Next Article in Journal
Considerations on the Design, Printability and Usability of Customized 3D-Printed Upper Limb Orthoses
Next Article in Special Issue
Effect of Processing and Storage of Very-Low-Sugar Apple Jams Prepared with Sugar Substitution by Steviol Glycosides on Chosen Physicochemical Attributes and Sensory and Microbiological Quality
Previous Article in Journal
Hazardous High-Energy Seismic Event Discrimination Method Based on Region Division and Identification of Main Impact Factors: A Case Study
Previous Article in Special Issue
Nutritional Analysis of Plant-Based Meat: Current Advances and Future Potential
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 14
Issue 14
10.3390/app14146155
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of Sourdough Bread Made with Probiotic Lactiplantibacillus plantarum Bacteria Addition

by
Dorota Zielińska
* and
Aleksandra Kostrzewska
Institute of Human Nutrition Sciences, Warsaw University of Life Sciences (WULS), Nowoursynowska St. 159C, 02-776 Warsaw, Poland
*
Author to whom correspondence should be addressed.
Appl. Sci. 2024, 14(14), 6155; https://doi.org/10.3390/app14146155
Submission received: 1 June 2024 / Revised: 7 July 2024 / Accepted: 12 July 2024 / Published: 15 July 2024
(This article belongs to the Special Issue Advanced Food Processing Technologies and Food Quality)
Browse Figures
Versions Notes

Abstract

:
Bread is a staple in the diet of people around the world. A new solution is the addition of selected strains of bacteria to the sourdough to increase the quality of the obtained bread. In the presented research, seven bread samples were baked and analysed, which differed by the selected strain of bacteria of the Lactiplantibacillus plantarum species used in sourdough preparation. The bread was subjected to a 3-day ageing test. The structure of the products was analysed using the texture profile analysis (TPA) method on days 1 and 3 of storage. It was observed that the samples with the addition of selected L. plantarum bacterial strains underwent the process of staling much slower than the control sample. The analysis of the viability of lactic acid bacteria (LAB) in products after 1 and 3 days of storage was also performed. The obtained results indicate the highest survival rate of LAB in the control sample, i.e., the native microflora of baker’s starters, which was at 3.07 log CFU after one-day storage after baking. In the case of other samples, the viability of the bacteria was below 2.74 log CFU, which confirms a certain degree of thermostability of selected bacterial strains. The belonging of the isolated bacteria to the species L. plantarum was proven via genetic identification using the PCR method. A sensory analysis using the quantitative descriptive profile (QDP) method was also performed on the bread immediately after it was baked and cooled down. The analysis showed that the use of L. plantarum strains as starters did not significantly affect the aromatic and taste profiles of the samples compared to the control sample. The overall quality of the bread samples was high, above 6 units, with the control sample having the highest sensory quality of 7.5 units (on a scale of 0–10 units). The presented research suggests that it is possible to produce bread with bacteria that have health-promoting properties and good sensory quality, which enhances the textural features of the final product. Future research will focus on attempting to microencapsulate selected thermostable probiotic bacteria.

1. Introduction

The United Nations Sustainable Development Goals also apply to food production, and measures to reduce food waste must be taken to reduce water consumption, ensure a reduction in environmental pollution and reduce hunger. This thread of issues is complex, although any action aimed at reducing food waste is extremely valuable. According to the European Commission, based on Eurostat data, 20% of the sum of food produced is wasted [1]. One of the largest groups of food waste is bread. According to the Waste and Resources Action Programme, bread waste accounts for 10% of the total food waste in the UK [2]. In Baltic countries such as Sweden, Poland, and Finland, between 10 and 25% of the bread produced is wasted at various stages of the food chain [3,4,5,6]. One of the ways to reduce the waste of bread is to extend its freshness period.
Sourdough bread is less susceptible to staleness, and its period of consumer attractiveness for consumption is extended [7]. It has been reported that the use of sourdough in breadmaking contributes to an improvement in the volume, texture and sensory quality scores of bread, an increase in bread acidity and the amount of low molecular weight dextrins, and an improvement in the bread physical and microbiological shelf life compared to straight doughs [8]. Sourdough production technology is believed to be the oldest biotechnological process used to produce cereal-based foods [9]. Traditional sourdough is made from water and flour by spontaneous fermentation. The constant propagation of microorganisms is maintained by the addition of a new portion of the nutrient medium to the sourdough every day. In this case, flour is mixed with water and added to the leaven. The process of sourdough fermentation should take place at a temperature of 20 °C to 30 °C, and if carried out correctly, sourdough with rich microbiota and high metabolic activity is obtained [10]. Many groups of microorganisms enter leaven microbiota; these are mainly lactic acid bacteria (LAB), acetic acid bacteria (AAB), and yeast. In the flour, there could be a presence of bacteria from the Enterobacteriaceae family, as well as the Staphylococcus aureus and Bacillus cereus species, but in the initial phase of fermentation, the environment is quickly dominated by LAB and does not allow the development of pathogenic or spoilage microbiota [11]. The main LAB species in sourdough are, among others, Limosilactobacillus reuteri, Lactobacillus amylovorus, Lactiplantibacillus plantarum, Levilactobacillus brevis, Lactobacillus paralimentarius, Fructilactobacillus sanfranciscensis, Limosilactobacillus fermentum, Lactobacillus curvastus, Lactobacillus sakei, and Pediococcus pentosaceus [11,12]. On the other hand, the main yeast species are Saccharomyces cerevisiae, Kazakhstania humilis, Yarrowia keelungesis, Torulaspora delbrueckii, and Pichia kudriavzevii [12]. Often overlooked bacteria in the description of sourdough are AAB (mainly Acetobacter malorum, A. pasteurianus, and A. lovaniensis), which have an undoubted impact on the quality and sensory profile of the obtained bread [13,14]. Such a rich variety of microbiota in sourdough affects its fermentation properties and determine the overall quality of the bread.
Bread production with the use of sourdough is a very sensitive method, which depends on various parameters that must be controlled. Most important is the thorough selection of a starter culture with specific and desirable properties for acidification during fermentation, as well as the fermentation temperature. Starter cultures can be defined as microbiological preparations containing a large number of cells of at least one microorganism that cause the fermentation of the product to which they were added, while maintaining stability and microbiological purity, and thus ensuring the safety of the final food product [15]. For mixes of this type of sourdough, strains of Lactobacillus fermentum, Lactobacillus sanfranciscensis and Lactobacillus plantarum are most often used due to their ability to quickly acidify the mixture of flour and water and produce aromas. The selection of starter cultures based on their desirable technological, sensory, and nutritional aspects are most important in the sourdough bread production process [10].
A new approach in modern bread technology development is to introduce selected strains of health-promoting bacteria into bread or sourdough and therefore improve its nutritional and technological value. This work aimed to determine the survival rate of the selected candidate of probiotic L. plantarum strains in sourdough bread as well as to assess the impact of added bacterial strains on the texture, freshness, and sensory characteristics of bread during simulations of typical bread storage at home.

2. Materials and Methods

2.1. Scheme of Experiment

A diagram of the experiment and the analyses performed is presented on Figure 1.

2.1.1. Baker’s Sourdough Preparation

Baker’s leaven was produced by the method of spontaneous fermentation. The sourdough contained sterile water and whole-grain rye flour (Basia, Good Mills LLC., Stradunia, Poland) combined in a ratio of 1:1 (wsw). Portions of flour and water were added to the sourdough once a day in the same proportions to stimulate the growth of native microorganisms and the fermentation process. The fermentation process took 5 days at temp. 27 °C. The sourdough prepared in this way was used for further stages of the research.

2.1.2. Lactiplantibacillus plantarum Strains Preparation and Sourdough Enrichment

Four strains previously isolated from Polish traditional food products and characterised according to their selected probiotic properties, L. plantarum Os1, L. plantarum Os2 [16], and L. plantarum O19, L. plantarum O20 [17,18,19], as well as two additional strains, L. plantarum ATCC 8014 and L. plantarum 299v (isolated from diet supplement Sanprobi LLC., Szczecin, Poland), were used in the present study. All bacterial strains were activated from a frozen culture stored at a temperature of −80 °C by incubation at a temperature of 37 °C for 24 h in 5 mL of DE Man, Rogosa, Sharpe broth (MRS, Neogen Company, Bridgend, UK). Subsequently, 1 mL of the suspension of each strain was taken separately and added to 9 mL of fresh MRS medium. Bacterial cultures were incubated overnight at temp. 37 °C. After incubation, the tubes were centrifuged for 5 min at 10,000 rpm (laboratory centrifuge MPW-251; MPW MED Instruments, Warsaw, Poland) to separate pellet cells from the medium. The supernatant was replaced with 0.85 g 100 g−1 saline, and the centrifugation procedure was performed 3 times to remove the residual growth medium. Finally, the biomass was suspended in 2.5 mL of sterile physiological saline for each strain separately and added to the bakery sourdoughs (50 g). The count of bacteria in the suspension prepared in this way was approx. 11 log CFU mL−1. The leaven was combined with the strains in sterile laboratory beakers with a lid. The sourdough was then stored for 4 h at temp. 37 °C to allow the added bacteria to adapt to the sourdough environment. The sourdough containers were then transferred to a cooling temperature of temp. 4 °C for another 48 h to prepare the dough.

2.1.3. Bread Preparation

Tap water, wheat flour 1 or “5 Stagioni” (Agugiaro & Figna Molini Inc., Collecchio, Italy), wheat flour 2 or “bread flour” (Przedsiębiorstwo Zbożowo-Młynarskie, Inc., Władysławowo, Poland), whole-grain rye flour (Basia, Good Mills LLC., Warsaw, Poland), and salt were used for the production of bread. Saccharomyces cerevisiae bakery yeast (Dr Oetker, L.P., Bielefeld, Germany) was also added to the samples based on previous research, which made it possible to achieve better consistency of the bread. The proportions of ingredients and the composition of the individual bread variants are presented in Table 1.
The preparation of bread started with mixing the entire volume of the leaven (100%) used with 15% of the amount of water indicated in the recipe and the entire volume of rye flour (100%) indicated in the recipe; the mixture was left at temp. 37 °C for 3 h. The resulting mixtures were then combined with the rest of the ingredients in separate bowls of the Kitchen Aid mixer (Whirlpool Corporation, Inc., Benton Harbor, MI, USA), and the dough was kneaded for 5 min. The dough pieces were then formed and put into baking containers. The fermentation and growth of the dough took place at temp. 4 °C for 12 h. The dough pieces (300 g ± 15 g) were baked at temp. 150 °C for 30 min. After this time, the finished samples were cooled to temp. 22 °C and wrapped in food paper for storage. The bread samples were stored for 3 days, aiming to simulate the typical storage of fresh, unpackaged bread at home. The bread and dough samples were marked with the name of the different bacterial strains, i.e., Os1, Os2, O19, O20, 8014, and 299v, added to the sourdough. The name of the control sample was shortened to SBY (sourdough bread with the addition of baker’s yeast).

2.2. Microbiological Analysis

The analysis of the amount of of LAB, AAB, and yeast was performed on the dough pieces before baking and on the 1st and 3rd days after baking the bread. Samples (10 g) were taken randomly from other places in the central part of the breadcrumb, and than placed in 90 mL of sterile peptone water (PW, Biocorp, Warsaw, Poland). The samples were homogenised in a laboratory blender for 1 min, then PW was used to dilute them. MRS agar (Neogen Company, Bridgend, UK) was used to detect LAB. The deep inoculation method technique was used. Petri dishes with appropriate dilution in the solidified medium were incubated anaerobically at temp. 37 °C for 48 h. GCA (glucose calcium carbonate agar) medium was used to detect AAB. The amount of AAB was determined by the spread plate technique. Growth medium was prepared according to [20,21]. The Petri plates with the solidified medium and the serially diluted samples were incubated at temp. 28 °C for 72 h. The number of yeasts was determined by the spread plate technique. The growth medium was YGC (yeast extract glucose chloramphenicol agar) (Biokar Diagnostic, Allonne, France). Serial dilutions of the sample were applied to the Petri dishes with the solidified growth medium and spread. The incubation of cultures took place for 5 days at temp. 25 °C. Microbial colonies were counted after incubation if they were in the range of 30–300 colonies. The results are presented on a logarithmic scale as log CFU per g.

2.3. PCR Analyses

Characteristic colonies of LAB bacteria were isolated from MRS agar plates from the microbiological part of the study, and using the streak plate technique, pure cultures were obtained. A total of 20 pure bacterial cultures were isolated: four from each sample of 8014 and SDY, and three from each sample of Os1, Os2, 299v, and O20. The colonies from the plates were transferred to 5 mL MRS broth using a loop. The samples were incubated at temp. 37 °C for 48 h, then the bacterial DNA was isolated using the commercial Genomic Mini AX Bacteria + Spin kit (A&A Biotechnology, Gdansk, Poland). The process was carried out in accordance with with the manufacturer’s manual. The purity and concentration of the isolated DNA were determined in NanoDrop (Thermo Scientific, Waltham, MA, USA). The PCR reaction–amplification of bacterial genetic material was performed using a pair of Lpla-3 (ATTCATAGTCTAGTTGGAGGT) and Lpla-2 (CCTGAACTGAGAGAATTTGA) primers at a concentration of 20 μM [22]. The composition of the reaction mixture contained 12.5 μL of 2xPCR Master Mix RAPID (A&A Biotechnology, Poland), 9.5 μL of RNA-free water (A&A Biotechnology, Poland), and 1 μL of primers and bacterial DNA. The control negative (C-) sample contained 1 μL of RNA-free water, and the control positive sample (C+) contained DNA from the pure culture of L. plantarum 299v. The entire PCR reaction was performed in a LabCycler thermocycler (SensQuest, Göttingen, Germany). The program included initial denaturation for 2 min at temp. 95 °C, which was then repeated 35 times in cycles of denaturation for 30 s at temp. 95 °C, primer attachment for 1 min at temp. 60 °C, and extension for 1 min at temp. 68 °C, the whole process ending with a final extension lasting 5 min at temp. 74 °C [22]. After the PCR reaction, the products of the amplified genetic material were separated electrophoretically on a 1.5% (w/v) agarose gel (Prona-abo, Poland) with ethidium bromide (Sigma Aldrich, Poznań, Poland) in 1 × TBE buffer (A&A Biotechnology, Poland) for 50 min. at a voltage of 120 V. The PCR reaction amplified the DNA fragment with 248 bp, characteristic of L. plantarum, which was detected in accordance with DNA marker M100-500 (DNA Gdańsk, Gdansk, Poland). The results obtained via electrophoretic separation were documented in BioDoc-It UVP 1-Door Imaging System (Cole-Parmer, Vernon Hills, IL, USA).

2.4. Texture Analysis

The mechanical properties of the bread crumb were tested via the TPA method using CT3 Texture Analyzer (Ametek Brookfield Inc., Middleborough, MA, USA) with the following accessories: TA-BT-KIT and TA4/1000 (38.1 mm). The following were analysed: hardness 1, hardness 2, elasticity, gumminess, and chewiness. The study was carried out on the 1st and 3rd day of storage of the bread. The test consisted of double-squeezing a sample with dimensions of 20 × 20 × 20 mm from the centre of the loaf. The method of Zięć [23] with a modification was used for the analysis. An attachment measuring a diameter of 38.1 mm was used at a speed of 60 mm min−1 to observe 50% of the sample’s deformation.

2.5. Sensory Analyses

Sensory analysis was carried out using the quantitative descriptive profile (QDP) method [24] immediately after baking and cooling the bread. The QDP is a strict laboratory method in which consumers do not participate. Before starting the analysis, experts were trained with the use of reference samples of bread. First, there was a discussion among the experts, after which the characteristics of the bread were determined. The target QDP analysis was carried out by a group of 11 experts using an unstructured linear scale [0–10 conventional units (c.u.)]. Each expert analysed the samples in duplicate. During analysis, the following characteristics were assessed: the intensity of bread, cereal, fermentation, and other odours. The texture properties of the breadcrumb and its appearance were assessed. The following were analysed: colour, elasticity, porosity, viscosity, the impression of humidity, and pore size. Also, the intensity of bread, cereal, sour, salty, bitter, and other flavours, together with the overall quality, was evaluated. For the discriminants related to the intensity of odour and flavour, the boundary terms of the scale were “none” and “very strong”. Appropriate boundary terms were adjusted to textural and colour determinants. Boundary terms related to the overall quality of products were “low” and “high”. Overall quality in the QDP method is expressed as the harmonisation of all product characteristics and is not related to the expression of the hedonic quality. The pieces of bread for analysis were placed in plastic containers with a lid. Each sample for analysis weighed approx. 30 g. The samples were coded and arranged for analysis in a random order. The analysis was performed under laboratory conditions at temp. 20 °C with constant light in separate evaluation rooms. Still water at room temperature was added between the samples to neutralise the taste.

2.6. Statistical Analyses

Firstly, all the results obtained in experiments were checked via the homogeneity of variance test, and the Shapiro–Wilk normality test and Brown–Forsythe test were performed. The results of microbiological and texture analysis were subjected to multivariate ANOVA. The results of the sensory evaluation were analysed using one-way ANOVA. Significant differences between the samples were determined using the Tukey HSD post hoc test. The results of the sensory and texture tests were analysed via principal component analysis (PCA) with the use of a covariance. A multivariate analysis of variance (MANOVA) was performed using means as the response design, and significances were reported in accordance with Wilks’ lambda. MANOVA was used for statistical comparisons of samples, days of storage, and both analysed parameters. All statistical analyses were performed using Statistica 13 (StatSoft, Poland). A heatmap was created using both Excel 2019 MSO and Statistica software. The difference was considered statistically significant when p < 0.05. Error bars in figures and values after “±” in tables represent the SD.

3. Results

3.1. Microbiological and PCR Analyses

The results of the microbiological analysis are presented in Table 2.
In the study, spontaneous fermented sourdough (SBY) was used, as was SBY enriched with selected Lactiplantibacillus plantarum strains (Os1, Os2, O19, O20, 8014, and 299v). It was found that the microbial survivability of LAB in all tested samples was affected (p < 0.05) by the applied baking temperature. Initially, before baking, the LAB count in all the samples ranged from 7.99 to 8.74 log cfu/g, while after baking and 1–3 days of storage, the LAB count decreased to 3.07–3.52 log CFU/g in the case of the SBY sample, and did not exceed 3 log CFU/g in the case of other samples. The bacteria most resistant to the baking temperature of bread turned out to be those in the control sample (SBY), whereas the LAB that were present in the O19 and O20 samples were the least resistant to high temperatures. The survival of LAB in other samples and their change after 1–3 days of storage were at similar levels. The AAB and yeast counts in the bread before and after baking are presented in Table 2. The count of AAB and yeast between the samples did not differ significantly before baking (p > 0.05). In most samples, both AAB and yeast were inactivated as a result of heat treatment, and their concentration did not increase during storage of the breads.
The results of genetic identification of the selected bacteria cultures isolated from bread samples are presented in Appendix A, Figure A1. It was found that the isolated strains mostly belong to the species of L. plantarum.

3.2. Texture Analysis

The results of texture analysis are presented in Table 3 and Table 4, and the photos of bread samples are included in Figure 2.
Texture parameters were changed during storage in a manner characteristic of the changes that take place in bread. The parameters hardness, chewiness, and gumminess increased during storage. The level of deformation after the storage time decreased. These changes occurred in all samples with different intensities, although statistical analysis only showed significant differences (p < 0.05) between the control sample (SBY) and the other tested samples. An important issue was the lack of a significant (p > 0.05) effect of storage time on texture parameters in samples with the addition of L. plantarum. Thus, all the samples with the addition of L. plantarum were significantly different from the control sample (p < 0.05), and to a lesser extent became stale. At the same time, the control sample became the stalest, and in this case, the changes in texture were the greatest. The hardness values of 1 and 2 increased during storage in the SBY sample by 5.85 N and 5.43 N. For samples with the addition of strains of L. plantarum, this value increased on average by 1.28 N and 1.22 N throughout the storage time. A similar phenomenon was observed in the parameters gumminess and chewiness. The gumminess value in the control sample increased by 2.69 N and the chewiness value by 24.6 mJ. For samples with the addition of L. plantarum, the mean value changed by 0.43 N (gumminess) and 3.29 mJ (chewiness). Springiness was the most stable parameter, without statistical differences in texture during the storage time (p > 0.05).
Table 4, as determined using MANOVA analysis, shows that the sample and the storage time both separately and in combination had a significant effect (p < 0.001) on hardness 1 and 2, as well as on the chewiness values. In the case of springiness and gumminess, only the treatment (starter culture of L. plantarum bacteria used) had a significant effect (p < 0.001), but storage time had no effect (p > 0.05) on the measured parameters.
Figure 3 shows the results of the PCA of the TPA and compares them with the heatmap (Figure 3B) for the values obtained in the same analysis.
The place of the sample cases in the coordinate system shows differences between the samples after one day of storage and after three days of storage. The greater the distance of samples with the same strain designation as each other, the greater the changes in texture observed during storage. The location of the sample cases after 1 and 3 days of storage with the addition of the L. plantarum strains indicates the similarity between them at these two points in time. Importantly, samples with the addition of L. plantarum strains are located much closer together than the SBY controls, which are at the extremes of the coordinate system. This result directly proves the influence of L. plantarum strains on the slowdown of staling changes in bread.

3.3. Sensory Analysis

The results of the sensory analysis are shown in Figure 4.
The odour and flavour profile of the samples were characteristic of sourdough bread, and dominated by notes of the odour and flavour of the bread, odour and flavour of cereal, and odour of fermentation; sour flavour, bitter flavour, and other odours and flavours remained at a low level (<2 c.u.) for all samples. The intensity of salty taste was similar for all samples, which indicates the lack of influence of L. plantarum bacteria on the intensity of this distinguishing feature. Overall, the tested samples did not differ significantly (p > 0.05) in the odour and flavour analysis. Among the distinguishing features of appearance and texture, significant differences were observed in terms of the following factors: elasticity (p < 0.05) (the O20 sample was significantly less elastic than the others) and humidity (p < 0.05) (the SBY sample was significantly different from the others). An element that balances out all the distinguishing features evaluated in the profile analyses is the overall quality. The SBY sample was significantly better than all other bread samples (p < 0.05) in terms of the overall quality. It was characterised by general quality, above 7.5 c.u. In addition, important information on the quality of bread and the impact of individual sensory characteristics was provided by the PCA analysis.
The PCA projection is shown in Figure 5. The overall quality was strongly correlated with elasticity, typical for bread odour and flavour, as well as salty and sour flavour. The direct result indicated by this analysis shows the negative impact of the factors responsible for fermentation on the pore size of the bread. In addition, it can be stated that the bread’s viscosity, different bitter taste, and humidity had a negative impact on its overall quality.

4. Discussion

Based on the obtained results and literature data, it can be concluded that the presence and amount of yeast, AAB, and LAB were characteristic of sourdough bread before and after baking [11]. In the case of baked sourdough with the addition of pure cultures of Lactiplantibacillus plantarum bacteria during preparation, environmental competition may occurred. The introduced LAB strains may have competed with the indigenous microbiota of the sourdough, leading to the domination of one group of microorganisms and the elimination of the native microbiota or that from the starter cultures. The strain showing the ability to dominate in the food system is L. plantarum; therefore, the addition of selected strains of this bacterial species gives great opportunities and chances to produce bread with a large population of bacteria with health-promoting properties [25]. Moreover, it was found that L. plantarum strains, during heat stimulation, may secrete specific proteins with various roles in cell physiology, including chaperone activity, ribosome stability, stringent response mediation, temperature sensing, and control of ribosomal function, which have been found to play a role in the mechanisms of stress adaptation of these bacteria [26]. Due to these properties, we decided to add selected L. plantarum strains of bacteria to the sourdoughs in the experiment.
The tested strains were isolated from regional cheeses (Os1 and Os2) and fermented cucumbers from organic farming (O19 and O20) [16,17,18,19], as well as a reference probiotic strain (299v) and ATCC 8014. Despite their probiotic properties and high resistance to stress factors, breads with these strains added to them were not characterised by a high amount of LAB after baking and after a storage period. It has been observed that native microbiota of sourdough had the best survival. Bacteria natively present in various food products are adapted to the environment of these products to the greatest extent [27,28]. The adaptation of bacteria consists of them adjusting their metabolism, enzymatic apparatus, and response to cellular stress [29]. Such a feature of bacteria can be an important factor in the production of food with added health-promoting strains of bacteria. However, it should be noted that high temperature is one of the most impactful factors in inactivating bacteria. For this reason, most methods of food preservation are based on this factor.
Moreover, to have health-promoting features, food should contain an appropriate number of probiotic bacteria. According to the FAO, the dose of probiotics that causes a pro-health effect on the host body is 106 CFU, and a 100 g portion provides the appropriate dose [30]. However, it is possible that under stress conditions, a bacterial cell can entera viable but not cultivable (VBNC) state. Probiotic strains during mild heat stress or storage may lose their culturability under laboratory conditions, and probably for this reason, bacterial survival in all tested samples was low. However, it was proven that bacteria cells under a VBNC state had maintained enzyme activity, membrane integrity, and pH gradients across the cell membrane, so they could be defined as alive [31]. Several publications suggest that non-viable probiotic microorganisms, sometimes, can also provide benefits to the consumer. Recently, a new definition of postbiotic was introduced. Postbiotics are a “preparation of inanimate microorganisms and/or their components that confers a health benefit on the host”. Effective postbiotics contain inactivated microbial cells or cell components, with or without metabolites, that contribute to observed health benefits [32]. During the baking process, probiotic bacteria are injured; some of them can enter a VBNC state, while some become inactivated, though the postbiotics may remain. Bread, due to its high consumption, which exceeds approximately 0.5 kg per week [2,17], is a food product that can serve as a matrix through which to deliver health-promoting microbiota and/or postbiotics to the human body.
Using the PCR method, it was proven that mostly L. plantarum strains survived in the bread samples. Interestingly, the presence of L. plantarum was also confirmed in the control samples (SBY). It should be emphasised that the used method did not determine the strain that given bacteria belonged to, only the genus. Therefore, the results of the separation of PCR reaction products did not give clear information on whether the bacteria in the tested samples were those added to the sourdough or the native microbiota. However, a factor that can confirm the strain of bacteria was the different numbers of them in the products after baking and their resistance to the temperature (Table 2), as well as the different quality features of the bread samples (Figure 2, Figure 4 and Figure 5) prepared with the addition of L. plantarum strains. It was assumed that when the pure bacterial biomass was added to bakery sourdoughs in the huge amount of approx. 11 log CFU, they competed with the native microbiota for nutrients and may have become the dominant strain [33].
L. plantarum was also chosen by other authors to assess survival in model bread. In the research of Zhang et al. [34], 30 g samples of bread with the addition of L. plantarum were baked at temp. 175 °C for 8 min. It was found that in the crumb of bread samples on the first day after baking, there was 3.82 ± 0.20 log CFU g−1 of LAB, and after 3 days of storage, the number increased to 4.51 ± 0.59 log CFU g−1. In our own study, only in SBY, as well as the Os1 and Os2 samples, did the LAB count increase between the first and third day of storage. In this case, the higher survival of LAB could have been due to the smaller size of the dough baked in comparison with the size of the dough in our own research, and thus the shorter baking time and lower exposure of LAB to thermal conditions. There is also a chance that the L. plantarum strain added in the cited study had a greater tolerance to high temperatures than the strains used in our own research.
Another approach that is used to increase the survival of bacteria is their microencapsulation. Penhasi et al. [35] used microencapsulated Bifidobacterium animalis spp. lactis NH019 to enrich bread with probiotics. The resulting survival was at the level of 4 log CFU g−1 immediately after baking the bread. Interestingly, these results are similar to those obtained in our own research (Table 2) and by Zhang et al. [34], where microencapsulated strains were not used. On the other hand, in the study by Seyedain-Ardabili et al. [36], the authors observed a extremely high survival (7 log CFU g−1) of L. casei 431 bacteria coated with chitosan microcapsules in bread after baking. This indicates that the thickness of the microcapsules and the number of coatings used determine the survival of bacteria. The limitation of the use of microcapsules in the production of bread is the cost of their production and their inability to develop and metabolise bacteria in the fortified product. When storing bread with added bacteria in the form of microcapsules, the number of them decreases with the time of storage [36]. This occurs due to the fixation of bacteria inside the microcapsules and the inhibition of their life cycle and then their inactivation over time. The opposite relationship was observed in our own studies where bacteria, during storage, multiplied and increased in number in the selected bread samples.
The greater durability of sourdough bread is a feature presented in many scientific works but is also known in baking practice. When comparing the quality changes in sourdough bread during the storage process, it was found that it was more durable than bread produced only with the addition of baker’s yeast [12]. In the present study, bread storage lasted 3 days, which is the typical time, simulating the consumer’s method of storing fresh bread at home. Moreover, bread samples were stored at room temperature (22 °C) and wrapped only in food paper, without any other specific conditions. An important and new issue revealed in the presented research is the phenomenon of the maintenance of most texture parameters in samples prepared with the addition of selected strains of L. plantarum to bakery sourdough. Interestingly, in the case of the control sample (SBY), these parameters changed unfavourably during the 3 days of storage. This can be explained by the fact that L. plantarum bacteria, which were added to the sourdough samples, can produce exopolysaccharides (EPS), which have rheological properties that improve the texture and consistency properties of some foods—including bread [37]. LAB properties for EPS production were tested by Torrieri et al. [38] in their study aimed at sourdough bread development. They used sourdough produced with and without the addition of EPS-synthesizing bacteria. In the research, they noticed that products containing EPS synthesised by bacteria were characterised by better durability and prolonged freshness. Also, Tamani et al. [39] used LAB strains (Lactobacillus delbrueckii subsp. bulgaricus LB18; L. delbrueckii subsp. bulgaricus CNRZ 737, and L. delbrueckii subsp. bulgaricus 2483) with a high ability to synthesise EPS. The authors noted that a higher level of EPS obtained from LAB could result in greater water retention, leading to improved properties of the crumb structure of bread and a longer shelf life. Another factor that affects the extension of the shelf life of bread is the acidification of the environment by the LAB contained in sourdough [40]. Acidification of the environment leads to a decrease in the activity of proteases and amylases, which directly affects the reduction in the degradation of protein and starch fractions of bread, thus extending its shelf life.
The sensory evaluation was carried out to characterise the sensory profiles of the bread samples and assess whether the introduction of new bacterial strains would significantly affect the taste and smell of the product. To answer this question, sensory evaluation was carried out on fresh bread samples, without continuing the research on stored samples, unlike in instrumental texture tests. It was found that the addition of selected L. plantarum strains affected the sensory properties of the bread samples. Although all samples represented the typical flavour of bread, they were different in terms of consistency. The decrease in the elasticity of the O20 sample was most likely due to the properties of L. plantarum enzymes. It has been proven that some strains of L. plantarum can synthesise proteolytic enzymes and that this is a strain-dependent feature [41]. The O20 and O19 strains were tested for enzymatic activity and several selective arylamidases were found to show activity on leucine, valine, and trypsin [17]. These enzymes can integrate into the structures of peptides and amino acids, reducing their properties [42]. In some studies, such properties have been used to reduce the allergenic effects of gluten through its bacterial enzymatic degradation. Unfortunately, the ongoing proteolysis harmed the texture properties of bread, causing its less stable structure, reducing its elasticity, and increasing its softness [43,44].
On the other hand, the SBY sample had the lowest humidity. This result may have been directly influenced by the previously mentioned properties of L. plantarum bacteria, which are able to EPS synthesis. These substances are characterised by high water absorption and very good rheological properties [45]. Due to the lack of addition of specific L. plantarum bacteria to the SBY sample, EPS were probably not formed in the same amount as in samples with the addition of a huge amount of L. plantarum strains. The lower humidity of the SBY sample was probably due to this relationship.
The overall sensory quality testifies to the quality properties of the analysed food to the greatest extent, determining its high or low sensory quality [46]. In this case, the SBY sample had better quality than all other bread samples. This result indicates the effect of decreasing sensory properties of the added strains of L. plantarum on the overall sensory quality of bread. The reason for the decrease in the quality of bread enriched with L. plantarum strains compared with that of the sample from the control trial is complex and dependent on many factors. A decrease in the sensory quality of bread with added bacteria may be attributed to changes due to the production of aromatic and flavour compounds, which could negatively affect the quality of the analysed samples. On the other hand, the added strains of L. plantarum may have had no ability to produce the aromatic compounds found in sourdough and bread without modified microbiota. These factors may have reduced the sensory quality of the analysed bread, which could be taken into consideration in a future study.

5. Conclusions

The results of the research suggest that it is possible to produce bread with health-promoting or probiotic bacteria with good sensory properties. It was found that strain differences within one species may be significant in terms of resistance to high-temperature baking. A very important aspect of the conducted research is the result indicating a slowdown in the ageing of bread in samples with the addition of selected strains of L. plantarum. Such strains can be used in bakery technology and at the same time reduce food waste.
The presented research requires continuation to more deeply examine the shelf life of this type of bread under different temperature and humidity conditions, taking into account the survivability of probiotic bacteria. An important aspect from the point of view of technological usefulness may be the analysis of aromatic properties of bread and the analysis of other bacteria species to obtain higher survival in finished products and thus increase the probiotic potential of such products. A promising direction for further research is the microencapsulation of selected bacteria, which could enhance the survivability of bacteria. However, in this case, probiotics would have to be added as additional functional cultures after the fermentation process to only introduce a therapeutic effect [47].

Author Contributions

Conceptualisation, D.Z.; methodology, D.Z.; software, D.Z.; validation, D.Z. and A.K.; formal analysis, D.Z.; investigation, D.Z. and A.K.; resources, D.Z.; data curation, D.Z.; writing—original draft preparation, D.Z. and A.K.; writing—review and editing, D.Z.; visualisation, D.Z.; supervision, D.Z.; project administration, D.Z.; funding acquisition, D.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Rector’s Committee for the Ethics of Scientific Research Involving Humans at WULS-SGGW (Resolution No. 28/RKE/2023/U of 6 July 2023).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data are available from the corresponding author. The data are not publicly available due to privacy.

Acknowledgments

The authors thank Marcin Kruk for the valuable laboratory support provided.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Applsci 14 06155 g0a1
Figure A1. A. Photo of agarose gel after separation of PCR reaction products.
Figure A1. A. Photo of agarose gel after separation of PCR reaction products.
Applsci 14 06155 g0a1
Explanatory notes: The sample codes represent different strains isolated from the bread samples; C+ represents the positive control with genetic material isolated from the pure 299v strain; C− represents the negative control without genetic material; 248 bp represents the DNA fragment searched for.

References

  1. Food Waste. Available online: https://ec.europa.eu/food/safety/food-waste_en (accessed on 20 May 2024).
  2. WRAP. Food Surplus and Waste in the UK—Key Facts; The Waste and Resources Action Programme: Banbury, UK, 2021. Available online: www.wrap.org.uk/food-drink (accessed on 20 May 2024).
  3. Ghosh, R.; Eriksson, M. Food waste due to retail power in supply chains: Evidence from Sweden. Glob. Food Secur. 2019, 20, 1–8. [Google Scholar] [CrossRef]
  4. Brancoli, P.; Bolton, K.; Eriksson, M. Environmental impacts of waste management and valorisation pathways for surplus bread in Sweden. Waste Manag. 2020, 117, 136–145. [Google Scholar] [CrossRef] [PubMed]
  5. Tomaszewska, M.; Bilska, B.; Kołożyn-Krajewska, D. Food Waste in Catering Establishments—An Analysis of Causes and Consequences. Eur. J. Sustain. Dev. 2021, 10, 365. [Google Scholar] [CrossRef]
  6. Immonen, M.; Maina, N.H.; Wang, Y.; Coda, R.; Katina, K. Waste bread recycling as a baking ingredient by tailored lactic acid fermentation. Int. J. Food Microbiol. 2020, 327, 108652. [Google Scholar] [CrossRef]
  7. Axel, C.; Zannini, E.; Arendt, E.K. Mold spoilage of bread and its biopreservation: A review of current strategies for bread shelf life extension. Crit. Rev. Food Sci. Nutr. 2017, 57, 3528–3542. [Google Scholar] [CrossRef]
  8. Paramithiotis, S.; Chouliaras, Y.; Tsakalidou, E.; Kalantzopoulos, G. Application of selected starter cultures for the production of wheat sourdough bread using a traditional three-stage procedure. Process Biochem. 2005, 40, 2813–2819. [Google Scholar] [CrossRef]
  9. Chavan, R.S.; Chavan, S.R. Sourdough Technology—A Traditional Way for Wholesome Foods: A Review. Compr. Rev. Food Sci. Food Saf. 2011, 10, 169–182. [Google Scholar] [CrossRef]
  10. De Vuyst, L.; Van Kerrebroeck, S.; Harth, H.; Huys, G.; Daniel, H.M.; Weckx, S. Microbial ecology of sourdough fermentations: Diverse or uniform? Food Microbiol. 2014, 37, 11–29. [Google Scholar] [CrossRef] [PubMed]
  11. De Vuyst, L.; Neysens, P. The sourdough microflora: Biodiversity and metabolic interactions. Trends Food Sci. Technol. 2005, 16, 43–56. [Google Scholar] [CrossRef]
  12. Arora, K.; Ameur, H.; Polo, A.; Di Cagno, R.; Rizzello, C.G.; Gobbetti, M. Thirty years of knowledge on sourdough fermentation: A systematic review. Trends Food Sci. Technol. 2021, 108, 71–83. [Google Scholar] [CrossRef]
  13. Landis, E.A.; Oliverio, A.M.; McKenney, E.A.; Nichols, L.M.; Kfoury, N.; Biango-Daniels, M.; Shell, L.K.; Madden, A.A.; Shapiro, L.; Sakunala, S. The diversity and function of sourdough starter microbiomes. eLife 2021, 10, e61644. [Google Scholar] [CrossRef]
  14. Van Kerrebroeck, S.; Comasio, A.; Harth, H.; De Vuyst, L. Impact of starter culture, ingredients, and flour type on sourdough bread volatiles as monitored by selected ion flow tube-mass spectrometry. Food Res. Int. 2018, 106, 254–262. [Google Scholar] [CrossRef] [PubMed]
  15. Champagne, C.P.; Møllgaard, H. Production of probiotic cultures and their addition in fermented foods. In Chapter 19: Handbook of Fermented Functional Foods, 2nd ed.; Farnworth, E.R., Ed.; CRC Press: Boca Raton, FL, USA; Taylor & Francis: Abingdon, UK, 2008; pp. 513–532. [Google Scholar]
  16. Ołdak, A.; Zielińska, D.; Rzepkowska, A.; Kołożyn-Krajewska, D. Comparison of Antibacterial Activity of Lactobacillus plantarum Strains Isolated from Two Different Kinds of Regional Cheeses from Poland: Oscypek and Korycinski Cheese. Biomed. Res. Int. 2017, 2017, 6820369. [Google Scholar] [CrossRef] [PubMed]
  17. Zielińska, D.; Rzepkowska, A.; Radawska, A.; Zieliński, K. In Vitro Screening of Selected Probiotic Properties of Lactobacillus Strains Isolated from Traditional Fermented Cabbage and Cucumber. Curr. Microbiol. 2015, 70, 183–194. [Google Scholar] [CrossRef]
  18. Zielińska, D.; Długosz, E.; Zawistowska-Deniziak, A. Functional Properties of Food Origin Lactobacillus in the Gastrointestinal Ecosystem-in Vitro Study. Probiotics Antimicrob. Proteins 2019, 11, 820–829. [Google Scholar] [CrossRef]
  19. Zielińska, D.; Łepecka, A.; Ołdak, A.; Długosz, E.; Kołożyn-Krajewska, D. Growth and adhesion inhibition of pathogenic bacteria by live and heat-killed food-origin Lactobacillus strains or their supernatants. FEMS Microbiol. Lett. 2021, 368, fnab024. [Google Scholar] [CrossRef]
  20. Neffe-Skocińska, K.; Kruk, M.; Ścibisz, I.; Zielińska, D. The Novel Strain of Gluconobacter oxydans H32 Isolated from Kombucha as a Proposition of a Starter Culture for Sour Ale Craft Beer Production. Appl. Sci. 2022, 12, 3047. [Google Scholar] [CrossRef]
  21. Kruk, M.; Wójcik, T.; Trząskowska, M. Application of Kombucha tea brew and SCOBY symbiotic culture to produce fermented milk beverage. Żywność. Nauka Technol. Jakość 2019, 120, 97–108. [Google Scholar] [CrossRef]
  22. Song, Y.L.; Kato, N.; Liu, C.X.; Matsumiya, Y.; Kato, H.; Watanabe, K. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA. FEMS Microbiol. Lett. 2000, 187, 167–173. [Google Scholar] [CrossRef]
  23. Zięć, G. Właściwości teksturalne miękiszu i jakość chlebów pszenno-owsianych. Żywność Nauka Technol. Jakość 2016, 106, 102–117. [Google Scholar] [CrossRef]
  24. ISO 13299:2016; Sensory Analysis-Methodology-General Guidance for Establishing a Sensory Profile. ISO: Geneva, Switzerland, 2003.
  25. Piasecka-Jozwiak, K.; Chablowska, B.; Stefanska, I. Kultury starterowe w piekarstwie—możliwość odzwierciedlenia tradycyjnego procesu fermentacji poprzez kształtowanie mikrobiota zakwasów piekarskich w przemysłowej produkcji pieczywa. Postępy Mikrobiol. 2016, 55, 268–278. [Google Scholar]
  26. De Angelis, M.; Di Cagno, R.; Huet, C.; Crecchio, C.; Fox, P.F.; Gobbetti, M. Heat Shock Response in Lactobacillus plantarum. Appl. Environ. Microbiol. 2004, 70, 1336–1346. [Google Scholar] [CrossRef] [PubMed]
  27. Brooks, A.N.; Turkarslan, S.; Beer, K.D.; Lo, F.Y.; Baliga, N.S. Adaptation of cells to new environments. Wiley Interdiscip Rev. Syst. Biol. Med. 2011, 3, 544–561. [Google Scholar] [CrossRef] [PubMed]
  28. Gibbons, J.G.; Rinker, D.C. The genomics of microbial domestication in the fermented food environment. Curr. Opin. Genet. Dev. 2015, 35, 1–8. [Google Scholar] [CrossRef]
  29. Papadimitriou, K.; Alegría, Á.; Bron, P.A.; De Angelis, M.; Gobbetti, M.; Kleerebezem, M.; Lemos, J.A.; Linares, D.M.; Ross, P.; Stanton, C.; et al. Stress Physiology of Lactic Acid Bacteria. Microbiol. Mol. Biol. Rev. 2016, 80, 837–890. [Google Scholar] [CrossRef]
  30. Probiotics in Food: Health and Nutritional Properties and Guidelines for Evaluation; Food and Agriculture Organization of the United Nations: World Health Organization, FAO Food and Nutrition Paper. 2006. Available online: https://catalogue.nla.gov.au/catalog/3788914 (accessed on 20 May 2024).
  31. Wendel, U. Assessing viability and stress tolerance of probiotics—A review. Front. Microbiol. 2022, 12, 4351. [Google Scholar] [CrossRef]
  32. Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M.; Sanders, M.E.; Shamir, R.; Swann, J.R.; Szajewska, H.; et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef] [PubMed]
  33. Van der Meulen, R.; Scheirlinck, I.; Van Schoor, A.; Huys, G.; Vancanneyt, M.; Vandamme, P.; De Vuyst, L. Population dynamics and metabolite target analysis of lactic acid bacteria during laboratory fermentations of wheat and spelt sourdoughs. Appl. Environ. Microbiol 2007, 73, 4741–4750. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, L.; Taal, M.A.; Boom, R.M.; Chen, X.D.; Schutyser, M.A.I. Effect of baking conditions and storage on the viability of Lactobacillus plantarum supplemented to bread. Food Sci. Technol. = Lebensm. -Wiss. Und Technol. 2018, 87, 318–325. [Google Scholar] [CrossRef]
  35. Penhasi, A.; Reuveni, A.; Baluashvili, I. Microencapsulation May Preserve the Viability of Probiotic Bacteria During a Baking Process and Digestion: A Case Study with Bifidobacterium animalis Subsp. lactis in Bread. Curr. Microbiol. 2021, 78, 576–589. [Google Scholar] [CrossRef] [PubMed]
  36. Seyedain-Ardabili, M.; Sharifan, A.; Tarzi, B.G. The Production of Synbiotic Bread by Microencapsulation. Food Technol. Biotechnol. 2016, 54, 52–59. [Google Scholar] [CrossRef] [PubMed]
  37. Silva, L.A.; Lopes Neto JH, P.; Cardarelli, H.R. Exopolysaccharides produced by Lactobacillus plantarum: Technological properties, biological activity, and potential application in the food industry. Ann. Microbiol. 2019, 69, 321–328. [Google Scholar] [CrossRef]
  38. Torrieri, E.; Pepe, O.; Ventorino, V.; Masi, P.; Cavella, S. Effect of sourdough at different concentrations on quality and shelf life of bread. LWT-Food Sci. Technol. 2014, 56, 508–516. [Google Scholar] [CrossRef]
  39. Tamani, R.J.; Goh, K.; Brennan, C. Physico-Chemical Properties of Sourdough Bread Production Using Selected Lactobacilli Starter Cultures. J. Food Qual. 2013, 36. [Google Scholar] [CrossRef]
  40. Fadda, C.; Sanguinetti, A.M.; Del Caro, A.; Collar, C.; Piga, A. Bread Staling: Updating the View. Compr. Rev. Food Sci. Food Saf. 2014, 13, 473–492. [Google Scholar] [CrossRef]
  41. Lim, Y.H.; Foo, H.L.; Loh, T.C.; Mohamad, R.; Abdullah, N. Comparative studies of versatile extracellular proteolytic activities of lactic acid bacteria and their potential for extracellular amino acid productions as feed supplements. J. Anim. Sci. Biotechnol. 2019, 10, 15. [Google Scholar] [CrossRef]
  42. Acosta-Martînez, V.; Tabatabai, M.A. Arylamidase activity in soils: Effect of trace elements and relationships to soil properties and activities of amidohydrolases. Soil Biol. Biochem. 2001, 33, 17–23. [Google Scholar] [CrossRef]
  43. Karimi, N.; Zeynali, F.; Bari, M.R.; Nikoo, M.; Mohtarami, F.; Kadivar, M. Amaranth selective hydrolyzed protein influence on sourdough fermentation and wheat bread quality. Food Sci. Nutr. 2021, 9, 6683–6691. [Google Scholar] [CrossRef] [PubMed]
  44. Heredia-Sandoval, N.G.; Valencia-Tapia, M.Y.; Calderón de la Barca, A.M.; Islas-Rubio, A.R. Microbial Proteases in Baked Goods: Modification of Gluten and Effects on Immunogenicity and Product Quality. Foods 2016, 5, 59. [Google Scholar] [CrossRef]
  45. Wang, J.; Zhao, X.; Yang, Y.; Zhao, A.; Yang, Z. Characterization and bioactivities of an exopolysaccharide produced by Lactobacillus plantarum YW32. Int. J. Biol. Macromol. 2015, 74, 119–126. [Google Scholar] [CrossRef]
  46. Baryłko-Pikielna, N.; Matuszewska, I. Sensory Analisis of Food Basics—Methods—Applications; Wydawnictwo Naukowe PTTŻ: Kraków, Poland, 2014. [Google Scholar]
  47. Pejcz, E. Biotechnological Approach of Technological Advancements for Sustainable Probiotic Bread Production. Sustainability 2024, 16, 3275. [Google Scholar] [CrossRef]
Applsci 14 06155 g001
Figure 1. Schematic diagram of the experiment.
Figure 1. Schematic diagram of the experiment.
Applsci 14 06155 g001
Applsci 14 06155 g002
Figure 2. Photos of the cross-section of pieces of the analysed bread.
Figure 2. Photos of the cross-section of pieces of the analysed bread.
Applsci 14 06155 g002
Applsci 14 06155 g003
Figure 3. (A) Projection of principal component analysis (PCA) of TPA analysis and (B) heatmap of the value obtained in the TPA analysis. Explanatory notes: The distance between samples from different days of storage in the coordinate system represents the variability of texture parameters; the greater the distance, the greater the changes in the texture profile of the samples between 1 and 3 days of storage. The heatmap shows the variability in samples between days of storage for all tested parameters.
Figure 3. (A) Projection of principal component analysis (PCA) of TPA analysis and (B) heatmap of the value obtained in the TPA analysis. Explanatory notes: The distance between samples from different days of storage in the coordinate system represents the variability of texture parameters; the greater the distance, the greater the changes in the texture profile of the samples between 1 and 3 days of storage. The heatmap shows the variability in samples between days of storage for all tested parameters.
Applsci 14 06155 g003
Applsci 14 06155 g004
Figure 4. The sensory evaluation of the bread. Explanations: 0–10 c.u.—conventional unit; f.—flavour; o.—odour; n = 22; ٭—the tested samples differ significantly (p < 0.05).
Figure 4. The sensory evaluation of the bread. Explanations: 0–10 c.u.—conventional unit; f.—flavour; o.—odour; n = 22; ٭—the tested samples differ significantly (p < 0.05).
Applsci 14 06155 g004
Applsci 14 06155 g005
Figure 5. Projection of variables (discriminants) of principal component analysis (PCA) of sensory evaluation. Explanatory notes: o: odor; f.: flavour.
Figure 5. Projection of variables (discriminants) of principal component analysis (PCA) of sensory evaluation. Explanatory notes: o: odor; f.: flavour.
Applsci 14 06155 g005
Table 1. The proportions of ingredients in samples.
Table 1. The proportions of ingredients in samples.
Dough Ingredients [g 100 g−1]
WaterWheat Flour 1Wheat Flour 2Rye FlourSaltSourdoughBakery Yeast
41.9039.705.705.700.905.700.40
Table 2. The mean amounts of LAB, AAB, and yeast in the dough pieces before baking and in the bread.
Table 2. The mean amounts of LAB, AAB, and yeast in the dough pieces before baking and in the bread.
SampleLAB [log CFU g−1]AAB [log CFU g−1]Yeast [log CFU g−1]
Days of Storage
01st3th01st3th01st3th
SBY7.99 aA3.07 aB3.52 aB7.84 aA2.91 aB2.03 aB6.58 aA1.53 B1.59 aB
299V8.17 aA2.39 aB1.84aB7.70 aA1.03 aB1.69 aB6.39 aAnd1.53 aB
O198.15 aA1.00 aBnd7.48 aAndnd6.19 aAndnd
O208.18 aA1.80 aBnd8.15 bA1.43 aB0.94 aB6.33 aAndnd
Os18.17 aA0.63 aB1.56 aB7.98 aAnd0.66 aB5.92 aAnd0.83 aB
Os28.74 aAnd1.43 aB7.93 aA2.57 aBnd6.33 aAndnd
80148.03 aA2.74 aB1.26 aB7.71 aA0.66 aB1.53 aB6.33 aAndnd
Explanatory notes: letters a and b represent the statistical difference between samples in Tukey’s post hoc test (p < 0.05) at one point in time; the letters A and B represent the statistical difference in Tukey’s post hoc test (p < 0.05) between samples at other points in time.
Table 3. The mean value of the TPA test results for bread on day 1 and day 3 of storage.
Table 3. The mean value of the TPA test results for bread on day 1 and day 3 of storage.
Sample
(S)		Days of Storage
(D) 		Hardness 1
[N]		Hardness 2
[N]		Springiness [mm]Gumminess
[N]		Chewiness
[mJ]
SYB15.59 ± 1.10 a4.95 ± 0.89 a8.63 ± 0.48 a3.79 ± 0.67 a31.49 ± 5.38 a
311.44 ± 2.66 b10.38 ± 1.83 b8.51 ± 0.42 a6.48 ± 1.3 b56.09 ± 9.16 b
299V111.51 ± 1.5 a10.16 ± 1.33 a8.23 ± 0.48 a6.15 ± 0.81 a41.83 ± 4.93 a
311.85 ± 2.86 a10.29 ± 2.83 a7.71 ± 1.09 a6.21 ± 1.32 a47.79 ± 6.44 a
O1916.33 ± 0.95 a5.58 ± 0.84 a8.48 ± 0.56 a3.65 ± 0.5 a30.09 ± 4.19 a
37.93 ± 1.56 a6.89 ± 1.38 a8.33 ± 0.49 a3.91 ± 0.51 a31.58 ± 5.04 a
O2016.44 ± 1.33 a5.76 ± 1.11 a8.51 ± 0.42 a3.99 ± 0.77 a35.91 ± 5.87 a
37.29 ± 0.72 a6.29 ± 0.66 a8.39 ± 0.27 a4.07 ± 0.5 a37.23 ± 4.77 a
Os118.48 ± 1.69 a7.82 ± 2.43 a8.87 ± 0.25 a5.4 ± 1.62 a41.51 ± 5.49 a
310.34 ± 2.55 a9.56 ± 1.96 a8.73 ± 0.22 a5.66 ± 1.32 a47.87 ± 6.30 a
Os216.92 ± 1.31 a6.22 ± 1.18 a8.71 ± 0.32 a4.42 ± 0.67 a39.14 ± 6.21 a
39.23 ± 0.94 a9.20 ± 1.94 a8.56 ± 0.27 a5.68 ± 1.22 a43.00 ± 8.57 a
801417.54 ± 0.97 a7.27 ± 1.25 a8.84 ± 0.11 a5.12 ± 0.88 a39.41 ± 6.45 a
38.28 ± 0.94 a7.92 ± 1.04 a8.83 ± 0.17 a5.82 ± 0.71 a40.21 ± 5.55 a
Explanatory notes: letters a and b represent the statistical difference between the samples in the t-test (p < 0.05); statistical differences are demonstrated for one sample with tests for one parameter.
Table 4. Significance levels of the experimental factors and their interactions, as determined via MANOVA.
Table 4. Significance levels of the experimental factors and their interactions, as determined via MANOVA.
EffectHardness 1Hardness 2SpringinessGumminessChewiness
p-Value
Sample (S)0.0000000.0000000.0000020.0000010.000000
Days of storage (D)0.0000000.0000000.0956940.0929570.000406
Sample × Days of storage (S × D)0.0000000.0000000.6978490.0000000.000000
Conditions of analysis: parameterisation with sigma restrictions; breakdown of effective hypotheses. F was calculated from Wilks’ lambda; the p-value is the probability.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zielińska, D.; Kostrzewska, A. Development of Sourdough Bread Made with Probiotic Lactiplantibacillus plantarum Bacteria Addition. Appl. Sci. 2024, 14, 6155. https://doi.org/10.3390/app14146155

AMA Style

Zielińska D, Kostrzewska A. Development of Sourdough Bread Made with Probiotic Lactiplantibacillus plantarum Bacteria Addition. Applied Sciences. 2024; 14(14):6155. https://doi.org/10.3390/app14146155

Chicago/Turabian Style

Zielińska, Dorota, and Aleksandra Kostrzewska. 2024. "Development of Sourdough Bread Made with Probiotic Lactiplantibacillus plantarum Bacteria Addition" Applied Sciences 14, no. 14: 6155. https://doi.org/10.3390/app14146155

APA Style

Zielińska, D., & Kostrzewska, A. (2024). Development of Sourdough Bread Made with Probiotic Lactiplantibacillus plantarum Bacteria Addition. Applied Sciences, 14(14), 6155. https://doi.org/10.3390/app14146155

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop