Identification of Biochemical Differences in White and Brown Adipocytes Using FTIR Spectroscopy
Abstract
1. Introduction
2. Materials and Methods
2.1. Culture and Differentiation
2.2. Oil-Red-O Staining
2.3. Reverse Transcription Quantitative Polymerase Chain Reaction Analysis
2.4. Preparation and Collection of Infrared Spectroscopy Spectra
2.5. Statistical Analysis
3. Results
3.1. Differentiation of 3T3-L1 White Preadipocytes and Immortalized Brown Preadipocytes
3.2. FTIR Spectroscopy Spectra of Adipocyte Conditioned Media
3.3. FTIR Spectroscopy Spectra of Adipocytes
3.4. Discrimination of Adipocytes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Derrick, M.R.; Stulik, D.; Landry, J.M. Infrared spectroscopy in Conservation Science; Getty Publications: Los Angeles, CA, USA, 2000. [Google Scholar]
- Smith, Y. What Is Infrared Microscopy? Available online: https://www.news-medical.net/life-sciences/What-is-Infrared-Microscopy.aspx (accessed on 15 March 2022).
- Berthomieu, C.; Hienerwadel, R. Fourier transform infrared (FTIR) spectroscopy. Photosynth. Res. 2009, 101, 157–170. [Google Scholar] [CrossRef] [PubMed]
- Erukhimovitch, V.; Pavlov, V.; Talyshinsky, M.; Souprun, Y.; Huleihel, M. FTIR microscopy as a method for identification of bacterial and fungal infections. J. Pharm. Biomed. Anal. 2005, 37, 1105–1108. [Google Scholar] [CrossRef] [PubMed]
- Camacho, N.P.; West, P.; Torzilli, P.A.; Mendelsohn, R. FTIR microscopic imaging of collagen and proteoglycan in bovine cartilage. Biopolymers 2001, 62, 1–8. [Google Scholar] [CrossRef]
- Krafft, C.; Sergo, V. Biomedical applications of Raman and infrared spectroscopy to diagnose tissues. J. Spectrosc. 2006, 20, 195–218. [Google Scholar] [CrossRef]
- Haslam, D.W.; James, W.P. Obesity. Lancet 2005, 366, 1197–1209. [Google Scholar] [CrossRef]
- Pischon, T.; Boeing, H.; Hoffmann, K. General and Abdominal Adiposity and Risk of Death in Europe. J. Vasc. Surg. 2009, 49, 811–812. [Google Scholar] [CrossRef][Green Version]
- Aboualizadeh, E.; Carmichael, O.T.; He, P.; Albarado, D.C.; Morrison, C.D.; Hirschmugl, C.J. Quantifying Bio-chemical Alterations in Brown and Subcutaneous White Adipose Tissues of Mice Using Fourier Transform Infrared Widefield Imaging. Front. Endocrinol. 2017, 8, 121. [Google Scholar] [CrossRef]
- Ami, D.; Mereghetti, P.; Foli, A.; Tasaki, M.; Milani, P.; Nuvolone, M.; Palladini, G.; Merlini, G.; Lavatelli, F.; Natalello, A. ATR-FTIR Spectroscopy Supported by Multivariate Analysis for the Characterization of Adipose Tissue Aspirates from Patients Affected by Systemic Amyloidosis. Anal. Chem. 2019, 91, 2894–2900. [Google Scholar] [CrossRef]
- Wang, Z.; Zhang, H.; Wang, Q.; Zhang, K.; Liu, R.; Fan, S. Estimation of postmortem interval using attenuated total reflectance: Fourier transform infrared spectroscopy in adipose tissues. J. Forensic Sci. Med. 2019, 5, 7. [Google Scholar] [CrossRef]
- Baloğlu, F.K.; Severcan, F. Characterization and Differentiation of Adipose Tissue by Spectroscopic and Spectral Imaging Techniques. In Adipose Tissue; IntechOpen: London, UK, 2018. [Google Scholar] [CrossRef]
- Küçük Baloğlu, F. Biophysical Characterization and Diagnosis of Obesity from Adipose Tissue by Fourier Transform Infrared Spectroscopy and Imaging. Ph.D. Thesis, Middle East Technical University, Ankara, Turkey, 2017. [Google Scholar]
- Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885. [Google Scholar] [CrossRef]
- Betz, M.J.; Enerbäck, S. Targeting thermogenesis in brown fat and muscle to treat obesity and metabolic disease. Nat. Rev. Endocrinol. 2018, 14, 77–87. [Google Scholar] [CrossRef] [PubMed]
- Senthivinayagam, S.; Serbulea, V.; Upchurch, C.M.; Polanowska-Grabowska, R.; Mendu, S.K.; Sahu, S.; Jaya-guru, P.; Aylor, K.W.; Chordia, M.D.; Steinberg, L. Adaptive thermogenesis in brown adipose tissue involves acti-vation of pannexin-1 channels. Mol. Metab. 2021, 44, 101130. [Google Scholar] [CrossRef] [PubMed]
- Lu, F.; Mizuno, H.; Uysal, C.A.; Cai, X.; Ogawa, R.; Hyakusoku, H. Improved Viability of Random Pattern Skin Flaps through the Use of Adipose-Derived Stem Cells. Plast. Reconstr. Surg. 2008, 121, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Rosen, E.D.; Walkey, C.J.; Puigserver, P.; Spiegelman, B.M. Transcriptional regulation of adipogenesis. Genes Dev. 2000, 14, 1293–1307. [Google Scholar] [CrossRef] [PubMed]
- Seale, P.; Kajimura, S.; Yang, W.; Chin, S.; Rohas, L.M.; Uldry, M.; Tavernier, G.; Langin, D.; Spiegelman, B.M. Transcriptional Control of Brown Fat Determination by PRDM16. Cell Metab. 2007, 6, 38–54. [Google Scholar] [CrossRef] [PubMed]
- Baloglu, F.K.; Garip, S.; Heise, S.; Brockmann, G.; Severcan, F. FTIR imaging of structural changes in visceral and subcutaneous adiposity and brown to white adipocyte transdifferentiation. Analyst 2015, 140, 2205–2214. [Google Scholar] [CrossRef]
- Movasaghi, Z.; Rehman, S.; Rehman, I.U. Fourier Transform Infrared (FTIR) Spectroscopy of Biological Tissues. Appl. Spectrosc. Rev. 2008, 43, 134–179. [Google Scholar] [CrossRef]
- Mostaço-Guidolin, L.; Murakami, L.S.; Batistuti, M.; Nomizo, A.; Bachmann, L. Molecular and chemical characterization by Fourier transform infrared spectroscopy of human breast cancer cells with estrogen receptor expressed and not expressed. Spectroscopy 2010, 24, 501–510. [Google Scholar] [CrossRef]
- Huang, G.; Wu, Q.; Wong, J.; Nagar, B. Transformation of organic matter during co-composting of pig manure with sawdust. Bioresour. Technol. 2006, 97, 1834–1842. [Google Scholar] [CrossRef]
- Cooper, G.M.; Hausman, R.E. The Cell: A Molecular Approach; Sinauer Associates: Sunderland, MA, USA, 2000; Volume 2. [Google Scholar]
- Kučerka, N.; Perlmutter, J.D.; Pan, J.; Tristram-Nagle, S.; Katsaras, J.; Sachs, J.N. The effect of cholesterol on short-and long-chain monounsaturated lipid bilayers as determined by molecular dynamics simulations and X-ray scattering. Biophys. J. 2008, 95, 2792–2805. [Google Scholar] [CrossRef]
- Yang, H.; Yang, S.; Kong, J.; Dong, A.; Yu, S. Obtaining information about protein secondary structures in aqueous solution using Fourier transform IR spectroscopy. Nat. Protoc. 2015, 10, 382–396. [Google Scholar] [CrossRef] [PubMed]
- Barth, A. Infrared spectroscopy of proteins. Biochim. Biophys. Acta 2007, 1767, 1073–1101. [Google Scholar] [CrossRef] [PubMed]
- Cantile, M.; Procino, A.; D’Armiento, M.; Cindolo, L.; Cillo, C. HOX gene network is involved in the transcriptional regulation of in vivo human adipogenesis. J. Cell. Physiol. 2003, 194, 225–236. [Google Scholar] [CrossRef] [PubMed]
- Gesta, S.; Tseng, Y.-H.; Kahn, C.R. Developmental Origin of Fat: Tracking Obesity to Its Source. Cell 2007, 131, 242–256. [Google Scholar] [CrossRef]
- Timmons, J.A.; Wennmalm, K.; Larsson, O.; Walden, T.B.; Lassmann, T.; Petrovic, N.; Hamilton, D.L.; Gimeno, R.E.; Wahlestedt, C.; Baar, K.; et al. Myogenic gene expression signature establishes that brown and white adipocytes originate from distinct cell lineages. Proc. Natl. Acad. Sci. USA 2007, 104, 4401–4406. [Google Scholar] [CrossRef]
- Nakagami, H. The Mechanism of White and Brown Adipocyte Differentiation. Diabetes Metab. J. 2013, 37, 85–90. [Google Scholar] [CrossRef]






| Target Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Gapdh | GGGGTCCCAGCTTAGGTTCAT | TTCACACCGACCTTCACCATT |
| Ucp1 | AGGATTGGCCTCTACGACTCA | GCATTCTGACCTTCACGACCT |
| Pgc1α | TCTGGGTGGATTGAAGTGGTG | TCTGTGAGAACCGCTAGCAAG |
| Pparγ | TCCATTCACAAGAGCTGACCC | GGCCATGAGGGAGTTAGAAGG |
| Prdm16 | ACAAGTCCTACACGCAGTTC | CGTGTAATGGTTCTTGCCCT |
| aP2 | GCTTTGCCACAAGGAAAGTG | ACGCCCAGTTTGAAGGAAAT |
| Cebpα | TGGACAAGAACAGCAACGAGT | ACCTTCTGTTGCGTCTCCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shon, D.; Park, S.; Yoon, S.; Ko, Y. Identification of Biochemical Differences in White and Brown Adipocytes Using FTIR Spectroscopy. Appl. Sci. 2022, 12, 3071. https://doi.org/10.3390/app12063071
Shon D, Park S, Yoon S, Ko Y. Identification of Biochemical Differences in White and Brown Adipocytes Using FTIR Spectroscopy. Applied Sciences. 2022; 12(6):3071. https://doi.org/10.3390/app12063071
Chicago/Turabian StyleShon, DongHyun, SeJun Park, SukJun Yoon, and Yong Ko. 2022. "Identification of Biochemical Differences in White and Brown Adipocytes Using FTIR Spectroscopy" Applied Sciences 12, no. 6: 3071. https://doi.org/10.3390/app12063071
APA StyleShon, D., Park, S., Yoon, S., & Ko, Y. (2022). Identification of Biochemical Differences in White and Brown Adipocytes Using FTIR Spectroscopy. Applied Sciences, 12(6), 3071. https://doi.org/10.3390/app12063071

