D.; Ma, B.; Gao, X.; Cheng, M. Costs and Benefits of the Development Methods of Drinking Water Quality Index: A Systematic Review. Ecol. Indic. 2022, 144, 109501. [Google Scholar] [CrossRef]
  6. OECD. Financing Water Supply, Sanitation and Flood Protection: Challenges in EU Member States and Policy Options; OECD Studies on Water; OECD: Paris, France, 2020. [Google Scholar] [CrossRef]
  7. Khatri, N.; Tyagi, S. Influences of Natural and Anthropogenic Factors on Surface and Groundwater Quality in Rural and Urban Areas. Front. Life Sci. 2015, 8, 23–39. [Google Scholar] [CrossRef]
  8. Kirschke, S.; Avellán, T.; Bärlund, I.; Bogardi, J.J.; Carvalho, L.; Chapman, D.; Dickens, C.W.S.; Irvine, K.; Lee, S.; Mehner, T.; et al. Capacity Challenges in Water Quality Monitoring: Understanding the Role of Human Development. Environ. Monit. Assess 2020, 192, 298. [Google Scholar] [CrossRef] [PubMed]
  9. Shayo, G.M.; Elimbinzi, E.; Shao, G.N.; Fabian, C. Severity of Waterborne Diseases in Developing Countries and the Effectiveness of Ceramic Filters for Improving Water Quality. Bull. Natl. Res. Cent. 2023, 47, 113. [Google Scholar] [CrossRef]
  10. Mills, F.; Willetts, J.; Evans, B.; Carrard, N.; Kohlitz, J. Costs, Climate and Contamination: Three Drivers for Citywide Sanitation Investment Decisions. Front. Environ. Sci. 2020, 8, 130. [Google Scholar] [CrossRef]
  11. Endale, H.; Mathewos, M.; Abdeta, D. Potential Causes of Spread of Antimicrobial Resistance and Preventive Measures in One Health Perspective-A Review. Infect. Drug Resist. 2023, 16, 7515–7545. [Google Scholar] [CrossRef]
  12. Araújo, L.; Silva, S.; Sá, R.; Lima, A.; Barbosa, A.; Silva, J.; Leite, K.; Júnior, W.; Silveira-Filho, V.; Mendes-Marques, C.; et al. Effects of Antibiotics on Impacted Aquatic Environment Microorganisms; IntechOpen: London, UK, 2020. [Google Scholar] [CrossRef]
  13. Harrower, J.; McNaughtan, M.; Hunter, C.; Hough, R.; Zhang, Z.; Helwig, K. Chemical Fate and Partitioning Behavior of Antibiotics in the Aquatic Environment—A Review. Environ. Toxicol. Chem. 2021, 40, 3275–3298. [Google Scholar] [CrossRef]
  14. Kusi, J.; Ojewole, C.O.; Ojewole, A.E.; Nwi-Mozu, I. Antimicrobial Resistance Development Pathways in Surface Waters and Public Health Implications. Antibiotics 2022, 11, 821. [Google Scholar] [CrossRef]
  15. European Parliament; Council of the European Union. Directive (EU) 2020/2184 on the quality of water intended for human consumption. Off. J. Eur. Union 2020, L435, 1–62. Available online: https://eur-lex.europa.eu/eli/dir/2020/2184/oj (accessed on 9 January 2025).
  16. ISO 9308-1:2014; Water Quality—Enumeration of Escherichia coli and Coliform Bacteria—Part 1: Membrane Filtration Method for Waters with Low Bacterial Background Flora. International Organization for Standardization (ISO): Geneva, Switzerland, 2014.
  17. ISO/IEC 17025:2017; General Requirements for the Competence of Testing and Calibration Laboratories. International Organization for Standardization (ISO): Geneva, Switzerland; International Electrotechnical Commision (IEC): Geneva, Switzerland, 2017.
  18. Clermont, O.; Christenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef] [PubMed]
  19. Clermont, O.; Dixit, O.V.A.; Vangchhia, B.; Condamine, B.; Dion, S.; Bridier-Nahmias, A.; Denamur, E.; Gordon, D. Characterization and rapid identification of phylogroup G in Escherichia coli, a lineage with high virulence and antibiotic resistance potential. Environ. Microbiol. 2019, 21, 3107–3117. [Google Scholar] [CrossRef] [PubMed]
  20. Bej, A.K.; Steffan, R.J.; DiCesare, J.; Haff, L.; Atlas, R.M. Detection of Coliform Bacteria in Water by Polymerase Chain Reaction and Gene Probes. Appl. Environ. Microbiol. 1990, 56, 307–314. [Google Scholar] [CrossRef]
  21. Hudzicki, J. Kirby-Bauer Disk Diffusion Susceptibility Test Protocol; American Society for Microbiology: Washington, DC, USA, 2009; pp. 1–23. Available online: https://asm.org/protocols/kirby-bauer-disk-diffusion-susceptibility-test-pro (accessed on 9 January 2025).
  22. European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 14.0. Available online: https://www.eucast.org/clinical_breakpoints (accessed on 9 January 2025).
  23. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
  24. Evans, B.R.; Leighton, F.A. A history of One Health. Sci. Tech. Rev. 2014, 33, 413–420. [Google Scholar] [CrossRef]
  25. Wen, X.; Chen, F.; Lin, Y.; Zhu, H.; Yuan, F.; Kuang, D.; Jia, Z.; Yuan, Z. Microbial Indicators and Their Use for Monitoring Drinking Water Quality—A Review. Sustainability 2020, 12, 2249. [Google Scholar] [CrossRef]
  26. Münster, P.; Kemper, N. Long-Term Analysis of Drinking Water Quality in Poultry and Pig Farms in Northwest Germany. Front. Anim. Sci. 2024, 5, 1467287. [Google Scholar] [CrossRef]
  27. Stec, J.; Kosikowska, U.; Mendrycka, M.; Stępień-Pyśniak, D.; Niedźwiedzka-Rystwej, P.; Bębnowska, D.; Hrynkiewicz, R.; Ziętara-Wysocka, J.; Grywalska, E. Opportunistic Pathogens of Recreational Waters with Emphasis on Antimicrobial Resistance—A Possible Subject of Human Health Concern. Int. J. Environ. Res. Public Health 2022, 19, 7308. [Google Scholar] [CrossRef]
  28. Andrzejak, T.; Raje, H.; LaFleur, G.; Willis, J.; Boopathy, R. Water Quality and Antibiotic Resistance in the Recreational Waters. Bioresour. Technol. 2023, 370, 128546. [Google Scholar] [CrossRef]
  29. Efstratiou, M.A.; Bountouni, M.; Kefalas, E. Spread of Antibiotic Resistance in Aquatic Environments: E. coli as a Case Study. Proceedings 2018, 2, 693. [Google Scholar] [CrossRef]
  30. Dioli, C.; Pappa, O.; Siatravani, E.; Bratakou, S.; Tatsiopoulos, A.; Giakkoupi, P.; Miriagou, V.; Beloukas, A. Molecular Characterization and Prevalence of Antimicrobial-Resistant Escherichia coli Isolates Derived from Clinical Specimens and Environmental Habitats. Microorganisms 2023, 11, 1399. [Google Scholar] [CrossRef] [PubMed]
  31. Kaliakatsos, A.; Gounaki, I.; Dokianakis, S.; Maragkaki, E.; Stasinakis, A.S.; Gyparakis, S.; Katsarakis, N.; Manios, T.; Fountoulakis, M.S.; Venieri, D. Treatment of Hospital Wastewater: Emphasis on Ecotoxicity and Antibiotic Resistance Genes. J. Chem. Technol. Biotechnol. 2024, 99, 2129–2138. [Google Scholar] [CrossRef]
  32. Kotzamanidis, C.; Malousi, A.; Paraskeva, A.; Vafeas, G.; Giantzi, V.; Hatzigiannakis, E.; Dalampakis, P.; Kinigopoulou, V.; Vrouhakis, I.; Zouboulis, A.; et al. River Waters in Greece: A Reservoir for Clinically Relevant Extended-Spectrum-β-Lactamases-Producing Escherichia coli. Sci. Total Environ. 2024, 941, 173554. [Google Scholar] [CrossRef]
  33. Kolokotsa, A.; Leotsinidis, M.; Kalavrouziotis, I.; Sazakli, E. Effects of Tourist Flows on Antibiotic Resistance in Wastewater of a Greek Island. J. Appl. Microbiol. 2021, 130, 516–527. [Google Scholar] [CrossRef] [PubMed]
  34. Larson, A.; Hartinger, S.M.; Riveros, M.; Salmon-Mulanovich, G.; Hattendorf, J.; Verastegui, H.; Huaylinos, M.L.; Mäusezahl, D. Antibiotic-Resistant Escherichia Coli in Drinking Water Samples from Rural Andean Households in Cajamarca, Peru. Am. J. Trop. Med. Hyg. 2019, 100, 1363–1368. [Google Scholar] [CrossRef]
  35. Ramatla, T.; Ramaili, T.; Lekota, K.E.; Ndou, R.; Mphuti, N.; Bezuidenhout, C.; Thekisoe, O. A Systematic Review and Meta-Analysis on Prevalence and Antimicrobial Resistance Profile of Escherichia Coli Isolated from Water in Africa (2000–2021). Heliyon 2023, 9, e16123. [Google Scholar] [CrossRef]
  36. Salamandane, A.; Alves, S.; Chambel, L.; Malfeito-Ferreira, M.; Brito, L. Characterization of Escherichia Coli from Water and Food Sold on the Streets of Maputo: Molecular Typing, Virulence Genes, and Antibiotic Resistance. Appl. Microbiol. 2022, 2, 133–147. [Google Scholar] [CrossRef]
  37. Bhowmik, A.; Shah, S.T.; Goswami, S.; Sirajee, A.S.; Ahsan, S. Predominance of Multidrug Resistant Escherichia Coli of Environmental Phylotype in Different Environments of Dhaka, Bangladesh. Trop. Med. Infect. Dis. 2023, 8, 226. [Google Scholar] [CrossRef]
  38. Rahimi, Z.; Malekzadegan, Y.; Bahador, A.; Azimzadeh, M.; Haghighi, M.A. Phylogenetic Study, Distribution of Virulence Genes and Antibiotic Resistance Profiles of Escherichia coli Isolated from Bushehr Coastal Water. Gene Rep. 2022, 26, 101473. [Google Scholar] [CrossRef]
  39. Nowicki, S.; deLaurent, Z.R.; de Villiers, E.P.; Githinji, G.; Charles, K.J. The Utility of Escherichia Coli as a Contamination Indicator for Rural Drinking Water: Evidence from Whole Genome Sequencing. PLoS ONE 2021, 16, e0245910. [Google Scholar] [CrossRef]
  40. Stoppe, N.d.C.; Silva, J.S.; Carlos, C.; Sato, M.I.Z.; Saraiva, A.M.; Ottoboni, L.M.M.; Torres, T.T. Worldwide Phylogenetic Group Patterns of Escherichia Coli from Commensal Human and Wastewater Treatment Plant Isolates. Front. Microbiol. 2017, 8, 2512. [Google Scholar] [CrossRef] [PubMed]
  41. Tettey, R.; Egyir, B.; Tettey, P.; Arko-Mensah, J.; Addo, S.O.; Owusu-Nyantakyi, C.; Boateng, W.; Fobil, J. Genomic Analysis of Multidrug-Resistant Escherichia Coli from Urban Environmental Water Sources in Accra, Ghana, Provides Insights into Public Health Implications. PLoS ONE 2024, 19, e0301531. [Google Scholar] [CrossRef]
  42. Koh, X.P.; Shen, Z.; Woo, C.F.; Yu, Y.; Lun, H.I.; Cheung, S.W.; Kwan, J.K.C.; Lau, S.C.K. Genetic and Ecological Diversity of Escherichia Coli and Cryptic Escherichia Clades in Subtropical Aquatic Environments. Front. Microbiol. 2022, 13, 811755. [Google Scholar] [CrossRef]
  43. Lübcke, P.; Heiden, S.E.; Homeier-Bachmann, T.; Bohnert, J.A.; Schulze, C.; Eger, E.; Schwabe, M.; Guenther, S.; Schaufler, K. Multidrug-Resistant High-Risk Clonal Escherichia Coli Lineages Occur along an Antibiotic Residue Gradient in the Baltic Sea. npj Clean Water 2024, 7, 94. [Google Scholar] [CrossRef]
  44. Dhengesu, D.; Lemma, H.; Asefa, L.; Tilahun, D. Antimicrobial Resistance Profile of Enterobacteriaceae and Drinking Water Quality Among Households in Bule Hora Town, South Ethiopia. Risk Manag. Healthc. Policy 2022, 15, 1569–1580. [Google Scholar] [CrossRef]
  45. Ghimire, B.; Pokhrel, M.K.; Banjara, M.; Rijal, K.R.; Ghimire, P. Antimicrobial Resistance in Escherichia Coli and Other Coliform Bacteria Isolated from Bagmati River. Tribhuvan Univ. J. Microbiol. 2023, 10, 95–104. [Google Scholar] [CrossRef]
  46. Araújo, S.; Silva, V.; de Lurdes Enes Dapkevicius, M.; Pereira, J.E.; Martins, Â.; Igrejas, G.; Poeta, P. Comprehensive Profiling of Klebsiella in Surface Waters from Northern Portugal: Understanding Patterns in Prevalence, Antibiotic Resistance, and Biofilm Formation. Water 2024, 16, 1297. [Google Scholar] [CrossRef]
  47. Ibrahim, G.; Mzula, A.; Makundi, I.; Mwega, E. Prevalence, Antimicrobial Susceptibility Profile of Citrobacter and Risk Factors Associated with Diarrheal Diseases in Water Wells in Urban West Region, Zanzibar. Open Access Libr. J. 2024, 11, 1–21. [Google Scholar] [CrossRef]
  48. Waegenaar, F.; García-Timermans, C.; Van Landuyt, J.; De Gusseme, B.; Boon, N. Impact of Operational Conditions on Drinking Water Biofilm Dynamics and Coliform Invasion Potential. Appl. Environ. Microbiol. 2024, 90, e0004224. [Google Scholar] [CrossRef]
  49. Oyewale, A.T.; Odetoyin, B.W.; Oluduro, A.O.; Adeniyi, I.F. Occurrence of Coliforms and Biofilm-Forming Bacteria in Raw, Treated, and Distributed Water from Two Waterwork Systems in Osun State, Southwestern Nigeria. J. Water Health 2024, 22, 673–688. [Google Scholar] [CrossRef]
  50. Sakkas, H.; Bozidis, P.; Ilia, A.; Mpekoulis, G.; Papadopoulou, C. Antimicrobial Resistance in Bacterial Pathogens and Detection of Carbapenemases in Klebsiella Pneumoniae Isolates from Hospital Wastewater. Antibiotics 2019, 8, 85. [Google Scholar] [CrossRef]
  51. Kalla, D.H.; Paila, D.M. A Study of Klebsiella Pneumoniae Isolated from Water Samples in and around Tirupati. Pharma Innov. J. 2023, 12, 413–417. [Google Scholar]
  52. Feng, J.; Zhou, L.; Zhao, X.; Chen, J.; Li, Z.; Liu, Y.; Ou, L.; Xie, Z.; Wang, M.; Yin, X.; et al. Evaluation of Environmental Factors and Microbial Community Structure in an Important Drinking-Water Reservoir across Seasons. Front. Microbiol. 2023, 14, 1091818. [Google Scholar] [CrossRef] [PubMed]
  53. Ho, J.Y.; Jong, M.-C.; Acharya, K.; Liew, S.S.X.; Smith, D.R.; Noor, Z.Z.; Goodson, M.L.; Werner, D.; Graham, D.W.; Eswaran, J. Multidrug-Resistant Bacteria and Microbial Communities in a River Estuary with Fragmented Suburban Waste Management. J. Hazard. Mater. 2021, 405, 124687. [Google Scholar] [CrossRef] [PubMed]
  54. Hartinger, S.M.; Medina-Pizzali, M.L.; Salmon-Mulanovich, G.; Larson, A.J.; Pinedo-Bardales, M.; Verastegui, H.; Riberos, M.; Mäusezahl, D. Antimicrobial Resistance in Humans, Animals, Water and Household Environs in Rural Andean Peru: Exploring Dissemination Pathways through the One Health Lens. Int. J. Environ. Res. Public Health 2021, 18, 4604. [Google Scholar] [CrossRef]
  55. Gutkind, G.O.; Conza, J.D.; Power, P.; Radice, M. β-Lactamase-Mediated Resistance: A Biochemical, Epidemiological and Genetic Overview. Curr. Pharm. Des. 2013, 19, 164–208. [Google Scholar] [CrossRef]
  56. Bajaj, P.; Singh, N.S.; Virdi, J.S. Escherichia Coli β-Lactamases: What Really Matters. Front. Microbiol. 2016, 7, 417. [Google Scholar] [CrossRef]
  57. Ferro, P.; Morales, E.; Ticona, E.; Ferró-Gonzales, P.; Oblitas, A.; Ferró-Gonzáles, A.L. Water Quality and Phenotypic Antimicrobial Resistance in Isolated of E. Coli from Water for Human Consumption in Bagua, under One Health Approach. Heliyon 2024, 10, e23961. [Google Scholar] [CrossRef]
  58. Duarte, A.C.; Rodrigues, S.; Afonso, A.; Nogueira, A.; Coutinho, P. Antibiotic Resistance in the Drinking Water: Old and New Strategies to Remove Antibiotics, Resistant Bacteria, and Resistance Genes. Pharmaceuticals 2022, 15, 393. [Google Scholar] [CrossRef]
  59. Kalu, C.M.; Mudau, K.L.; Masindi, V.; Ijoma, G.N.; Tekere, M. Occurrences and Implications of Pathogenic and Antibiotic-Resistant Bacteria in Different Stages of Drinking Water Treatment Plants and Distribution Systems. Heliyon 2024, 10, e26380. [Google Scholar] [CrossRef]
  60. Kalli, M.; Noutsopoulos, C.; Mamais, D. The Fate and Occurrence of Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes during Advanced Wastewater Treatment and Disinfection: A Review. Water 2023, 15, 2084. [Google Scholar] [CrossRef]
  61. Makuwa, S.; Green, E.; Tlou, M.; Ndou, B.; Fosso-Kankeu, E. Molecular Classification and Antimicrobial Profiles of Chlorination-Resistant Escherichia Coli at Wastewater Treatment Plant in the North West Province of South Africa. Water Air Soil Pollut. 2023, 234, 490. [Google Scholar] [CrossRef]
  62. Umar, M. From Conventional Disinfection to Antibiotic Resistance Control—Status of the Use of Chlorine and UV Irradiation during Wastewater Treatment. Int. J. Environ. Res. Public Health 2022, 19, 1636. [Google Scholar] [CrossRef] [PubMed]
  63. Yu, D.; Ryu, K.; Zhi, S.; Otto, S.J.G.; Neumann, N.F. Naturalized Escherichia Coli in Wastewater and the Co-Evolution of Bacterial Resistance to Water Treatment and Antibiotics. Front. Microbiol. 2022, 13, 810312. [Google Scholar] [CrossRef] [PubMed]
  64. Nasrollahian, S.; Graham, J.P.; Halaji, M. A Review of the Mechanisms That Confer Antibiotic Resistance in Pathotypes of E. coli. Front. Cell. Infect. Microbiol. 2024, 14, 1387497. [Google Scholar] [CrossRef]
  65. Park, J.-H.; Bae, K.-S.; Kang, J.; Yoon, J.-K.; Lee, S.-H. Comprehensive Assessment of Multidrug-Resistant and Extraintestinal Pathogenic Escherichia Coli in Wastewater Treatment Plant Effluents. Microorganisms 2024, 12, 1119. [Google Scholar] [CrossRef] [PubMed]
  66. Kichana, E.; Opare-Boafoa, M.S.; Bekoe, E.M.O. Prevalence of Multidrug-Resistant Escherichia Coli in Household Drinking Water in Rural Ghana. J. Water Sanit. Hyg. Dev. 2022, 12, 862–868. [Google Scholar] [CrossRef]
  67. Lyimo, B.; Buza, J.; Subbiah, M.; Smith, W.; Call, D.R. Comparison of Antibiotic Resistant Escherichia Coli Obtained from Drinking Water Sources in Northern Tanzania: A Cross-Sectional Study. BMC Microbiol. 2016, 16, 254. [Google Scholar] [CrossRef]
  68. European Centre for Disease Prevention and Control. Antimicrobial Consumption in the EU/EEA (ESAC-Net)—Annual Epidemiological Report 2021; ECDC: Stockholm, Sweden, 2022. [Google Scholar]
  69. European Centre for Disease Prevention and Control and World Health Organization. Antimicrobial Resistance Surveillance in Europe 2023—2021 Data; European Centre for Disease Prevention and Control and World Health Organization: Stockholm, Sweden, 2023. [Google Scholar]
  70. Kritsotakis, E.I.; Lagoutari, D.; Michailellis, E.; Georgakakis, I.; Gikas, A. Burden of Multidrug and Extensively Drug-Resistant ESKAPEE Pathogens in a Secondary Hospital Care Setting in Greece. Epidemiol. Infect. 2022, 150, e170. [Google Scholar] [CrossRef]
  71. Zhou, Y.; Zhou, Z.; Zheng, L.; Gong, Z.; Li, Y.; Jin, Y.; Huang, Y.; Chi, M. Urinary Tract Infections Caused by Uropathogenic Escherichia Coli: Mechanisms of Infection and Treatment Options. Int. J. Mol. Sci. 2023, 24, 10537. [Google Scholar] [CrossRef]
  72. Wanke-Rytt, M.; Sobierajski, T.; Lachowicz, D.; Seliga-Gąsior, D.; Podsiadły, E. Analysis of Etiology of Community-Acquired and Nosocomial Urinary Tract Infections and Antibiotic Resistance of Isolated Strains: Results of a 3-Year Surveillance (2020–2022) at the Pediatric Teaching Hospital in Warsaw. Microorganisms 2023, 11, 1438. [Google Scholar] [CrossRef] [PubMed]
  73. Whelan, S.; Lucey, B.; Finn, K. Uropathogenic Escherichia Coli (UPEC)-Associated Urinary Tract Infections: The Molecular Basis for Challenges to Effective Treatment. Microorganisms 2023, 11, 2169. [Google Scholar] [CrossRef] [PubMed]
  74. Akinjogunla, O.J.; Odeyemi, A.T.; Udofia, E.-A.S.; Adefiranye, O.O.; Yah, C.S.; Ehinmore, I.; Etukudo, I.U. Enterobacteriaceae Isolates from Clinical and Household Tap Water Samples: Antibiotic Resistance, Screening for Extended-Spectrum, Metallo- and ampC-Beta-Lactamases, and Detection of blaTEM, blaSHV and blaCTX-M in Uyo, Nigeria. Germs 2023, 13, 50–59. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Map of Greece (green color) with the distribution of drinking water samples from urban and rural sites of Central South Greece (red stars) during the period 2018–2022.
Figure 1. Map of Greece (green color) with the distribution of drinking water samples from urban and rural sites of Central South Greece (red stars) during the period 2018–2022.
Applsci 15 02664 g001
Figure 2. (A) The percentage of antibiotic resistance of E. coli isolates (n = 46) from drinking water recorded per phylogroup in connection with the tested antibiotics. AM: ampicillin; AMC: amoxicillin/clavulanic acid; CAZ: ceftazidime; CFR: cefadroxil; CTX: cefotaxime; FOX: cefoxitin; CIP: ciprofloxacin; CN: gentamicin; MEM: meropenem; SXT: trimethoprim/sulfamethoxazole; TE: tetracycline. Antibiotics of the same group classified into groups referred to as A-G: A: AM and AMC; B: CAZ, CFR, CTX, and FOX; C: CIP; D: CN; E: MEM; F: SXT; G: TE. (B) The percentage of antibiotic resistance of coliform isolates (n = 114) from drinking water recorded per genus in connection with the tested antibiotics. AM: ampicillin; AMC: amoxicillin/clavulanic acid; CAZ: ceftazidime; CFM: cefixime; CFR: cefadroxil; CTX: cefotaxime; CXM: cefuroxime; FEP: cefepime; FOX: cefoxitin; CIP: ciprofloxacin; CN: gentamicin; IMP: imipenem; MEM: meropenem; SXT: trimethoprim/sulfamethoxazole; TE: tetracycline. Antibiotics of the same group classified into groups referred to as A-G, where Group A: AM and AMC; Group B: CAZ, CFM, CFR, CTX, CXM, and FEP, and FOX; Group C: CIP; Group D: CN; Group E: IMP and MEM; Group F: SXT; Group G: TE.
Figure 2. (A) The percentage of antibiotic resistance of E. coli isolates (n = 46) from drinking water recorded per phylogroup in connection with the tested antibiotics. AM: ampicillin; AMC: amoxicillin/clavulanic acid; CAZ: ceftazidime; CFR: cefadroxil; CTX: cefotaxime; FOX: cefoxitin; CIP: ciprofloxacin; CN: gentamicin; MEM: meropenem; SXT: trimethoprim/sulfamethoxazole; TE: tetracycline. Antibiotics of the same group classified into groups referred to as A-G: A: AM and AMC; B: CAZ, CFR, CTX, and FOX; C: CIP; D: CN; E: MEM; F: SXT; G: TE. (B) The percentage of antibiotic resistance of coliform isolates (n = 114) from drinking water recorded per genus in connection with the tested antibiotics. AM: ampicillin; AMC: amoxicillin/clavulanic acid; CAZ: ceftazidime; CFM: cefixime; CFR: cefadroxil; CTX: cefotaxime; CXM: cefuroxime; FEP: cefepime; FOX: cefoxitin; CIP: ciprofloxacin; CN: gentamicin; IMP: imipenem; MEM: meropenem; SXT: trimethoprim/sulfamethoxazole; TE: tetracycline. Antibiotics of the same group classified into groups referred to as A-G, where Group A: AM and AMC; Group B: CAZ, CFM, CFR, CTX, CXM, and FEP, and FOX; Group C: CIP; Group D: CN; Group E: IMP and MEM; Group F: SXT; Group G: TE.
Applsci 15 02664 g002
Figure 3. (A) The percentage of E. coli isolates per phylogroup detected in drinking water, divided into levels of drug resistance spanning from one to four groups of antibiotics. AMR1: exhibiting resistance to 1 group of antibiotics; AMR2: exhibiting resistance to 2 groups of antibiotics; MDR3: exhibiting resistance to 3 groups of antibiotics; MDR4: exhibiting resistance to 4 groups of antibiotics; Total AMR: AMR1 + AMR2; Total MDR: MDR3 + MDR4; The total AMR + MDR: exhibiting resistance to at least one antibiotic. (Β) The percentage of coliform isolates per genus detected in drinking water, divided into levels of drug resistance spanning from one to four groups of antibiotics. AMR1: exhibiting resistance to 1 group of antibiotics; AMR2: exhibiting resistance to 2 groups of antibiotics; MDR3: exhibiting resistance to 3 groups of antibiotics; MDR4: exhibiting resistance to 4 groups of antibiotics; Total AMR: AMR1 + AMR2; Total MDR: MDR3 + MDR4; Total AMR + MDR: exhibiting resistance to at least one antibiotic.3.4. AMR/MDR Classification of Antibiotic Resistance of Microbial Isolates.
Figure 3. (A) The percentage of E. coli isolates per phylogroup detected in drinking water, divided into levels of drug resistance spanning from one to four groups of antibiotics. AMR1: exhibiting resistance to 1 group of antibiotics; AMR2: exhibiting resistance to 2 groups of antibiotics; MDR3: exhibiting resistance to 3 groups of antibiotics; MDR4: exhibiting resistance to 4 groups of antibiotics; Total AMR: AMR1 + AMR2; Total MDR: MDR3 + MDR4; The total AMR + MDR: exhibiting resistance to at least one antibiotic. (Β) The percentage of coliform isolates per genus detected in drinking water, divided into levels of drug resistance spanning from one to four groups of antibiotics. AMR1: exhibiting resistance to 1 group of antibiotics; AMR2: exhibiting resistance to 2 groups of antibiotics; MDR3: exhibiting resistance to 3 groups of antibiotics; MDR4: exhibiting resistance to 4 groups of antibiotics; Total AMR: AMR1 + AMR2; Total MDR: MDR3 + MDR4; Total AMR + MDR: exhibiting resistance to at least one antibiotic.3.4. AMR/MDR Classification of Antibiotic Resistance of Microbial Isolates.
Applsci 15 02664 g003aApplsci 15 02664 g003b
Table 1. (A) The target regions, the oligonucleotide primers, the product size, and the thermal profile of the amplification product of the PCR assay incorporated into the phylogroup analysis of E. coli isolates from drinking water [18,19]. (B) The target regions, the oligonucleotide primers, the product size, and the thermal profile of the amplification product of the PCR assay incorporated into the genus assignment of coliform isolates from drinking water [20].
Table 1. (A) The target regions, the oligonucleotide primers, the product size, and the thermal profile of the amplification product of the PCR assay incorporated into the phylogroup analysis of E. coli isolates from drinking water [18,19]. (B) The target regions, the oligonucleotide primers, the product size, and the thermal profile of the amplification product of the PCR assay incorporated into the genus assignment of coliform isolates from drinking water [20].
(A)
TargetOligonucleotide Sequence (5′-3′)Product SizeThermal Profile
chuAF: ATGGTACCGGACGAACCAAC
R: TGCCGCCAGTACCAAAGACA
28895 °C for 10 min
95 °C for 20 s
59 °C * for 30 s
72 °C for 15 s
72 °C for 10 min
Applsci 15 02664 i00130c
yjaAF: CAAACGTGAAGTGTCAGGAG
R: AATGCGTTCCTCAACCTGTG
211
TspE4.C2F: CACTATTCGTAAGGTCATCC
R: AGTTTATCGCTGCGGGTCGC
152
arpAF: AACGCTATTCGCCAGCTTGC
R: TCTCCCCATACCGTACGCTA
400
arpAF: GATTCCATCTTGTCAAAATATGCC
R: GAAAAGAAAAAGAATTCCCAAGAG
301
trpAF: AGTTTTATGCCCAGTGCGAG
R: TCTGCGCCGGTCACGCCC
219
cfaBF: CTAACGTTGATGCTGCTCTG
R: TGCTAACTACGCCACGGTAG
384
ybgDF: TATGCGGCTGATGAAGGATC
R: GTTGACTAAGCGCAGGTCGA
177
trpA
Internal Control
F: CGGCGATAAAGACATCTTCAC
R: GCAACGCGGCCTGGCGGAAG
489
(B)
TargetOligonucleotide Sequence (5′-3′)Product SizeThermal Profile
lacZF: ATGAAAGCTGGCTACAGGAAGGCC
R: CACCATGCCGTGGGTTTCAATATT
87695 °C for 5 min
95 °C for 30 s
60 °C for 30 s
72 °C for 45 s
72 °C for 10 min
Applsci 15 02664 i00135c
lamBF: GGATATTTCTGGTCCTGGTGCCGG
R: ACTTGGTGCCGTTGTCGTTATCC
554
* 57 °C for primers targeting phyloroup C region trpA.
Table 2. (A) Antibiotic susceptibility testing of E. coli isolates (n = 220) from drinking water with reference to EUCAST classification criteria (% of total). (B) Antibiotic susceptibility testing of coliforms (n = 138) isolated from drinking water with reference to EUCAST classification criteria (% of total).
Table 2. (A) Antibiotic susceptibility testing of E. coli isolates (n = 220) from drinking water with reference to EUCAST classification criteria (% of total). (B) Antibiotic susceptibility testing of coliforms (n = 138) isolated from drinking water with reference to EUCAST classification criteria (% of total).
(A)
AM
(%)
AMC
(%)
CAZ
(%)
CFR
(%)
CTX
(%)
FOX
(%)
CIP
(%)
CN
(%)
MEM
(%)
SXT
(%)
TE
(%)
Resistant36 (16.4)6 (2.7)2 (0.9)9 (4.1)1 (0.5)9 (4.1)4 (1.8)0 (0.0)0 (0.0)9 (4.1)21 (9.5)
Intermediate0 (0.0)0 (0.0)1 (0.5)0 (0.0)1 (0.5)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)2 (0.9)
Susceptible184 (83.6)214 (97.3)217 (98.6)211 (95.9)218 (99.1)211 (95.9)216 (98.2)220 (100)220 (100)211 (95.9)197 (89.5)
Total220220220220220220220220220220220
(B)
AM
(%)
AMC
(%)
CAZ
(%)
CFM
(%)
CFR
(%)
CTX
(%)
CXM
(%)
FEP
(%)
FOX
(%)
CIP
(%)
CN
(%)
IMP
(%)
MEM
(%)
SXT
(%)
TE
(%)
Resistant100 (72.5)62 (44.9)21 (15.2)6 (4.3)54 (39.1)21 (15.2)2 (1.4)0 (0.0)63 (45.7)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)3 (2.2)
Intermediate0 (0.0)0 (0.0)1 (0.7)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (0.7)
Susceptible38 (27.5)76 (55.1)116 (84.1)132 (95.7)84 (60.9)117 (84.8)136 (98.6)138 (100)75 (54.3)138 (100)138 (100)138 (100)138 (100)138 (100)134 (97.1)
Total138138138138138138138138138138138138138138138
AM: ampicillin; AMC: amoxicillin/clavulanic acid; CAZ: ceftazidime; CFM: cefixime; CFR: cefadroxil; CTX: cefotaxime; CXM: cefuroxime; FEP: cefepime; FOX: cefoxitin; CIP: ciprofloxacin; CN: gentamicin; IMP: imipenem; MEM: meropenem; SXT: trimethoprim/sulfamethoxazole; TE: tetracycline.
Table 3. Percentage of MDR3 and MDR4 isolates of E. coli (n = 12) and coliforms (n = 4) exhibiting resistance to the respective group of antibiotics.
Table 3. Percentage of MDR3 and MDR4 isolates of E. coli (n = 12) and coliforms (n = 4) exhibiting resistance to the respective group of antibiotics.
Antibiotic Group
A (%)B (%)C (%)D (%)E (%)F (%)G (%)
E. coli
MDR39 of 9 (100.0)3 of 9 (33.3)3 of 9 (33.3)0 of 9 (0.0)0 of 9 (0.0)4 of 9 (44.4)8 of 9 (88.9)
MDR43 of 3 (100.0)2 of 3 (66.7)1 of 3 (33.3)0 of 3 (0.0)0 of 3 (0.0)3 of 3 (100.0)3 of 3 (100.0)
Total12 of 12 (100.0)5 of 12 (41.7)4 of 12 (33.3)0 of 12 (0.0)0 of 12 (0.0)7 of 12 (58.3)11 of 12 (91.7)
Coliforms
MDR34 of 4 (100.0)4 of 4 (100.0)0 of 4 (0.0)0 of 4 (0.0)0 of 4 (0.0)0 of 4 (0.0)4 of 4 (100.0)
Antibiotics of the same group classified into groups referred to A–G: A: ampicillin and amoxicillin/clavulanic acid; B: ceftazidime, cefixime, cefadroxil, cefotaxime, cefuroxime, cefepime, and cefoxitin; C: ciprofloxacin; D: gentamicin; E: imipenem and meropenem; F: trimethoprim/sulfamethoxazole; G: tetracycline. MDR3: isolates exhibiting resistance to 3 groups of antibiotics; MDR4: isolates exhibiting resistance to 4 groups of antibiotics.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tzimotoudis, N.; Mataragka, A.; Andritsos, N.D.; Ikonomopoulos, J. Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece. Appl. Sci. 2025, 15, 2664. https://doi.org/10.3390/app15052664

AMA Style

Tzimotoudis N, Mataragka A, Andritsos ND, Ikonomopoulos J. Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece. Applied Sciences. 2025; 15(5):2664. https://doi.org/10.3390/app15052664

Chicago/Turabian Style

Tzimotoudis, Nikolaos, Antonia Mataragka, Nikolaos D. Andritsos, and John Ikonomopoulos. 2025. "Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece" Applied Sciences 15, no. 5: 2664. https://doi.org/10.3390/app15052664

APA Style

Tzimotoudis, N., Mataragka, A., Andritsos, N. D., & Ikonomopoulos, J. (2025). Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece. Applied Sciences, 15(5), 2664. https://doi.org/10.3390/app15052664

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop